21Novel

Font: Big Medium Small
Dark Eye-protection
21Novel > The Story of Hero Among Heroes ~The Founding Chronicles of Arestia > CH 94

CH 94

    Chapter 94 – Waterway Development


    Aquarius cried in response to Ares’ question.


    [That is… it was a long time ago… when this place was formed…]


    [Sorry, we are not exactly free here so can you make it brief?]


    [You are horrible despite your cute face, aren’t you…]


    Aquarius sighed, then began explaining.


    [In the past, this place wasn’t as gloomy as it is now. But… a demon lord settled down west from here, causing the aquatic magic beasts to increase in number and ended up living here. But… the biggest cause is probably… it…]


    Aquarius continued on with a vain voice.


    [A rock turtle… ate my kin. Thanks to that, it gained tremendous power… and became the lord of this swamp. But it wasn’t satisfied with that alone. It started attacking other water spirits as well, wanting to gain their strength. Especially this last decade, a lot of my kin were eaten by it.]


    At that point Aquarius began to sniffle.


    [Trying to do something, the head of the water spirit of this land, Sedna-sama went to meet that turtle, but…]


    [….I see. So simply put, we need to get rid of this magic beast from this area…]


    Ares nodded after hearing Aquarius’ story. She tried to rebuke him upon hearing his response.


    [….didn’t you hear me just now? About how it ate the head spirit of this place? About how it may have a power rivaling a dragon now?]


    [I did. But… it’s not like we should do nothing about it, right?]


    [If we could then we would’ve already done something ourselves! That creature is too strong…]


    [So that’s why… I’ll do it in your stead.]


    Ares said with a refreshing smile.


    Aquarius’ mouth was agape.


    [Ah, but if we managed to do it somehow… I’d like to forge a contract with the water spirits living in this place… deal?]


    Hearing that almost shameless offer… Aquarius could only sigh,


    [If you can do that, I’ll gladly forge any contract with you… I don’t care already what will happen to me next anyways…]


    Hearing her reply, Ares nodded in satisfaction.


    =====


    ◆


    [Y-you are an Army general!? I thought you were just a mere adventurer!]


    Aquarius complained upons seeing the fourth corps under Ares’ command.


    [But… even with this many soldiers, you are still not the opponent of that rock turtle…]


    [No, who said that my soldiers will deal with that turtle?]


    [Haa?]


    [I’ll deal with it myself.]


    [You…are you crazy?]


    In the midst of that exchange, the swamp began to churn. Perhaps sensing the arrival of the fourth corps… the magic beasts surfaced to attack from every direction.


    [That was fast… but not outside my expectations. Roland, can you execute the command that I told you earlier?]


    [Yes sir! As you command!]


    Roland then turned towards the thousand knights and began giving instructions.


    [You heard the order! Assume the Trinity formation as per usual and engage the magic beasts! Show them the might of Grants soldiers!]


    =====


    Since he became the lord of Grants, Ares had pointed out to both Sigurd and Darius the weakness of the Grants soldiers.


    Which were the low level of tactics and no coordination.


    They are strong. However… they tend to rely on individual performance. That’s why, Ares pressed the importance of understanding tactics and good coordination for their training. This 『Trinity Formation』was an anti-magic beast tactic that was previously employed in Schwarzer territory to battle beast attacks and was applied in the Grants army training regime starting from a few weeks ago.


    This time, he would see the result of the training in an actual combat situation.


    [Roland will take over the command. As for me… I’ll handle the big one.]


    Having said that, Ares looked further into the swamp.


    The deeper he looked, the more monsters entered his sight…


    A huge figure could be seen behind the swarming monsters.


    [It ate a lot of water spirits. Of course, its intelligence is quite high.]


    [Does Your Excellency require support…]


    [No. No need to worry about me.]


    Having said so, Ares used wind magic to convey his command to the entire forces.


    [The fourth corps, heed me. Begin the monster subjugation. Remember all the training you’ve gone through up until now and defeat the enemy before you. And then… let’s kick that big turtle’s ass!]


    [ [ [ [ [ [ [ Yes sir! ] ] ] ] ] ] ]


    The soldiers of the fourth corps shouted in affirmation to Ares’ words for they recognized him. The figure of Ares who did not fall against the onslaught of a million beasts.


    The words of such a hero would ignite any soldier’s heart.


    [Fourth corps, charge!]


    Thus the fourth corps charged towards the horde of magic beasts like hungry wolves.


    =====


    ◆


    The monsters were slaughtered one after another. The murky water of the swamp was dyed red with their blood.


    Grants soldiers had experienced fighting against larger numbers and varying kinds of monsters. These aquatic beasts were nothing much for them.


    On the contrary… they’re enjoying this subjugation.


    It’s because…they realized the advantages of this tactic they’ve trained in for a while.


    The Trinity formation was originally devised for use in Schwarzer territory which often got attacked by magic beasts.


    Organizing a group of three and fighting together back to back. While one fights, the other two guard the other directions. Then they switch positions as needed while pushing forward.


    All three will work together to finish their opponent.


    It’s very effective against monsters that attack from random directions.


    [Okay, they’re doing well.]


    [Without having to worry about their backs, they could focus on what’s standing before them. This is a good tactic.]


    The Grants soldiers held their ground.


    [Their cooperation could still use some more work… but Iexpected nothing less from Grants soldier, hm?]


    [This is surprising. I would be able to fight with ease this way. This tactic is great.]


    [The Grants soldiers are already strong. Once we strengthened their tactical and collaborative skills, they will be a force to be reckoned with. They’ll realize the importance of tactics from this battle.]


    Ares had a little talk with Roland as the two watched the battle unfolded. The swarm of aquatic monsters began to thin out. And seeing this… the rock turtle finally made a move.


    [Oh, the big guy has decided to move at last… well then, time to crush it once and for all. I’m sorry, but can you pull the soldiers out?]


    [Yes sir! As you command!]


    Roland immediately gave instructions and rang the retreat signal. In response, the soldiers also steadily retreated. Meanwhile, Ares got off from atop Saint and walked towards the Rock Turtle alone.


    [This swamp…it’s really hard to walk on. I really should end this soon.]


    Having said so, Ares pulled out the Oldeus of the Seven Heavenly Swords, and launched an invisible slash at the rock turtle.


    But his attack was met with a hard rebound. The rock turtle shell was so thick that Ares’ attack merely left a scratch on the surface.


    [Hmm….]


    Ares squinted his eyes after seeing the result of his first attack.


    The rock turtle in turn opened its maw and aimed it toward Ares. A swirl of shining magic power could be seen from its open mouth.


    Seeing the situation, Ares felt something odd. He turned around and realized .


    [What!? This is bad!]


    Behind him were the fourth corps. It’s crystal clear to Ares that the giant turtle would cause immense damage to the soldiers should it release its breath weapon.


    Ares hastily began casting a spell. Several magic diagrams appeared before him, and right then.


    Goooooooo!


    That noise meant that the giant turtle had released the immense magic power it has been accumulating in its mouth.


    Ares directed the magic circles to his front and…


    [Counter Spell!]


    The immense magic power was instantly reflected toward the giant turtle upon making contact with his magic diagram.


    [That is it, the『Non-elemental』magic, Counter Spell… with it I can reflect magic back unto its caster, but… is it enough?]


    He couldn’t see how the turtle’s faring due to the rising dust. So Ares relied on his hearing instead… and frowned.


    [It doesn’t budge at all… certainly, it’s more troublesome than a regular dragon.]


    Once the dust settled, he could see that the turtle had remained intact. Seeing this, Ares decided to change his approach.


    First, he retracted Oldeus and held the Seven Heavenly Sword handle tightly.


    [Such an amazing defense… but then, I’ll just have to attack it with strength strong enough to overwhelm it.]


    Ares strengthened his body with both magic power and fighting spirit. The silver aura of the『Magic Sword Style』enveloped his body.


    Then he called out its name.


    [Magic Sword Gram!]


    Responding to Ares’ voice, a black sword with swirling red aura appeared in his hand.


    [Well then… let’s see if you can endure this one!]


    Ares rushed towards the giant turtle with great momentum. The turtle tried to fight back with its claws and maw… but its retaliation was nothing against Ares’ greatly improved parameters.


    Ares advanced toward the turtle’s head, avoiding a claw strike in the process.


    [Now…let’s put an end to this once and for all!]


    He jumped over the head and slashed the magic sword Gram in a flash.


    Zugagagagagagagagagagagaa!!!!


    Following that slash, the turtle roared, before being promptly split into two.


    And at that moment…


    A mysterious sight unfolded before everyone’s eyes.


    The torn part of the giant turtle started to glow in a bluish light.


    [This is… I can sense the magic power of my kin!]


    Aquarius, who was watching from a distance, rushed to the corpse of the giant rock turtle.


    [Fuu.]


    As Ares took a breather, Roland came over to him.


    [That was splendid. Ares-sama.]


    [Yeah, I guess I managed to finish it somehow, didn’t I?]


    [Somehow…is it? That sounds easier said than done for the likes of us… no… the fact that you fought in a duel against my elder brother is… could it be…?]


    [It’s not the time to worry about little things like that, Roland. The aquatic beasts still remain. We need to sweep them off cleanly.]


    Roland snapped out from his amazed state after seeing such an incredible sight.


    [Yes! Pardon me, milord. I’m heading back to the soldiers now!]


    He immediately gave an order to all soldiers.


    [The rock turtle has been slain. Now it’s time to eliminate the rest of them! Let’s go!]


    [ [ [ [ [Haaaa!] ] ] ] ]


    The soldiers were all excited after seeing Ares’ fight. Their morale was sky high.


    After watching the situation with satisfaction, Ares turned around to check the turtle…and was surprised.


    [A lot of water spirits came out from its corpse… what is going on?]


    The reason why the corpse was shining blue… was because the water spirits overflowed from its body.


    [Oi! Ares!!]


    Ares noticed that Aquarius was waving at him from under the turtle’s shell.


    [Aquarius? What is going on?]


    [Thanks to you, everyone is saved! Thank you!]


    Aquarius then continued on excitedly.


    [Sedna-sama said that she wants to meet you, Ares! Come quick!]


    =====


    ◆


    The fourth corps managed to annihilate the remaining aquatic beasts.


    Although there were some injured… they got through without any casualties.


    [This many beasts… we can turn it into materials. Let’s send them to the guild later.]


    Hearing Roland’s report, Ares nodded.


    [This many magic beast materials should sell for a fairly high price, right? We can reorganize the money to help with the development. At this point, we could use all the funding we could get our hands on after all.]


    Having said that and chuckled in satisfaction, Ares turned his attention sideways.


    [Well then… let’s get to the point. Aquarius and also… Sedna-dono]


    [Please just call me Sedna, Ares-sama.]


    Sedna said as she bowed.


    [Thank you for tearing that beast apart so that we could get out from its belly… what could we do to as our gratitude for your help…?]


    Aquarius thought that the turtle had eaten the water spirits… but in reality, they were still alive inside its belly. However, they were weakened because their magic power was continuously absorbed.


    [We should regain our power back once we reach clean water… I… I was prepared for the worst while I was inside the stomach of that beast. What’s with our magic power being drained continuously… even us, might eventually meet our end. You are truly our benefactor.]


    Sedna then gave Ares a look.


    [I’ve heard from Aquarius. You want to forge a contract with the water spirit… in that case, this Sedna, as the head of water spirit in this region, will be the one to forge the contract with you.]


    [What!? Sedna-sama will do it!?]


    Ignoring Aquarius, Sedna continued on without breaking eye contact.


    [If I make a contract with you…wouldn’t that be the same as having forged contracts with all of the water spirit residing in this area? Am I correct?]


    Ares could only nodded in agreement.


    [I can’t ask for anything better. Let’s work together from now on.]


    Saying so, Ares raised his hand to Sedna’s forehead.


    At that moment, Sedna showed a puzzled look.


    [Ah? Could Milord… has forged similar contract with many other spirits before?]


    [You can tell?]


    [Yes… it’s evident from that many marks on your arm… Oh? You are also in contract with the water spirit Quara?]


    [Yes, she’s managing the water circulation on the Schwarzer territory now, you know?]


    [Quara is my sister. It seems that she had found a good master…]


    Sedna smiled pleasantly.


    With that, Ares began the chant.


    [I, Ares Schwarzer has decreed. You body will belong to me. My will shall become your will. You, the water spirit undine, Sedna.]


    A dazzling light wrapped both Ares and Sedna.


    [Uhhyaa, what is that!?]


    Aquarius and the other water spirit was perplexed by the scene.


    Sedna smiled and informed all of them.


    [Since all of you are under my ward, this will be the same as him having contracted to all of you at the same time.]


    [That kind of thingーー! No wayーー!]


    Aquarius screamed, but the light only grew brighter… until it gradually died down later on.


    [The contract has been forged. Come, water spirit undine Sedna.]


    [Until your life is at its end, this water spirit is at your command, Master.]


    And thus, Ares managed to forge a pact with the water spirits of Grants and secured a source of clean water for the waterway development.
『Add To Library for easy reading』
Popular recommendations
Super Gene Shadow Slave Cultivation Online Mecha Breaks the World Nine Star Hegemon Body Arts I Can Copy Talents