《Mushoku no Eiyuu ~Betsu ni Skill Nanka Iranakattan daga~》 1-Episode 1 Is this a profession? ''I''m thinking about what kind of occupation Arel will be given, dad, I didn''t sleep a wink yesterday because I was so nervous! ''Hmmm, your mother is even more nervous than she was. ''I''m sure Arrell would be a [senior position]!After all, he''s your sister''s brother! Oh dear, my family is still noisy as usual. Why do they seem to be more excited than me? My name is Arel. I''ll be ten years old this year. Whenever I turn ten, I have to go to the temple. The Goddess has blessed me in order to give me her blessing. After receiving the Blessing, one is given a vocation without exception. What one does for a living can have a profound effect on the rest of one''s life. ''But even so, Arel is so calm. When my dad received the blessing, he was so nervous that he peed his pants on the way to the temple... That''s information I''d appreciate you keeping in your heart, Dad. Because there''s no point in fussing over it. It''s not going to change the profession you''re given, just because you make a fuss about it. I''m just going to have to accept it. I''m sure you''re not the only one with an eye for detail. It''s hard to believe she''s ten years old. ''Absolutely!This kid is bound to be a big deal in the future! Hmmm, if I become a celebrity, my house might be full of fans. If that happens, I''m sure there will be a lot of women courting Arel...................that''s not right!Your sister will not allow it! Mom and Dad draw a self-serving picture of the future. My sister is angry for some reason. Well, it''s the usual. And once they start to fantasize, it''s a long time. If we wait for them to finish, we won''t be able to finish in time. I decided to leave it alone and leave for the temple quickly by myself. I don''t want to be late and have to wait another year. Yes, today is the day of the blessing. Today is the day of the blessing. We live in a small town in the middle of nowhere. We don''t have a resident priest who can perform the rituals to give the blessing, but a priest is dispatched once a year from a larger city. Therefore, all the children in the town who were the same age were to receive the blessing at once. ''Arel!Wait! Why do you want to get ahead of me, Arrell? ''That''s right!It''s terrible to leave your sister behind! They came after me. "I can get your blessing on my own. ''It''s a momentous occasion. It''s only natural that you should be accompanied by your family. So that''s how it is. Come to think of it, I remember going with my sister when she was blessed three years ago. When I got to the temple, there were already a group of children and their families that I recognized. It''s a small town and there are only about twenty children of the same age in total. ''''Then I would like to begin the blessing ceremony. The priest announces. He is an elderly man, a man who has been in charge of the blessing rituals of this town for many years. One by one, they went forward in turn and prayed with the priest. ''Yes!The Blacksmith!Now I can follow in Dad''s footsteps! I am a magician! The children shout for joy as they get their chosen profession. Blacksmith and Magic Master? They''re all Basic Position. There are two types of occupations, Basic Position and Major Position. Most people are in the Basic Position, and Higher Position is rare. This is because it is only by mastering the basic job that one can become a senior position. However, very rarely, there are cases where one can be given a senior position with the first blessing. ''''Oh, could you possibly be Leon-kun''s...?'''' As I stepped forward, the priestess mentioned my dad''s name. ''It''s been over twenty years now, isn''t it?But I still remember the time when Leon and Fara received the blessing. I remember when Leon-kun and Fara-chan received the blessing. I didn''t expect two kids to be given [senior position] from the beginning at the same time. Farrah is my mother''s name. My parents are both from this town, so-called childhood friends. That''s why we were blessed in this town on the same day. My father is the Mage King and my mother is the Sword Princess. Both of them were given Higher Rank from the beginning. I heard that there have been many invitations to serve in the royal palace, but both of them refused these invitations to live in this town where they were born. Naturally, my father is the best sorcerer in town and my mother is the best swordsman in town. It is said that the professions given to them by the Goddess are greatly influenced by their bloodlines. That''s why the children of Blacksmith are often Blacksmiths. Although I''ve heard there are exceptions. That''s why the people around me seem to have high expectations for me as well. You''re going to be Leon''s son next. ''''Arrell-kun. I''m sure he''s a [senior position] too. I wonder if you''ll marry my daughter when she grows up. I hear those voices from all over the place. ''Go for it, Arel!'' Arrell, fight! I''ve got your sister with me! Well, it''s my family that is the loudest. What in the world are we supposed to try so hard to do when all we have to do is receive a blessing? As I was praying to the Goddess, a kind of revelation suddenly came down in my head. Hmm, apparently this is my profession. .........hmm? But this ... is it a profession? The only thing that popped into my mind was --Unemployed. It was a letter that said. 2-Episode 2 There is no such feeling at all Cheer up, Arrell!Whatever profession they give you, you must be my proudest son! ''Your father is right. Arrell-chan is Arrell-chan. ''Your sister is on Arel''s side too! When I came home after the blessing ceremony, I was comforted by my fathers. When a person is given an occupation, he or she can acquire skills that correspond to that occupation. For example, if one is a swordsman, one can improve their swordsmanship (sword skill). I''m sure you''ll be able to find out what''s best for your goods if you''re a merchant. The influence of skills is so great that it is said that there is a difference between acquiring these skills and not acquiring them. In other words, being "unemployed" meant that one could not benefit from these skills at all. And unlike other professions, they would never grow up to become a [senior position]. The "jobless" are "jobless" for life. In a sense, it''s like being branded by the Goddess directly as having "no talent". I''ve heard that even the eldest son of an aristocrat is thrown out of the heir''s seat if he is found to be "unemployed". My father is desperately pleading with me. ''''Listen, Arel!Don''t even think about dying! No, I''m not interested in that at all. So is your sister. ''It''s all right!Don''t worry about it, Alel will be provided for by your sister! "No. ''Why is that?See, when you were little, you said you wanted to marry your sister when you grew up! When did this happen? And I''m sorry, but you''re not my type. What? ''Because sis, you''re a dick. I prefer a more feminine appeal. My sister is short and baby-faced, just like my dad. She''s thirteen years old, but her breasts are flat and she''s shorter than me at ten. That''s why I''m often mistaken for my brother. My thirty-five year old father was about to be surpassed by me. ''Well, you have a lot of growing up to do!I''ve been working hard and drinking a glass of milk every day!Wow, a quarter of an inch is hard! Six inches to go. Good luck, sis. You don''t think I can--? Of course I''m thinking. ''As for your sister, your mothers will work hard for as long as possible, so you don''t have to work, Arel-chan. Mom calmly tolerates her son''s biting of her shins. She is the complete opposite of her sister, tall and glamorous. I''m more like your mother, I guess. I''m sure you''ve been worried about me for some time now. To be honest, I''m not that sad. I think. It''s not that I don''t have any skills, but I think I can handle it, even if I don''t have any skills. The day after I received my blessing, I was sitting in the square near my house. I was pretending to be in the square near my house. It''s a routine I''ve been doing since I was five years old. It was the first time I saw my mother doing it every day and I started doing it with her. People around me said there was no point in doing it. I''ve been told that no matter how good your swordsmanship is during your childhood, once you become a "swordsman" and acquire the "Sword Techniques Elementary" it''s easy to overtake you. It is not meaningless. Just swinging a sword feels good. As the buzzing, buzzing wind noise was echoing, a laugh could be heard from somewhere. ''''Hey, hey, there''s an [unemployed] training for a sword! ''Bu-ha-ha!Seriously! They were a couple of boys my age. In other words, they were the guys I had blessed with yesterday. They both have swords at their waists. "Maybe you guys are too? I asked. ''You guys?Well, unlike you, we''re swordsmen! Don''t put us together! It seems that both of them were given the profession of "swordsman". It''s a good idea to have a good idea of what you can do with it. We don''t need to do any fancy swordsmanship tricks, unlike you who are unemployed! Well, watch it there! They suddenly started the game. Kang Kang Kang! Swords collide with swords and sparks fly. ''Whoa, wow!I''ve never held a sword before, but seriously, my body is moving on its own! ''Me too, me too!I could kill a goblin in the blink of an eye with this one! I see, it''s certainly not a beginner''s swordsmanship. This is the power of skill, isn''t it? You can''t get away with it. ''''Hahahaha, I guess some "unemployed" person won''t be able to experience this feeling for the rest of their life. They slashed at each other for a while, switching between offense and defense at a dizzying pace, but eventually their breath caught and they slumped into place. After waiting for their breathing to calm down, I called out to them. ''''Since we''re here, why don''t you join me for a bit? Then they started laughing loudly. ''''An ''unemployed'' with us ''swordsmen''?Buhahaha, there''s no way I''m going to be a match for you! Didn''t you see the swordplay we just saw? ''No, it was because I was watching. Honestly, I thought it was just the thing to deal with. The only person I''ve ever met in my life that I''ve had to deal with is my mom. But she''s too strong and not good enough to train at all. If possible, I would have liked to try it once with someone a little closer to my level. They rolled their eyes for a moment and then burst out laughing even more. ''''Buhahahaha!This guy is an idiot! Didn''t the shock of losing your job drive you crazy? Hmm. Did I say something so crazy? By my estimation, I don''t think you can take on two people at the same time and still lose. 3-Episode 3 Why Im afraid to look at it from above The blessings given by the Goddess are not only occupations. There is a blessing that comes before occupation, or rather, at birth. It''s called a blessing. Blessings are like a strange aura that always covers our bodies, and if you look hard enough you can see it subtly. Its effect is to protect the body and take care of the damage received. Each time it does, though, the blessing is drained away, though. As long as you have this, you won''t die first even if you are serious and fight with each other. I asked. ''If I can get even one hit in, I win, right? Oh, come on, are you sure you want to do this? I''ve told you that before. Shit. Okay. Then I''ll show you the difference in professions. The smaller, more agile-looking of the two men came forward. I don''t know his name well. He has curly hair, so we''ll call him Curly for convenience. ''What. Aren''t you two coming at the same time? ''Oh?How well you''re getting on, man? Curly hair twisted his face in an abhorrent manner and drew the sword from his waist. ''''I''m enough for you, at least on my own! Well, it''s no use. I drew my sword, too. The curly hair closes in on me in time. "O-o-o-o-o-o-o-o-o-o! Ding dong dong dong dong! ''Haha, what''s going on?You''ve got a big mouth and you''re defending yourself! Ding dong dong dong dong! You can''t win anytime soon if you keep on protecting people! Ding dong dong dong dong! Well, I guess it''s time to put an end to that! Ding dong dong dong dong! ...Wait a minute! The curly hair jumped back and once it was out of range. ''''Why the hell are you handling my sword like a normal person?I''m a swordsman, and I have the skills of the Swordsmanship Elementary! No, I think you''ve got pretty good swordsmanship. Why do you have to be so high and mighty? I''ve been holding the sword longer than you have, so I don''t think it''s strange, right? What are you playing at? Just get rid of that "no-show" as fast as you can! It was the other boy who interrupted me. He''s taller than his curly hair, and he''s also a little overweight, so he seems to move slowly. Let''s call him a little fat. ''Then you should help me too! All right. Let''s get out of the way. We''re going at the same time. Apparently, they''re coming together this time. I hope so. Curly hair and little fatties are attacking me from both sides. Kink, kink, kink, kink, kink! Mmm, I guess we''re not gonna be able to do this together. Since you only have one sword, you can''t deal with them if they slash at you at the same time. Therefore, I''ll stand well to take off the timing of the two attacks. ''''Huh, don''t be silly! Not even close.... The two of them are desperately trying to land a blow on me, but are quite frustrated that they can''t catch it. Because of that, even though it''s a two-man effort, I''m not making the most of it at all. Rather, they are dragging each other down, with their shoulders colliding and their stance collapsing. I see. It seems that the Swordsmanship Elementary skill only improves the skill of the sword, but does not enhance the combination in group combat. Boom! Oh, that''s dangerous!What the hell are you doing? You''re the reason you''re in that place! An argument finally broke out as the sword wielded by the little fat man almost hit his curly hair. I seized the opportunity and went on the offensive. ''''Ahh!'''' What? He struck the curly haired man''s right wrist and cut the little fat man''s neck with the returning sword. Of course, thanks to the blessing, I didn''t actually cut it off. ''I guess I win.'' f*ck you!You didn''t do that one! ''Yes!You have some unfair timing! No, can you say that on the battlefield as well? There''s no way we, as swordsmen, could lose to an "unemployed"! Ah!Next time it won''t be like now! Hmm, still going strong. It''s a bit of a long shot for us. It''s a far better lesson than dealing with your mother, after all. "Don''t do that. If you''re a swordsman, don''t show any more disrespect. Suddenly, a third party voice interrupted us. When I looked towards the voice, I saw a boy about the same age as us. His flame-red hair was striking, but his neutral, neat face also stood out well. ''''Who the hell are you?!'''' Hey, hey.........this guy........ Curly hair that was about to be eaten, but the little fatty noticed something and controlled it. ''''I''m a swordsman too. But I''m a year older than you guys. He was one year older than me. You are the son of Fara, the Swordswoman? Yeah? Apparently, you know me. Well, my mom is famous. No, neither are my father and sister. ........To be exact, the current mother isn''t the Sword Princess. Although the Sword Princess is one of the Higher Ranked Positions, since it is the highest rank among them, she was sometimes called the Top Rank. Of course, everyone recognizes her as the best swordsman in town. Despite not being a member of the Neighborhood Watch, whenever a large demon appears near the town, he is often asked to help defeat it. ''''Next time, you''ll have to deal with me.'''' Oh, man. You want a piece of that? Don''t buy your way out of this by beating two minnows. I will show you, a nobody, how powerful the Swordsman really is. Hmm?That''s a lot of hostility laid bare. 4-Episode 4 It can only be said that the abilities are equal The blessings given by the Goddess are not only occupations. There is a blessing that comes before occupation, or rather, at birth. It''s called a blessing. Blessings are like a strange aura that always covers our bodies, and if you look hard enough you can see it subtly. Its effect is to protect the body and take care of the damage received. Each time it does, though, the blessing is drained away, though. As long as you have this, you won''t die first even if you are serious and fight with each other. I asked. ''If I can get even one hit in, I win, right? Oh, come on, are you sure you want to do this? I''ve told you that before. Shit. Okay. Then I''ll show you the difference in professions. The smaller, more agile-looking of the two men came forward. I don''t know his name well. He has curly hair, so we''ll call him Curly for convenience. ''What. Aren''t you two coming at the same time? ''Oh?How well you''re getting on, man? Curly hair twisted his face in an abhorrent manner and drew the sword from his waist. ''''I''m enough for you, at least on my own! Well, it''s no use. I drew my sword, too. The curly hair closes in on me in time. "O-o-o-o-o-o-o-o-o-o! Ding dong dong dong dong! ''Haha, what''s going on?You''ve got a big mouth and you''re defending yourself! Ding dong dong dong dong! You can''t win anytime soon if you keep on protecting people! Ding dong dong dong dong! Well, I guess it''s time to put an end to that! Ding dong dong dong dong! ...Wait a minute! The curly hair jumped back and once it was out of range. ''''Why the hell are you handling my sword like a normal person?I''m a swordsman, and I have the skills of the Swordsmanship Elementary! No, I think you''ve got pretty good swordsmanship. Why do you have to be so high and mighty? I''ve been holding the sword longer than you have, so I don''t think it''s strange, right? What are you playing at? Just get rid of that "no-show" as fast as you can! It was the other boy who interrupted me. He''s taller than his curly hair, and he''s also a little overweight, so he seems to move slowly. Let''s call him a little fat. ''Then you should help me too! All right. Let''s get out of the way. We''re going at the same time. Apparently, they''re coming together this time. I hope so. Curly hair and little fatties are attacking me from both sides. Kink, kink, kink, kink, kink! Mmm, I guess we''re not gonna be able to do this together. Since you only have one sword, you can''t deal with them if they slash at you at the same time. Therefore, I''ll stand well to take off the timing of the two attacks. ''''Huh, don''t be silly! Not even close.... The two of them are desperately trying to land a blow on me, but are quite frustrated that they can''t catch it. Because of that, even though it''s a two-man effort, I''m not making the most of it at all. Rather, they are dragging each other down, with their shoulders colliding and their stance collapsing. I see. It seems that the Swordsmanship Elementary skill only improves the skill of the sword, but does not enhance the combination in group combat. Boom! Oh, that''s dangerous!What the hell are you doing? You''re the reason you''re in that place! An argument finally broke out as the sword wielded by the little fat man almost hit his curly hair. I seized the opportunity and went on the offensive. ''''Ahh!'''' What? He struck the curly haired man''s right wrist and cut the little fat man''s neck with the returning sword. Of course, thanks to the blessing, I didn''t actually cut it off. ''I guess I win.'' f*ck you!You didn''t do that one! ''Yes!You have some unfair timing! No, can you say that on the battlefield as well? There''s no way we, as swordsmen, could lose to an "unemployed"! Ah!Next time it won''t be like now! Hmm, still going strong. It''s a bit of a long shot for us. It''s a far better lesson than dealing with your mother, after all. "Don''t do that. If you''re a swordsman, don''t show any more disrespect. Suddenly, a third party voice interrupted us. When I looked towards the voice, I saw a boy about the same age as us. His flame-red hair was striking, but his neutral, neat face also stood out well. ''''Who the hell are you?!'''' Hey, hey.........this guy........ Curly hair that was about to be eaten, but the little fatty noticed something and controlled it. ''''I''m a swordsman too. But I''m a year older than you guys. He was one year older than me. You are the son of Fara, the Swordswoman? Yeah? Apparently, you know me. Well, my mom is famous. No, neither are my father and sister. ........To be exact, the current mother isn''t the Sword Princess. Although the Sword Princess is one of the Higher Ranked Positions, since it is the highest rank among them, she was sometimes called the Top Rank. Of course, everyone recognizes her as the best swordsman in town. Despite not being a member of the Neighborhood Watch, whenever a large demon appears near the town, he is often asked to help defeat it. ''''Next time, you''ll have to deal with me.'''' Oh, man. You want a piece of that? Don''t buy your way out of this by beating two minnows. I will show you, a nobody, how powerful the Swordsman really is. Hmm?That''s a lot of hostility laid bare. 5-Episode 5 But Still Still It''s morning, Arel!Arel''s favorite sister came to wake him up! Loud voices echoed in my room from the morning. My sister runs over to me as I sleep in bed. ''As usual, Arel has a weak morning!All right, good morning, sis. Gong! Morning. I got off the bed and left the room, biting down on my absent-mindedness. ''Hey, you just hit your sister as hard as you could!And you''re just going through it like it never happened! I head to the living room with my sister''s voice behind me, holding her head with tears in her eyes and screaming at me. ''''Oh, good morning, Arelle-chan,'''' Good morning, Mother. Breakfast is ready. Thank you. ''Hey!Don''t leave your sister unattended! Mmm, your cooking is as good as ever. "Are you? ''She''s still asleep. Can you go wake her up, sister? ''Gugnu..........I understand! Me and Dad had few similarities, the only thing we had in common was that we were weak in the morning. Mom asked me to go, and for some reason, much to my chagrin, my sister went to wake Dad up. After breakfast, I went to the square yesterday. I think back to the game with the red hair. I lost. I couldn''t capture that "double-blade slash" attack skill, and my blessings were reduced to less than half. But victory or defeat doesn''t matter. Since the middle of the hand-to-hand combat, I had been concentrating on watching rather than preventing that skill. "Double-blade slash! I wrap the straw around and into the large tree I always use to practice my striking, I try to do yesterday''s technique as I see it. Gasp! Hmm. It''s no good. That was just two strikes. You hit the left side of the tree, then the right side. That''s it. A real ''double-bladed slayer'' would have to slash at two places at exactly the same time. "Do you need more sword speed? Next time I''m going to try to do it anyway with speed in mind. Gasp! It''s no good. It''s only two strikes. The return of the wrist is important, too. After slashing the left side, you have to turn your wrist once to slash the opposite side next. This time must be shortened to the extreme. Gaga! ''Hmm. That one was faster than the one before. But not fast enough. The interval between the sounds has been reduced, but it still doesn''t sound quite simultaneous. Faster. Gaga! I could go on and on. Gaga! Not yet. Gaga! It''s been a month since I started practicing the Double-Blade Slayer. I''ve now come to the outskirts of town. In front of me is a forest of dense trees. I stepped into it. As I proceeded for a while, I encountered a creature. ''''Gugiye!'''' The one who emitted a fearless cry was an ugly looking demon with green skin. It''s a goblin. It''s only as tall as my ten-year-old me, and it''s not very intelligent. It was holding something that looked like a spear made from the bones of an animal or something else. I quickly drew my sword and intercepted the goblin that attacked me as soon as it spotted me. ""Double-bladed slash!" Gah! The goblin''s head flew off, and its torso cried out to be separated from its upper and lower body. Blood was splattered in a heap. Naturally, it was an instant death. Unlike humans, goblins, which have no protection, are demons that can be easily defeated with a decent sword skill. ''''Hm. That worked out well. I just slashed the goblin''s neck and body at the same time. This is exactly what the red-haired man showed me: a double-edged slash. This isn''t the first time I''ve succeeded in this. He had already succeeded many times in practice. I came to this forest to see if I would be successful in a real battle as well. This is the first time I''ve succeeded against a moving creature. Since then, I''ve encountered goblins on several occasions and killed them with a double-edged slash. I tried various forms of slashing, including neck and legs, right arm and left arm, as well as neck and body, and all were successful. But still, goblins are a perfect opponent for a test slaying. They can be swarmed sometimes, though, so you have to be careful about that. ''''So this is it.'''' Satisfied, I was about to turn on my heel and head back to town. Ahhhh! A scream rang out from deep in the forest. ''''... what?'''' It was definitely a human voice. And it sounded like a child''s voice. I scrambled through the trees and ran in the direction of the voice. Eventually, I could see it. It looks like a person is being attacked by a demon. But that guy..... d*mn it I never thought I''d see this...! I recognized that face, twisted in a hateful way. It was the red hair from the other day. He held a sword in his right hand, but his left hand hung slackly. A bone was broken or bent in a slightly odd direction. It seemed that he had suffered damage that exceeded his blessings. The one facing that red hair is a goblin - but it''s huge. I wonder if it''s at least 180 centimeters tall. It''s an unusually large body for a goblin. ''A hobgoblin?'' Hobgoblins are a higher species of goblin. They look like goblins in appearance, but their bodies are far larger and more monstrous. It has a club in its hand and a grimy smile on its face as it looks down at the red hair. Perhaps the red hair''s arm was killed by this guy. He too had entered this forest for a real battle, and I assume he had the misfortune of meeting a hobgoblin. It''s dangerous for a child to enter the forest alone. No, that''s not something I could say. ''Fortunately, they haven''t noticed you over here. I jumped out from behind the grass where I was hiding and attacked the hobgoblin from behind. ""Double-bladed slash!" Huh? The hobgoblin''s neck was slammed with two slashes simultaneously from both sides. The flesh of the neck is much harder than that of a goblin. But, thanks to the "double-blade slash" that was released as if to pinch it, it was cut cleanly, and the head fell to the ground with a whirl in the air. ''''Ah........'''' The giant crumbles down. ''Hmm. It''s been a while. Nah.... The red hair was wide eyed. ''What do you mean?How can you use a double-bladed slayer? 6-Episode 6 I am normal What does this mean?How can you use a double-bladed slayer? The red hair packed in. ''I practiced,'' You''re kidding me!It''s not something you can learn by practicing! I don''t care if you say so. I can actually do it. That''s a skill that makes it possible! ''Indeed, normally you can''t cut two places at the same time at all. There would inevitably be a time lag between them. Isn''t it! But if that''s the case, you can''t just go through the motions. I don''t know what that means! The red hair tried to hold her head, but she must have noticed the intense pain in one arm, and frowned as hard as she could. ''''Huh........'''' What, you didn''t bring any holy water? There are two main ways to restore blessings. One is natural recovery through the passage of time. The other is to drink holy water. Holy water can be purchased at the church. It''s a necessity if you''re going out of town, but apparently the red hair broke a bottle of holy water while fighting the goblins. He drank the holy water I gave him, so by the time the town came into view, the red hair''s blessing had recovered a lot. And when the blessing returns, it will take care of the wounds it received in time. In other words, the wounds would heal on their own. ''''How''s your injury?'''' I''m doing much better. Yeah. ....Hmmm, but I guess we''d better not do that today. What are you talking about? ''No, I was hoping to get some revenge for the other day. But by the looks of it, we''ll have to wait until a later date. I was trying out against the goblins in preparation for a rematch with the red hair. I don''t like to lose like this, I''m a loser, you know. It doesn''t feel good to end up being defeated. ''''Huh!...All right!Let''s take that gamble! The red hair drew his sword. ''?We can do that later, okay? ''No problem!I''ve already healed my injuries! The red hair waved his sword buzzingly, as if to appeal to a full recovery. ''I see.'' It saved me the trouble of going to the trouble of setting a date for the game. If I didn''t happen to meet him in the forest in the first place, I was going to make a trip to the vigilante''s clogging station and ask him to tell me where the red hair lived. Unfortunately, I don''t know where the red hair lives, even though we are in the same town. Even if you use the Double-Blade Slayer, the winner is me!Because as a genuine swordsman, my "double-bladed slayer" can''t be beaten by your impostor, an unemployed one! The red hair assured him so, and he held up his sword. I too drew my sword and confronted him. ''Let''s go!Double-bladed slayer. He suddenly unleashed an attack skill. A slash is approaching from both sides simultaneously. Of course, this one is also countered with the same technique. "Double-blade slash! Ding!There is a metallic sound, and the red-haired sword flicks outward. I didn''t use the "double-bladed slash" for attack, but for defense. But that''s not the end of it. Gun! Wha...? The red hair looks away. Because my third blow had struck the red hair on the shoulder. ''''Hmm...?What the hell did you just do? My ''double-bladed slash'' is not due to skill. In other words, you don''t have to be a ''double-bladed'' slayer. However, the third blow has not yet reached the realm of simultaneous, and it is slightly delayed from the previous two blows. ''''Bah, that''s ridiculous... there''s no way I can do that...'''' Hmm. Then I''ll show you as many times as I can. I got my revenge on the red hair and went home. ''Oh, welcome home, Arel,'' Mother. I need you to do one thing for me. "?What''s going on?From the bushes to the sticks. I want you to show me all the skills your mother is learning. My mom gets a puzzled look on her face at my words. ''Why again?'' I want to learn a skill. He was able to replicate the skill that the Swordsman learns, the Double-Blade Slash, on his own. If that was the case, wouldn''t it be possible to do the same thing with other skills? That''s what I thought. I thought Mom approached me, and she hugged me tightly. ''''I''m sorry, Arel-chan I didn''t know you were in so much pain...'''' Mom? ''I''m sorry I didn''t notice.......I''m not a good mother.......'' So what are you talking about, Mother? Even though she is very mature, she is still only ten years old... she can indulge her mother as much as she wants, you know? Hmm, apparently he thinks I''ve gone crazy because I can''t stand the reality of being "unemployed". ''''Mom, I''m normal.'''' ''Yeah, I know. Your mother will always be there for you, Arel. It''s no good. The quickest thing to do would be to get them to see that thing. I got out of mom''s arms and went out into the yard. "Mom, watch me. Of course, Arrell-chan. I''ll always watch over you, Mom. I think you''re the one who''s going crazy with shock. Let''s get this over with. "Double-bladed slayer. Two slashes slashed through the void at the same time. ''''What do you think, mother?'''' An ordinary person''s kinetic vision wouldn''t be able to catch it, but even with her bare hands, Mom would have been able to clearly see that that was a proper ''double-edged slash''. ''''........That''s strange. It looked like Arel-chan just used the ........ No, that can''t be true. If that''s the case, then this is a dream........yes, it''s a dream, right? But to dream like this........could it be that I have not been able to accept that Arelle-chan is unemployed......?Oh, what a terrible mother she is... Mom, I wasn''t dreaming. I''ve been dimly aware of this for a while, but Mom might be a bit of a natural. I tugged on Mom''s cheek. ''Hee-hee (ouch)?'' It''s not a dream. I recreated the Double-Bladed Slayer. It took me about a month to do it. Then really.... Mom often looked dumbfounded, but eventually she ran into the house and Dad!Dad!Arrell-chan is a genius after all! Good grief. It''s still noisy as ever. 7-Episode 7 Dont make fun of older people The carriage rumbled along the cobblestone road, making a rumbling sound. I asked him, "How much farther is it to the City of Swords? How much farther is it to the City of Swords? It''s only three stops away, so if things continue as they are, we should be able to arrive the day after tomorrow in the afternoon. He replies in a leisurely voice. Two days. Considering it has taken more than a week to get here, it''s almost there. Five years have passed since then. I am now fifteen years old. On my fifteenth birthday, I told my mom and dad that I was thinking of leaving my hometown. Neither of them objected. They said I should do what I wanted. And now we are on our way to Breathless Gear, also known as the City of Swords. I''ve been wanting to visit this city for a long time. In Breathless Gear, skilled swordsmen gather from all over the world. It is said that they work hard to improve each other''s skills to reach higher levels. My mother once lived here, and I have often heard stories from my childhood. What, you''re planning to go to the City of Swords, too? The man in question, who looked to be in his early 20s, asked me about it. "You too? ''Yes. That''s because it''s a swordsman''s dream. But the level is so high that there''s no end to the number of people who fail. Even the swordsman I used to go to school with returned home in less than six months. The man hung up the edge of his mouth as he stared around at my whole body. ''Kukku, how long do you think the boy will last?'' Then a woman about the same age as the man interrupted me. It''s a surprise. I''m going to the City of Swords, too. The man snorts. ''Hmph, how dare you wield a sword, woman! Oh, my God, you''re so old-fashioned nowadays, aren''t you from a very rural area? What? It''s your occupation that counts. It doesn''t matter what gender you are. ''Ha, you must be a very respectable profession if you say so much, don''t you?Don''t tell me it''s a [basic job] swordsman, right? Of course, I''m a senior official. I''m the Twin Swordsman. As you know, my offensive ability is excellent, and I''m the most popular among the [Senior Officials]. Compared to the basic job, there are many different types of senior positions. It is said that which Senior Position one can become a Senior Position depends on one''s nature, experience, or the skills acquired. And naturally, there were popular and unpopular ones. ''''Tsk.'''' The man clicks his tongue evasively. The woman smiles triumphantly. What about you, then? I''m a gladiator. What, aren''t you a regular [senior position]? I don''t want to be the equal of a woman. You''re such a pain in the ass..... The only ones that are higher than the [Senior Official] are the ones that are already called "Sword Emperor" or "Sword Princess" or the [Highest Official]. Then their eyes turned to me. ''What about you, kid, what about you?'' So what about you? They all ask me what I want to say. "Unemployed. The two men''s eyes darted to each other. After a brief pause, the man''s laughter burst out. ''''Kuku, kuhahahahaha!Boy, are you seriously unemployed? Hey, you don''t want to laugh, do you?It''s not like he wanted to become "unemployed" either........ The woman also burst out in a gush, as if she couldn''t help it. I mean, what does an unemployed person need in the City of Swords!No, okay, so you''re a tourist!Then you should have said that in the first place, it''s confusing. It''s not for sightseeing. It''s about getting to the top of the heap in swordplay. I clearly deny it. ''Phew!You have no job, but you''ve come out on top in the way of the sword?Kahahahaha!This guy is a masterpiece! You''re kidding me. You''re kidding me!You shouldn''t make fun of older people. I''m not kidding. I assured him, and I could hear laughter from the other guests. I looked closer and saw that even your father was shaking his shoulders. I''ve been doing this for a long time, you know. I''ve seen many swordsmen go to the City of Swords with ambitions. But I''ve never seen anyone who is not employed. Hmm. Of course I expected that if I honestly responded that I was "unemployed", I would receive such a reaction. But the fact that I''m "unemployed" is a fact. There''s no point in going out of your way to deceive or tell a lie. The fact that others ridiculed me doesn''t change my intentions. And then one of the passengers said, "Hey, that''s it...", pointing to a forest in the direction of travel and making a twitching noise. A number of figures emerged from the woods. ''''Bandits?!'''' No, no, that was an orc! Orcs are humanoid demons. They have a head similar to a pig and are only slightly taller than a human, but have a very thick girth. ''''Hey, and there are quite a few of them! The passengers scream. There are more than a dozen orcs appearing one after another from the woods, just by a rough count. The carriages are always manned by bodyguards in case of an attack by bandits or demons. But perhaps because of the low cost of the ride, this carriage does not have an escort. Or maybe they were expecting passengers heading to the City of Swords and were being stingy with their escort fees. "Well, I guess we''ll just have to do it. With all that number, I guess we can''t just sit back and watch. The man and woman from earlier tried to get out of the carriage. Immediately after, their faces turned blue. A little later, an orc with an exceptionally large body came out of the woods. ''''Well, no way........King Orc.......? 8-Episode 8: Those who are quite pitiful With their hard skin and powerful muscles, Orcs are excellent at attacking and defending themselves. On the other hand, their movements are relatively slow and their intelligence is low, so they are not a formidable foe as long as you can handle them. However, that is only if the number of opponents is small. "Hey, hey, there are more than 20 of them! And that guy in the back... he''s not a king orc...? Unlike the normal oaks that have reddish-brown skin, the lead-skinned oaks could be seen. The King Orc was the upper level of the Orc. They are much bigger than ordinary Orcs, and their power is incomparable. They lead Orcs to form packs and attack villages and towns, so as soon as they emerge, a large strike force will be formed. ''''Ooh-oh-oh!'''' As soon as that King Orc roared, the orcs rushed towards us all at once. An earth-shaking sound roared in the area. ''''Hiiii!Keiji-sama.......please help me! A passenger clings to the man in the Gladiator. The man shakes it off. You have to be kidding me!I can''t fight a king orc with that many orcs in tow! He jumped down from the carriage and fled alone, leaving the other passengers behind. ''I''m not going to be there!I''m not going to risk my life for a stranger! Furthermore, the woman from the Twin Swordsman also left easily and left. ''''Hmm. They''re pretty cold-hearted. I jumped off the wagon. I walked toward the approaching herd of orcs. ''Hey, visitor!This isn''t someone that an "unemployed" customer can do anything about! I kicked the ground while listening to the Gosha''s voice at my back. The distance between me and the orc who was running in the lead instantly closed. ''''Buhhhh! My sword clicks the orc''s brain and the huge body collapses. ''''Wha!What was that speed...? You''re not suggesting... a contraction skill? Hoh. You only had to see it once to see it. It''s not a contraction skill, but a recreation of it. One of them is hit, and the orcs are upset. But they were soon painted with anger and leapt at him with a yell. They are swallowed up in a flash. Wielding primitive axes and sticks in their hands, the orcs attack. But it never reaches me. ''''Dancing...?'''' ''It''s true!That boy, he''s dancing and dodging the enemy''s attacks! ''No, that''s not all!Look closely!Orcs are falling one by one........ Just like a butterfly dancing, it evades all attacks while sewing up the gaps. At the same time, she swings her sword to cut down the orcs. It''s a "sword dance"........that''s a "sword dance"!Only the highest ranking player, the Sword Princess, can use this offensive and defensive skill...!But why would he, a man...? You know your father very well. Of course, this is not a skill. It''s a sword dance that he learned on his own. Before I knew it, all the orcs that were around had been wiped out. I''m not sure if the wounds are fresh or not, but the ones that are still barely alive are trying to attack me from behind. ''''Bhoho........'''' Without looking back, he swung his sword and stabbed a thorn in the side. ''''Even the ''''Attitude Detection'''' skill...? Now all that''s left is him. "Oh, oh, oh, oh, oh! You are very angry at having your entire company wiped out. He comes at you with a huge club in his hand. And as soon as the distance is closed, he raises the club wide and slams it down boldly. ''''Watch out!'''' With a roar, the ground was gouged wide open and sediment leapt up. ''''Oaaaaaah!'''' The King Orcs thought they had finished him off and let out a victory cry. ''Alas, I''m not going to hit him with such a big swing. Ack! I was leaping behind the King Orc, and even above his head. I raised my sword above my head as far as it would go. ''''A blow with all your might should be done in a situation as sure as this. He swung his sword as hard as he could into the King Orc''s brain. The skull is destroyed and the blade reaches the brain. The giant body slumped down. The King Orc was doomed. ''''Oooohhhhhh! The passengers who had been watching me fight, forgetting to flee from the middle of the fight, all shouted with glee. ''Wow!You took down a king orc and all those orcs all by yourself! What a boy! Haha, to say you''re "unemployed" is a f*cking liar! I''m not lying. Oh well. The carriage starts to move forward again towards its destination. Fortunately, no one was killed or injured. However, those two men who were heading to the City of Swords were nowhere to be found. I''m not going to be able to get away with it because they ran away before I could defeat the orcs. It''s not a good idea to be a swordsman who runs away with that level of skill, it won''t work in that city anyway. He says once and for all, "They will be at a level where they will be satisfied with just becoming a [senior position]. They will be satisfied with the level of satisfaction they get from just being a [senior position] after all. A senior position is just the starting point in that city. What''s important is how to aim higher from there. Even if it kills me, I will become even stronger. If you don''t have that kind of spirit, you won''t be able to advance any further. That''s very harsh. But you''re right. After that, we didn''t get attacked by any demons, and after passing through several towns and villages, we eventually saw the huge city walls. "So this is the City of Swords? 9-You are a newcomer even if you do not have episode 9 The carriage ducked through the gates and stopped in the square beyond. ''''Thank you for the long journey. Nevertheless, you''ve been a great help.'''' What are you talking about? Isn''t it obvious?You have defeated the King Oak. If it weren''t for your customers, I wouldn''t be in this world today. What do you mean? What would you have done without me? ...Heh. Your father snorted in admiration at my point. ''You understand very well, don''t you?'' Of course. If it''s only a knowledge of swordsmanship skills, it''s not something an ordinary person can do, like guessing what skill I''ve used just by looking at it. Well, even without that, I knew from the beginning that he wasn''t just any guy. It''s because every movement exudes the air of a refined warrior. It''s a good thing that you''re able to have a good time with them. But serving at the court is not for me, and I''ve been living by myself for many years. Why do you want to kill yourself? I''m tired of being in the middle of a battle all the time. Sometimes I travel from place to place, taking it easy. The reason I''m playing the role of a coach is because of that. Hmm. So that''s why the carriage was so unorthodox. Still, it was cheap, so I didn''t care to ride it. It makes sense that there were no guards. Since this person is a skilled warrior himself, there was no need to hire another. ''''By the way, could you tell me some secrets about our guest? "Secret? Yes. What is the real profession? Or how could he use the skills of the Swordswoman when he was a man and only a woman was supposed to be able to become one? As I said many times, I''m not a professional. Again. It''s true, though. They won''t believe me at all. I learned the skills of the Swordswoman by watching my mother use them. Haha, I guess you really want to keep it under wraps, huh? Of course, that was true now, too. ''''No, that''s fine. However, there are many guilds that require you to reveal your profession to enter, so please be careful. After saying that, He leaves. You didn''t believe me until the end, did you? "I see. I should have shown you the appraisal report. I remember it now. The certificate is a written description of one''s profession and skills. Only a person with the profession of an Appraiser can create one, and you can always get one at the Blessing Ceremony. Since I had it made again before I left my hometown, it is certain that I am "unemployed". If I showed them this, as expected, they wouldn''t have suspected me. ''''Oh well. I''ll do that next time. It is as expected of the "Sword City". Most of the people on the street are wearing a sword. There are many swordsmen like me who are visiting the city for the first time, and there are people here and there looking around curiously. I''m sure you''ll find a lot of people looking around and talking to them. The Cavalry''s guild is made up of knightly swordsmen, and it is an honorable guild!If you have any knightly professions, by all means join our guild! ''Yes, sir!We, the Swordlords, welcome everyone, regardless of profession!Even if you''re a hunter or bandit type, as long as you can handle a sword, it''s OK! The Legion is looking for new military recruits. Let''s join us in a collective fight to reach the top. It looks like they''re recruiting new recruits. In the City of Swords, there are countless organizations called ''Swordsmen''s Guilds''. There are always a number of tournaments held in this city, and the prize money earned from these tournaments is the main source of income for the swordsmen, but it is said that you cannot participate in most tournaments unless you belong to a guild. Therefore, guild membership is a must. By the way, it is said that guilds that have many excellent swordsmen also have immense power in the management of the city. ''''Hmm, speaking of which, what did I say?The guild your mother was in. In the past, the guild my mom belonged to was a top guild in name only. Mom went out of her way to write me a letter to recommend me, because the members of that time would definitely remember me. I''m going to go to that guild for now but I can''t remember the name. ''Can I ask someone?'' Those who were soliciting in the square would be familiar with the city. That''s what I thought, and I was about to call out to them. You there!Maybe you''re a newcomer even if you''re not! On the contrary, I was approached from behind. When I turned around, I saw a woman there, about twenty years old. She had stunning blonde hair and a rather well-defined face. Perhaps that''s why she was attracting attention from the surroundings. ''''........That Lilia guy, he''s coming to solicit you again without s*xual discipline.'''' Haha, who would want to join a mud-ship guild like that anyway? No, apparently it''s not just because she''s beautiful. What is being directed at you is a look of contempt or mockery. In both cases, they are the ones doing the recruiting. On the other hand, the new swordsmen who do not know what is going on have a strange look on their face. ''''Please join our guild!Please!There''s no registration fee now! They''re recruiting at a tremendous rate, but why are they so desperate? It''s definitely a weak guild. ''''Hit another one.'''' I said no, once and for all. Then the woman suddenly dropped to her knees and put her forehead on the ground. She was on her knees and even put her forehead on the ground. This is a culture that was handed down from the swordsmen of the East, as I recall. ''How about that!Like this! Hmm. Sounds like you''re in dire straits. "No, thanks. 10-Episode 10: Its insanely rude, right? But I won''t. I clearly refused. ''Wait, why? If you''re going to join anything, it''s going to be a very large guild. No one would willingly go out of their way to choose a weak guild. Then why do you look away? "Gimme. Maybe it''s such a bubbly guild that everyone knows about it. Are you trying to demand my body as well...? The woman hides her body with her arms, her cheeks twitching. ''Unfortunately, I prefer big breasts.'' I don''t have any tits, you son of a b*tc*! The woman screamed with tears in her eyes and then Then get your shoes!I''ll lick your shoes! Do you want a newcomer that badly? Since they''re so desperate to get to this point, they might have some kind of situation that they can''t get away with. Well, at least listen to the details! "Hmm. ''Will you listen to me!Now, since this is also the place to be, I will take you to the guild! But I won''t. Why? I''m not interested. Hidebu! I don''t care what the state of this woman''s guild is. I came to this city to master the sword. Honestly, I''m not interested in anything else. The woman grunted something, but I didn''t care to ask her a question. ''By the way, what is the most powerful guild in this city?'' You want to ask me about that........that''s a very brazen thing to ask.... The woman told me with a look on her face that didn''t matter anymore. Hmm. Black Blades, huh? I don''t remember the name of the guild Mom mentioned, but I think it was somewhat ostentatious like that. ''''There''s a headquarters (home) in the square... but I heard it''s hard to get in, especially since the requirements for membership are so strict these days...'''' Oh, yeah. Thank God. You''re welcome... Where was the initial momentum, the woman''s tone was weak. ''Well, good luck. There are many newcomers besides me. I''m sure there are some oddballs out there that will listen to you. That''s so rude! ...? Why was he angry with me when I encouraged him to do so? I nodded my head and headed to the swordsmen''s guild called Black Blade. ''''Hmm. Is that it? The building that looked like the Black Blade''s home base was soon found. ''What do you want?'' As he approached the gate, the gatekeeper swordsman came to visit him. ''''Is this the Black Blade''s home base?'''' Yes. I''d like to join. You''re a prospective member. You''re a prospective member, but you have to pass a test to get in. We meet on the 10th of every month. The next one is in three days. Three days. Do I have to wait until then? No, in fact, I''m probably lucky that it only took me three days. "You have to register for the exam to take it. Okay. The gatekeeper took me inside and to the reception desk. There were a lot of young fencers lined up, probably to register for the test, just like me. I waited for a while, and then it was my turn to register for the test. ''You''re registering for the exam, aren''t you? In order to take this guild''s exam, you must be at least a [Senior Official]. Can you tell me what your occupation is? What. [Senior position] required? Do you have that kind of condition? ''''No, I''m [unemployed]. I''m not a [senior position]. When I told him that, the guy at the reception desk rolled his eyes for a moment. Buh. I gushed. ''''I''m sorry, too. .........Unemployed, huh? As I said earlier, the minimum requirement for joining our guild is to be a [Senior Official]. I''m sorry, but please leave. The man said this with a look on his face as if he was trying to hold back a laugh. "Hey, hey, it''s "unemployed"! Did he really expect an "unemployed" to be in this top guild? I mean, any guild that doesn''t have a job is going to shut you down! It seems he heard me and I can hear him laughing behind me. Hmm. This is troubling. It''s fine because I''m used to being ridiculed for being "unemployed", but to not even be able to take the test to join the guild. ''''Can''t we do something about that?I''m confident that if I take the test, I''ll get it. Buh-hoh... but I''m sorry, but rules are rules. Another grand gush of laughter. Loud laughter from behind me. ''If you take the test, you''re sure to get in! ''Oh, shit!He''s a real a**h*le, that guy! The receptionist is having a hard time with this! And then I remembered something important. That''s right. I''m sure Mom wrote a letter to me for a situation like this. ''Then I want you to give this letter to the head of the guild. The Guild Master? Yeah. .... The man at the reception desk often looked at me as if he were assessing something and then let out a loud sigh. ''''I''m afraid I can''t accept that,'''' Why? That''s where the man''s customer service smile falters, and his expression becomes one of contempt. ''It''s obvious. The guild leader is busy. There''s no time for an "unemployed" person to rip. ........The back is available, so can you please leave quickly? 11-Episode 11: This guild is over After I left Blackblade, I went to the other guilds. It''s not that I necessarily have to join the guild that my mom was in. I know that a top guild would be a better environment to hone my sword skills, but it can''t be helped. ''''What?Unemployed?Impossible. We don''t need someone like that in our house. ''''Hahahahaha!Do you really think you can join the Swordsmen''s Guild with an ''unemployed''?! I could hire you as a scullery maid. ........However, no matter which guild you go to, you''ll be rejected at the door just because you''re "unemployed". ''''Hm. Weak. I muttered to myself. I didn''t think they would even listen to me just because I told them I was "unemployed". It would be nice if I could at least show them my sword skills, but they won''t even give me that opportunity. What if I joined under the false pretense of a different profession, and after demonstrating my abilities and being recognized, revealed that I''m "unemployed"? No, I don''t want to be asked to provide an opinion. They''ll find out in one shot. I don''t know what''s going on. I don''t know what to do... Hmm? The voices overlapped. I turned my gaze and there was the blonde woman from that moment. ''''Ah!You are!It must be fate for us to meet again by chance! But I won''t. ''I haven''t said anything yet! The woman must have tweaked that and then remembered what I said earlier. You just said that!Even if you didn''t, you''ve been refused a membership to the Black Blade! Yeah. ''I see!Well, there''s a strict requirement of at least a [senior position] there! He looks very happy. ''But I have good news for you!Our swordsmen''s guild, Dragonfang, has no such terms!All are welcome!Sign up now for free!And with such a beautiful sister! I don''t think I''d normally call myself beautiful. That said, Dragon Fang or.......I don''t know if I''ve heard of it or not. ''Why don''t we just take a tour for now?In fact, it''s right there! The one the woman said and pointed at was a rather magnificent building. Bigger than the Black Blade''s home base (home). No, that''s indeed not true. Perhaps it''s the small, raggedy building next to it. ''''No, no, it''s definitely this one!This is the home of Dragonfang! Wasn''t it a weak guild? ''I told you so!Everyone knows it''s a famous guild! Come to think of it, he had claimed that. Whatever the case, this would be on a scale comparable to the top guilds. ''''Please wait a moment.'''' ? As I was about to enter the main base, I was stopped by a handful of arms for some reason. ''In order to visit, you''ll need to sign here in a jiffy. No, it''s easy enough to sign in! Then the woman shows me a sheet of paper. There is writing on it, but some of it is hidden by her fingers, so you can''t see it. "Here, here. Here, right here. .... I snatch the paper away quickly. ''Ah!'' "Subscription Agreement," it said. I ripped it to pieces. ''Ah!Hey!Wait-- With the screaming woman behind me, I stepped inside the headquarters. A spacious lobby, befitting its splendid exterior, welcomed me. However, there was not a single person in sight. It was filled with such silence that the sound of footsteps could be heard. ''''I see. So this is the famous guild that everyone knows. In other words, it''s in the past. The only thing that remained of its home base was what it was back then, but it would mean that it had fallen to the point of being deserted. ''''Ka, we have produced several top swordsmen in the past! The past is the past. The past is the past. Bragging about past achievements doesn''t change the reality. Ugh! I guess I was right, the woman let out a sound like she was spitting blood. But she''s no longer open to it. ''Oh, yes!Our glory is in the past anyway, we''re the weakest guild at the bottom of the pile now!But I never gave up!I''m going to bring back the golden age we once had! I declare so emphatically. ''So, you know what?We need people. That''s why I''m trying so hard to recruit, but I''m not getting any new recruits.Heh........ Suddenly he lowers his hips and appeals to me to indulge him. ''Then shouldn''t you pull it off with your skills, not your words?I don''t know how good you are, but the more you perform in competitions, the more people will want to join you. ''But of course I know that''s the best thing to do, but there''s a situation now...'' "Circumstances? ''''As a matter of fact, well, if we don''t add at least one more swordsman in the next few days, we''ll lose this stronghold. That''s when the woman revealed in frustration. A drunken old man came in through the doorway. ''''Hiccup........'''' Dad!Drinking in the daytime again...! Shut up, Lilia. Apparently, he is the woman''s father. He seems to be quite intoxicated and his footsteps are unsteady. But this old man ..........his right arm is missing. The sleeve of the clothes is swimming in the air with a flutter. My eyes met with the old man. ''What, are you a new guy?Ha, as you can see, this guild is done for. You''d be wise to go elsewhere. After saying that much, he left at a wobbly pace to the back. ''''........In the past, even that was the best swordsman in this city, but.......'''' You lost an arm and you became desperate. Even if you are injured when your blessings are broken, if your blessings return, your wounds will heal. But as expected, it''s not possible to heal a serious injury like a physical deficiency. ''''........Simply put, that''s about it. Moreover, since he was the Southern Sword King, he couldn''t use most of his skills as a result of losing one arm....... Hmm. The Twin Swords King, huh? That''s the highest ranking position along with the Sword Princess. ...I just remembered. The name of the top guild my mother used to belong to. The origin of the name is the Twin Swords King''s Dragon Tooth Slayer, a killing skill in the shape of a dragon that uses its sharp fangs to bite its prey. It''s dragon fang. 12-Episode 12: Its all because of shit I see. So, this is the Swordsmen''s Guild you say your mother used to run. Can I ask you one question? ...What is it? Do you know the name Farrah? The woman - said to be called Lilia - poof, her expression brightened. ''''Could it be that you''re talking about [Sword Princess] Fara!Of course!She is a female swordswoman of the golden age!Back then, my dad and I were guild two-tops, and we were always vying for the strongest name in the city!I had them play with me a few times when I was still young!She was so beautiful and kind... unfortunately, she got married and went back home... Apparently there''s no doubt about it. ''Lilia, did you say?'' Yes? ''It''s no use. Let''s join this guild. Oh, really? This is the guild that my mother was in, and I have no memories of it. So I don''t mind if it goes out of business, but as of now, I don''t think I''d be able to join another guild as an "unemployed" person. I''m not going to be able to get in, but I''m going to be able to move to another guild if it goes out of business. If you can show them that you are as good as those swordsmen, even if you''re "unemployed", at competitions and the like, then you won''t get kicked out of the gate. ''''Thank you!Now I''m going to ask you to sign the subscription form. Lilia is quick to offer it to me, as if she carries it with her at all times. There was a box for me to write my name and then my occupation, so I filled it in there as well. Lilia takes it with a smile on her face and ''''So your name is Arel-san, huh? What''s your occupation................what? His smile froze. ''''.........Um, have my eyes gone wrong?I think it says ''unemployed'' here, no matter how many times I look at it... I think your eyes are fine. You see? ''''Hmmm..........You like to joke around, don''t you, Arel?But this is a contract, so you can''t lie about it. No problem. It''s the right information, not a lie. I show him the certificate. "...and... With an icy smile, Lilia silently drew the sword she had been holding at her waist. ''What''s wrong with you, pulling out your sword out of the blue?That''s disturbing. What? If you don''t want to die, could you break the contract now...? Why?I gave you the contract because you insisted, didn''t I? No one would ever think that a newcomer with such a shitty, pompous attitude is an unemployed person, dammit! The wording has changed. ''''To begin with, to join the swordsmen''s guild in this city, you need at least a ''Swordsman'' or ''Knight'' or some other ''basic job'' that can learn the ''Sword Skill'' skill!I thought it would still be a head count, so there was no way around it, but then you said you were unemployed!You''re kidding me!As soon as you add in the Unemployed, the name of Dragonfang, which has already fallen to the ground, will plummet to the bottom of the earth!I''m a laughingstock for the future! Lilia''s leopard-like rage echoed through the empty lobby. At the thought, she''s on all fours on the floor. Well, cheer up. I''m sure it''ll get better one day. "It''s your fault, you son of a b*tc*! Just then, someone else walked in again. This time it was a woman. ''Lilia?What''s the matter with you?I can even hear the loudest voices outside now... ''Laina~!Please listen to me! Lilia cries out. She was called Laina, and she was a girl about my age. Her red hair like a burning flame was tied in a single strand behind her head. Where have I seen this color of hair before...? She is tall and slender, with long, sleek limbs. On the other hand, her breasts are more than enough, and my gaze is drawn to them. Hmm, big breasts are nice. ''''Just when I thought a newcomer came in, it''s ''unemployed''! Unemployed...?-- and you are...? The red-haired woman looks at me and her eyes widen. Then, for some reason, she raises the corners of her mouth and lets out a giggle. I never thought you''d be in this city. ''What?Laina, do you know each other by any chance? Yeah. This man is from my hometown. ...from the same town? I still haven''t forgotten how humiliating it was. I came to this city out of frustration at being defeated by you. I nodded my head. ''Who are you?'' What? The red-haired woman looks aghast. ''Wow, don''t tell me you''ve forgotten! ''No, I''ve forgotten, so I''ll just say I''ve forgotten, won''t I? f*ck off!How many times did I have to deal with you? I don''t remember. "Yes, I won the first time, but you beat me the second time! ...? ''d*mn!Have you really forgotten?! That''s why I''ve been saying that for a while now. "To begin with, I don''t think I''d forget a beautiful woman like you. Babe, babe... Well there was a guy with a similar hair color. He was the boy who helped me learn the Double-Edged Slayer and discover that I could do the same thing without any skills. Come to think of it, I haven''t seen him once since then. The vigilante''s son... Mm, my daughter! Hmm? Evans, the vigilante leader, has no son!It''s my daughter!...I mean, that''s me! ...Seriously? 13-Episode 13 I thought I was completely a man That guy was a woman. I was surprised to learn the truth after five years. ''Bad. I thought you were a complete man. ''''Ta, it''s true that I had short hair back then, and I was often told I looked like a boy, but...! On the other hand, what I have in front of me right now is a very mature and beautiful girl. It''s no wonder they don''t match. ''''Wait, wait a minute, Laina...! It was Lilia who interrupted me there. ''''You, the Swordsman, lost?This boy with no job...?Just kidding, right? Laina shook her head. ''No wonder you''re surprised. But it''s true.'' ''Oh, but that was before you were given a profession, wasn''t it?That makes sense. Not so. I had become a Swordsman a year before this man. And I had already mastered the Swordsmanship Intermediate skill. And yet, I was defeated by this man, who was only an unemployed man. That''s...impossible...isn''t it? Normally," Lyna responded in a small way, and then ''But I''m not the same now as I was then. I''m far stronger than I''ve been in the last five years. That''s what I''m doing. "This is a good opportunity. It would be foolish to deal with an unemployed person like you at this point in time, but I have to make up for it. If you are still imitating swordsmen, from now on you must deal with me. Then we went to the training grounds in the basement of the headquarters. I face Laina. Laina checks on me. "The rules are the same as they were then, right? Yeah, it''s all good. The game is played until the blessing is less than half full. It''s a large training ground with even spectator seats set up, but there is only one spectator. Lilia said, "Are you really going to have a match with the Unemployed...? He looks at me from there with a look of "I''m sorry. Then let''s go. Mm, I''m ready for you. Huh, now''s the time to make yourself comfortable. Laina kicked the ground. ''Can you still prevent this from happening to you?Double-bladed slayer! A double-edged slash, huh? You handled it perfectly at the time, and yet you dare to bring this out. ...Is it possible that he''s not paying attention to what''s going on, or does he have some kind of plan? I also responded with a double-edged slash. "Hm? I thought I had flicked Laina''s blade, which was coming at me from both sides, perfectly. But her blade didn''t falter at all, to say the least. It felt as if the blade had slammed into a block of steel. I jumped back as quickly as I could, but I couldn''t avoid it, and I had been slashed all over both shoulders. Nearly a third of the blessings would be lost at once. ''''I told you.I''ve become much stronger in the last five years, Laina says triumphantly. ''''Now I''m no longer just a [Swordsman]. I''m a [senior] rigid swordsman. A rigid swordsman. Was it a profession that could learn skills such as Monstrous Power and boasted of its overwhelming power? What did she think, Laina took her hand away from the hilt of her sword. Then it crashed into the ground and a heavy sound of a thud echoed out. I see. That sword, that''s no ordinary weight. This sword is made of a special metal, and it''s roughly five times heavier than an ordinary sword. If it weren''t for my supernatural skills, it would be impossible for me to wield it at such a high speed. What happens if you strike with a sword five times as heavy? The answer is the phenomenon I mentioned earlier. You will be defeated for sure. "So you can''t use the same move you did last time? That''s what I''m talking about. But it was good?It''s that easy to go to seed. No problem. In fact, you''ll need a handicap of this magnitude. Just to be sure, as we just saw, that doesn''t mean that my sword speed will drop. On the contrary, it''s much faster than a [Basic Position] swordsman. Laina slashed at him again. I can''t catch the slash. You will be defeated like before, or if you''re not good at it, our sword itself will be broken. ''''Hmm. But with this degree of speed, there''s no need to catch it. "Hooray!I got it! Laina''s sword cuts through me. But I''m already not there. "What? Behind you. My sword strikes Laina''s back. ''''Kuh.......when did you get behind.......!I''m sure my sword caught you...! It''s an afterimage. I used it against a King Orc as well, and it is an imitation of the Swordswoman''s skill, Afterimage. You can only use this skill if you can shrink it, so you could say it''s an application of the Shrinkage skill. One of the strengths of the Kenhime is its speed. It''s no less than the fastest swordsman in the class of swordsmanship, even if it''s not as fast as the Thin Swordsman. ''''Silly........How in the world can you imitate that, you...? Simply put, you have to move insanely fast. "...What?There''s no way I can do that... I leave the afterimage again and deliver a stab at Laina from my blind spot. "Not twice as fast as that! This time, however, he didn''t deceive me. He reacted to me and fought back. "It''s an afterimage, Nope. The real me slashed her shoulder. ''Hm?Hardly any less blessings, huh? The Sturdy Swordsman is also skilled in the art of sturdiness!Your slashes won''t do much damage! The blessings are consumed according to the depth of the wounds he would have received if he didn''t have them. Hence, Laina, who is protected by the Sturdy skill, has difficulty in reducing her blessings. If you are attacking normally, you''ll have to take at least ten more shots. ''''On the other hand, if I can get even one decent hit, I win! Laina slashes at me without punishment. I catch her sword and... Fool!I''m going to cut you open with my sword! The counterattack skill "Obtain Counter". I did not oppose her slash, on the contrary, I absorbed its power. Moreover, I blinked and added centrifugal force to my body, and I hit the strongest and fastest counter. ''''Gah! As expected of a "rigid swordsman", even the "rigid swordsman" took a lot of damage from this, and her blessings were cut in half. 14-Episode 14: I dont cry! Defeated by me, Laina kneeled on the spot, her shoulders shaking as she plumped. Huh? ''Aaaaahhhhhh! Suddenly, he shouted like a child. ''I lost again!Aaaaaaahhhh!I worked so hard, and now this guy has beaten me again! And just as I thought he stood up, he ran off at full speed. ''''........Hmm. Looks like I''ve made you cry. This isn''t the first time I''ve made a girl cry it''s not the first time I''ve made a girl cry. You''ve made her cry many times before. Hey, I''m not crying!I''m not crying! He could hear me muttering. Laina shouted that much and then left. ''''I didn''t expect to beat Laina, who''s a top-ranked B-class student...!And he''s that fast.Ho, are you really "unemployed"...? Lilia stands there stunned. Then she realizes I''m looking at her. "...Welcome to Dragonfang!I would like to welcome Mr. Arrell as a new member of our team! He has a big smile on his face, as if there was no such thing as a leopardopard change earlier. It''s a great way to return the favor. Ha-ha-ha, no?I believed in you from the beginning, didn''t I? ''Hmm, that''s funny. Who was screaming, "You''re the reason you''re here, a**h*le! Isn''t that an afterimage of me? Even I can''t make an afterimage speak. "Oh well. I''ve already signed off on it anyway. Yes, that''s right! ''That said, what do you mean by this stronghold being gone? ...well, that''s the thing... When I asked her about it, she told me all about the situation this guild is in right now. To put it simply, she said that they have a large amount of debt. And if they can''t repay the debt by the end of this month, they''ll have to vacate this stronghold that they''re using as collateral. Moreover, if they lost their headquarters, they would lose their guild status. Of course, they could immediately move to another headquarters, but with the debt they have, that would be difficult. Hmm. It sounds like you''re in quite a pinch. "Do you have any idea how to pay it back? ''''In case you''re wondering, I''m planning to participate in a guild competition in a week. If we can win that...'''' But apparently you need at least three or more people to compete. ''''That''s why I was desperately looking for recruits. ''So, currently, there are only three people in this guild, including me? ''''Ugh ... that''s right. No wonder it''s such a big building and no one else has seen it but us. ''Well, there used to be a lot of them!But after his father became like that, everyone else became disenchanted with him and quit... How is it that he''s the only one left among them? ''''Ra, Laina is a righteous child. Maybe it''s because she came to this city when she was only ten years old, she was rejected by every guild and was at her wit''s end. But then, my father called out to him and brought him home. He still seems to be grateful for that, and he told me he was going to stay until the end. You''re a surprisingly disciplined guy, aren''t you? But that''s easy to understand. We''ll just have to win this rivalry. Well, yes. What''s up?You look so weak before the fight. No, no!That''s not true!That''s right!Yes, sir!We just need to win!If you win! That''s just plain cheerful. A strong opponent. I''m not sure. Lilia hesitated a bit, then The Black Blades, sir. ....is currently considered the strongest guild in the city. So that''s it. I was the first guild to get kicked out. ...and they''re probably up to ten men, and there are three of us. Whereas this one has three. Opponent battles are basically a winner-take-all system. This means that we have three of us and we have to defeat ten of our opponents. ''''To top it off, there are eight A-class swordsmen in the Black Blade. What''s that A-grade or B-grade thing you say? Simply put, it is a grade of strength of an individual fencer. At large tournaments, the more advanced a fencer is, the less likely he is to qualify for an individual tournament. There are four levels, A, B, C, and D. Class A is the highest, apparently. The higher the rank, the fewer the number of people are, and at the A level, there are only 20 swordsmen in the entire city. It is said that they are the ones who reign supreme among the nearly five hundred swordsmen of this city. By the way, Laina and Lilia are B-class swordsmen. It''s not likely that they''ll be able to bring out all A-class swordsmen, but there''s a wide range of non-A-class swordsmen as well, and there are even B-class swordsmen who are stronger than us. But of course, we have no intention of losing to them from the start! The day of the guild competition soon arrived. There were several arena in this city, and almost every day there was a gladiatorial battle taking place somewhere. In addition to swordsmen fighting each other, there are also battles between swordsmen and demons, and large group battles that are sometimes held. All of them are subject to betting, and our match was no exception. This was the main and final match, as our opponents were the largest guild in the city. Thanks to that, the amount of betting is said to be considerable. 15-Episode 15: If you win this, you will be in debt at once Every gladiatorial match held here in the "City of Swords" is a betting contest. It is said that in large tournaments, or matches with good cards, huge sums of money can be raised. ''''With the top guilds, old and new, the stakes are quite high. In the waiting room before the game, Lilia tells me with a nervous look on her face. She says that the amount of the prize money for winning is based on the amount of the bet. But that''s still not enough to pay off the debt. Dragonfang''s popularity is one-sided, and our odds of winning are over 20 times higher than the odds for us. That''s why, if you win this one, you''ll be out of debt....... Apparently, contestants can bet on themselves, and Lilia has placed a significant amount of money on "Dragonfang". Anyway, if he lost, the guild would go out of business. It''s probably the last big game she played. It''s really healthy, isn''t it? The daughter is trying her best to protect her father''s guild. It''s dazzling. It''s very dazzling.'''' Such a voice from the entrance. When I turned my head to look at it, I saw a courageous old man. He was tall and slender, with vagrant mane of hair. He has a taunting smile on his face, but only his eyes are glittering and sharp like a wild beast. ''''Ha!Georg.........! ''However, I did hear that?I didn''t think it was possible to have an "unemployed" as a member. Even for a headcount match, it''s too much, indeed. He glanced at me for a moment. ''Lilia, do you know each other?'' ''''I don''t know anyone or anything, this guy is the head of the Blackblade guild...'''' Hmm. I thought this was not just any man, but this man is the head of the city''s largest guild? Lilia glares sharply at her opponent. ''''Gee, you don''t need to look at me with such hostility. It''s a good thing that you''re able to seize this last chance thanks to me, you know. Of course, I''m sure you understand this very well, but it would never be possible for a guild that has fallen this low to this point to be able to compete with my guild. Even if it was a new old top guild or something like that, the difference between them was obvious. I thought how they were able to set up a match with that, but it seems that this man had a say in it. ''''I''d hate to lose my former rival guild, too,'''' he said. I just wanted to do something for them. Of course it wouldn''t be with good intentions. Even I, who''ve never met him before, can tell that much by looking at the smile sticking to this man''s face. He''s the kind of guy who enjoys tormenting the weak, isn''t he? But it''s up to you whether or not you can repay the debt, right?But don''t worry. If you fall into debt and fall into slavery, I''ll buy you out. ......... Under the man''s mousy gaze, Lilia hides her body with her arms. ''''I won''t let that happen........! "Chuckle. After a disgusted sneer, the man turned on his heel. I''m sure you''ll be able to find a way to make it work. It''s a pity to lose an arm like someone else. With that, he leaves. Lilia looks away from it resentfully and then Don''t be absurd.You''re the one who''s happiest that your father''s arm became like that, and you''re the top swordsman because of it...! Now let''s begin today''s main event, the Blackblade versus Dragonfang guild competition. The field has sprung up loudly. We step onto the field as a large crowd looks on. There is a square stage set up there, and the game seems to take place on it. ''Hey, look!Dragonfang, there are only three of us! ''It''s true!I heard that you''d fallen off the wagon, but I didn''t think you''d be able to produce anything but that much! The crowd buzzed as they saw us, with only three members competing. Meanwhile, ten Blackblades, the largest number, appeared on the field. ''''Whoa!It looks like we''ve got four A-class swordsmen over here! The remaining six are all B-level swordsmen! As expected from the Great Swordsman Georg, but even so, these guys are no match for a few guilds. Next to me, Lilia''s cheeks twitched. ''''I can''t believe they brought out four A-listers...'''' Since there is not a single A-class swordsman here, he was probably expecting the other side to drop their guard and drop more strength. ''That''s the type of person who enjoys hunting rabbits by going out of his way to mess with them. Well, as far as I''m concerned, I''m grateful to fight a strong opponent. You''re good, aren''t you?And when you lose, you just have to quit as soon as you can! ''Hmm, you''re right, but so what?'' It''s a guild that my mother belonged to, but I have no further contact with it. They don''t want you to be asked to get involved in their emotions. ''''That said, is Laina okay?'''' Don''t call my name so casually! When I approached my hometown girl, who had been silent for a while now, she yelled at me like that. ''''Why are you angry?'''' Oh, shut up!I''m not angry! Apparently he still cares that he lost to me, Lilia said pleadingly. ''''Laina-san please.......I know you''re frustrated about losing to Arel-san, but for now, please focus on the game.......'''' "I know, I know!Or rather, I''m not regretting it, you know! So let''s get this first game underway!The Gladiator from the Black Blade!His opponent is Dragonfang''s... what?M..... M... Unemployed Arel...! 16-Episode 16: I dont feel like winning So let''s get this first game underway!The Blackblade to Gio the Slender Swordsman!His opponent is Dragonfang''s... what? When he said the "unemployed" part, he stuttered for a moment. The audience went into a thump. ".........Mu, Unemployed? Didn''t you just say you''re unemployed?Did I hear it wrong? No, that''s what it sounded like to me. Little by little, the buzz spread, and eventually I know that guy!He came to our guild as a prospective member! ''I know!The receptionist got us at the door! So you''re really unemployed? "Blah-ha-ha-ha!Seriously?Dragon Fang has brought out the Unemployed! You put an unemployed member of the guild in charge just because you are short on staff! Laughter broke out in the hall. No, it wasn''t just the sound of laughter. ''You ain''t gonna win, you idiot! "Then don''t make the match a reality!There are plenty of other guilds that want to play with Blackblade! ''This is a swordsman''s sanctuary!Stay out of it, you unemployed bastards! Such an angry shout echoes through the air. ''''Please don''t throw things!It''s very dangerous! Things even flew onto the stage. ''''Ya, I knew it was going to be like this...'''' Hmm. That was quite a response. How can you be so calm? What? All I have to do is keep him quiet from now on. As the spearhead of the tournament, I go on stage. My opponent also comes on stage. He is a small, slender man who looks agile and agile. His age would be around 20 years old. His weapon is a rapier. As I recall, he was introduced as the Gio of the "Fine Swordsman". ''''.......I didn''t expect to be dealing with an ''unemployed''. We''ve been taken for a fool. I don''t mean to lick it, though. I can hear Lilia''s voice from behind me, a yakuza-like voice. ''Mr. Arel!He''s a Grade B swordsman!Please take them down with no damage! If you take all of your opponent''s blessings, you win, and the guild that defeated all the players in the winner-take-all system wins. You have to defeat ten players with three players, but even if you win, the next game will start right away and they won''t wait for your blessings to be restored. Hence, they need to win out without reducing their blessings as much as possible. At Lilia''s words, Gio snorted. ''''Ha, you make me laugh. I''ll be the one to beat you with no damage.'''' Then the match began. ''I''m going to end it with a blow. In the next moment, Gio''s figure disappears and appears in front of me. A shrinkage. And then he stabs me from there. A perfectly aimed blow to my heart. Kryptonite, I suppose. I''d close the distance between us in an instant, and then strike the vital point to finish him off. If you pierce the vital point, you''ll lose all your blessings at once, but it''s quite difficult to avoid it from shrinking. This is the true essence of the Slender Swordsman, the fastest swordsman type, and the strongest skill combo. Gio''s rapier''s sword tip went straight to the heart-- That was stupid. You''re not ready for that line yet, are you? What? --I went through it, but it was just an afterimage of me. The real me is behind Gio. I''m going to return the favor and shoot him in the back, aiming for his heart. It''s a kryptonite thrust. Ugh! As expected, Gio avoided a direct hit to the heart by twisting his body as quickly as possible. Even so, he was pierced in the shoulder and his blessings were greatly reduced. ''''Ridiculous!Is that an afterimage?A skill that should only be used by the Fine Swordsman and the Phantom Swordsman, why you, an unemployed person, should be able to use it...?On top of that, you even used a kryptonite thrust...! Gio was astonished, but seemed to change his mind quickly. But I''m pretty good at afterimages. Gio''s figure separates into two. Hmm. That''s quite an afterimage. I can''t quite tell which one is the real thing. One of them shoots out a stab. But the heart it pierces is once again my afterimage. But Ghio seemed to read it. ''I don''t ride in the same hand!The real one''s this way!........What! Too bad it''s just an afterimage. Yikes! Once again, Gio''s blessing was reduced to a sneakily low level. Just one or two more blows. ''Two afterimages at once?But that''s the least I could do...! This time they separated into three and Gio rushed forward. ''''Who said you could only do two bodies?'''' What? I''m going to create a total of five afterimages to attack Ghio. Three against six, the outcome is clear. Once again Gio''s stab fails to catch me, and my sword slices through Gio''s body. Finally, all of Gio''s blessings are lost. ''''Sho, winner, Arel! The end of the match was declared. ''Bah, stupid....................'' I tell Gio, who is on his knees on the stage, his lips shivering in astonishment. ''''I''ll make one correction. There are other swordsman-type professions that can learn the Afterimage skill. What? The Swordswoman. Gio''s eyes widened as if in a huff. ''''Keh, a swordsman-type [Highest Rank] [Sword Princess]...?But that''s only for women... He''s right, only a woman can become the Swords Princess. But it doesn''t matter to me. After all, I''m just an ordinary person with no job. 17-Episode 17: Why do you overwhelm the A-class swordsman? Hey, that guy is really an unemployed person... right? Yeah, right?Normally, you wouldn''t lie about your profession at a convention... What if... Why are you overwhelming a Class A swordsman? Guh! My sword avoids the protection of my opponent''s shield and slashes through his thighs, taking away his blessings. ''d*mn you!'' My opponent fires back at me in a yakuza-like manner, but a slash cuts through the air in front of me as I was quickly backing away. ''''Don''t be silly!There''s no way you''re unemployed! The man who roared with such a rage is a "Shield Swordsman". Since he is equipped with a shield in one hand, it is an occupation that allows him to have a well-balanced fighting style with excellent offensive and defensive skills. It is quite difficult for the A-class swordsman to deal damage by sneaking through the protection of his shield. You can''t go so far as to say, "Thanks to you, it''s not overwhelming. The only thing I can do is chip away at the blessings little by little because I''m not hitting the vital points. That''s already funny to me!You don''t have to be ''unemployed'' to have won this far without a single scratch in the first place! As he called out, I had dispatched six B-class swordsmen in a row, and now I was facing the seventh one. Fortunately, I hadn''t been attacked once so far, so my blessings continued to be maxed out. ''''I don''t want you to say that. I''m a veritable ''unemployed''. So how can you be a decent cutthroat with me, when I''m supposed to have mastered the sword technique and advanced skills? That''s obvious. Because of my sword training. --effort, if you will. That''s a profession and a skill that can''t be solved by hard work! He slashes at you with a look of anger. But he pretends to be. You got it!Shieldbash. He tried to slam his shield down on me. But I can read that move. "Anticipation. By intuitively predicting the next move, I start moving faster than my opponent''s initial move. It''s one of the hardest Sword Princess skills I''ve had to learn. I backstepped to evade the shield attack and delivered a kick to the side edge of that shield. ''''Wha?'''' The shield, which is a lifeline for the Shield Swordsman, blows away from his hand. ''''Hm, now I''ve managed to deal with that troublesome shield. Hey, you know, that''s a... The sword-fighter you just fought, how do you think he did it? It was a poor one, though, due to a lack of practice yet. I should have lifted my foot a little higher. I''ll need to adjust my angle too. Hmmm, is that about right? What...? My foot was impaled on the other man''s side. I lost my shield and lost the will to fight, or maybe I was just standing there stunned, so I had them use it as a training ground. It seems that he got into a good spot as he intended, and his blessings are quietly decreasing. ''''See, look and see........!I can''t do that! ''Sure, some skills take practice, but I''m sure some things can be imitated to a certain extent on the first try, don''t you think? I picked up the shield my opponent had dropped and held it up. ''Like this?'' Nah.... He continues to close the distance. ''''Ta, don''t think you can handle the shield easily........! The Shield Swordsman, who had his shield taken away, slashed at me. ""Catching away." What? I tried the Shield Swordsman skill that was shown in front of me a few times earlier. The sword deflected as it slid across the surface of the shield. Furthermore, this skill also had the effect of breaking the opponent''s stance, so I didn''t miss the opening that was created by doing so and looked at the counterattack. ''''Bah, idiot........'''' The Shield Swordsman, with his blessings reduced again, tries to hurriedly get away from him. But I wouldn''t let him. I closed the distance between us by "shrinking the distance between us and ourselves," and also rushed forward with that momentum. I slammed my shield down. ''''Shield Bash!'''' What? He takes a strong shield blow and is blown wide open. Hmm. Just as I thought, this technique is a good match for "shrinking ground". You can go straight into it from a full blown sprint. .........I don''t think my skills are also....... He was thwarted by his own technique and finally lost all of his opponent''s blessings. ''''Winner, Arel........! The name of the winner echoes in the silent hall before you know it. ''''........He even beat a Class A swordsman.......? And I can''t believe you haven''t taken a single hit yet... Hey, are you really an unemployed person? Such a voice could be heard from all over the place. ''''No, no, no, unemployed or whatever you think it is, it''s not true!I''m definitely faking it! ''You''re not going to let them do that!What the hell is the management doing?! ''Yes, yes, yes!Disqualify me! As if to cut through the silence, such an angry shout also begins to rise. ''''........But, if it wasn''t ''''unemployed''''......then what is that guy''s occupation......huh? "......... That''s why I''m saying I''m unemployed. I just had the "Appraiser" take a look at it right before the tournament. Sensing this atmosphere in the venue, the organizers of the tournament seemed to have made a move. ''What?Ah, yes. Arrell, are you ready?'' I don''t mind. The facilitator unfolded my certificate and held it up. It would be difficult to see from the audience, but if you have reasonable eyesight, you should be able to read the occupation written on it. ''''Mm, Unemployed........she''s really unemployed.......? ''Seriously...'' Of course. If you think about it for a moment, you will understand that there is no point in going to the trouble of falsifying your occupation as "unemployed" in the first place. 18-Episode 18: I was shown a good one Starting with the first A-level swordsman, he began a series of battles with A-level swordsmen. The second was the Double Swordsman. And the third was the "Holy Knight". The Soukenshi was a swordsman-typeadvanced positionthat could use the Nintendo skill. He had a bit of a hard time with the large number of hands, but he defeated them unharmed. The next "Holy Knight" was not a swordsman type, but a knight type, and its greatest feature was the fact that it had more blessings than a normal human thanks to its "enhanced blessing" skill. For that reason, he is a troublesome opponent in terms of the rules of a match. Well, I was able to defeat him unscathed. But ........ Can''t we learn this skill somehow as well? That''s great, Mr. Arrell!There''s one more!I can''t believe I''ve managed to outsmart nine people...!Please keep on knocking down the last one as well! Lilia''s cheers come flying in from the side of the stage. ''''Oh, come on.......if we keep this up, Dragon Fang is going to win for real.......'''' ''How high a payout would that be........'' "d*mn, I should have put my money where my mouth is...! No, we don''t know that yet. Look. The next guy to come out of Blackblade is one of the best A-listers in the world. Now the tenth swordsman from the Black Blade has arrived!Masamune! My last opponent comes up on stage. He is a man of mature years, dressed in a costume I have not seen before. It seems that I am the last stronghold, that I am. The sword held at his waist was not the straight sword commonly used, and the blade was slightly euphemistic. Also, the sword''s width was as thin as a rapier. ''''Sword, huh?'''' You are on the left, that I am. My occupation, the Swordsman, is the senior position of the Samurai, the swordsmen of the East, that it is. As expected of the Sword City. There are even swordsmen from the east. "Hmm. This is a pretty interesting opponent. I held my sword at the ready. But my opponent didn''t pull his sword out of its scabbard, he just slumped forward slightly. ''''You''re not going to pull it out?'''' This is my stance, that it is. ...I see. There''s no gap at all. If I stepped in carelessly, my opponent''s sword would cut me first. My trained ability to "anticipate" ahead of time was sounding the alarm bell. "Well........as expected. It was my intention to use my special skills to defeat you with a half-hearted sword, but they are quite sharp. Is it a special skill? It''s probably a technique that can be released from that situation where the sheath is put away. If you''re not pulling out your sword, a normal person would think that he or she is taking you for granted, and if you''re not careful and step in, you''ll be killed in a heartbeat. It''s a very difficult type of skill to deal with on first sight. But as it is, we won''t be able to see the skill we''ve been working on. That''s unfortunate. I''m going to get closer to my opponent. "Knowing this, are you going to jump into the land of death yourself? And that was when the distance between him and me was two meters. The killing spirit that had been quietly suppressed until now erupted from the Eastern Swordsman''s entire body. A moment later, a sword flashed and I saw the figure being cut in two. However, this is my afterimage. I left the afterimage in front of me and started to cut at the Eastern swordsman from the side. "Sweet, that it is. Huh! However, the Eastern Swordsman was not deceived by the "after-image" and had a firm grasp on the real me. The proof of this is that the sword has not yet been pulled from its scabbard. "--Iai-slaying pole. The Great Swordsman special skill is unleashed. The divine speed slash - snatched a few millimeters away from my nose. Of course, the opponent, who is a sword expert, did not misjudge the distance. It''s because I assessed the timing and dropped back to just barely out of reach. "Don''t tell me that you have seen through my sword perfectly, that you have........? You''re fast. But I hate to say it, but I''m used to seeing swords so fast, thanks to my mother. However, he was able to anticipate what kind of technique it would be, and that''s why he was able to perform this trick. The vision I just saw made it possible. At that moment, the skill wasn''t activated, but the hint of it was enough for me. It''s great that he didn''t get caught by my ''afterimage'', but at that point it was already decided that his special skill was going to be a dud. I''ve seen some good things. As a token of my appreciation, I''ll show you one of my special killing skills as well. -- "Piercing Tempest Perhaps it must have looked to him as if countless flashes of light flashed. The Sword Princess''s special skill, the Piercing Tempest. She unleashed a series of lightning-fast stabs that were just like a storm. There was no way he could avoid them right after he drew his sword. All of the blessings were blown away in an instant as the stabs hit every part of his body. ''''Sho, winner, Arel!This means that all of the Black Blades have been eliminated, so Dragonfang wins!'''' That declaration caused a tremendous stir in the hall. "He beat one of the best swordsmen in Class A........ And without ten men...? ''Blackblade shit!I can''t believe we were beaten by that guild!Shame on you! ''How many bets did you think you''d have to make this time?I want my money back! Some were genuinely astonished, while the majority of people were betting on Blackblade, and there was some indignation from all over the place. ''''Yes!It''s great, Mr. Arrell! Lilia jumped up and down with glee. 19-Episode 19 ''Oh no, the abominable face of the defeated Blackblade Gilmouth!Woof!I''ll have a bottle of wine with that one! Lilia let out a nasty laugh, as if she had accumulated so much resentment. After that match, I met the Black Blade''s guild leader again, and he certainly seemed quite frustrated. He just glanced at us and left without saying a word. We won the guild competition and now we''re back at our home base. We, or rather, I was the only one who fought in the end. ''That''s not important!We wouldn''t have been able to beat a Grade A swordsman anyway!Hey, Laina! Laina was suddenly asked to agree, "What?Ah, yeah........" she nods vaguely. Without caring about her reaction, Lilia, who is high on tension, entwines herself in my arms. ''''Fufufu, my debt is paid off now, I didn''t have to sell my headquarters, and on top of that, I''ve got enough change to pay for it.......!Thank you so much, Mr. Arrell! I''m in too hot a place, would you mind stepping away? Don''t be embarrassed!What man wouldn''t be happy to be embraced by such a beautiful sister! Don''t call yourself beautiful. It''s okay?May I take my young desires out on your sister? With a s*xy smile on her face, Lilia presses her breasts into my arms. Unfortunately, I''m a poor breast, so it doesn''t feel much better. ''''.........With Arel-san, our guild is safe.......I definitely can''t let it go.......and although it looks hardcore at first glance, Arel-san and I are both men.......if we cage them with a woman''s s*x appeal.......no, this place is already.......'''' I know you''re secretly planning something, but I can hear you. ''Mr. Arrell!Marry me! "No. A quick answer?You don''t even pretend to be bothered by such a beautiful woman asking you to marry her! Rather, why should I bother? ''Terrible!Even so, she was once in the newspaper as a "beautiful but unfortunate swordsman"! Is that sales pitch an honor? What''s wrong with me? He''s not my type. Boom! If anything, I''d rather have a woman like Laina. Unlike Lilia, Laina has big breasts. I believe that a woman''s greatest attraction is her breasts. And the bigger they are, the better. ''''Wha ... what are you saying, you! Laina raised her voice. ''Jeez, you''ve got to be kidding me!You''re kidding me! Are you kidding me?Like I said the other day, Laina is a beauty. What? I didn''t expect the red hair I thought was a boy to have grown into such a beautiful woman. I still can''t help but be amazed. ''B-b-ba, don''t be ridiculous! "?Why would that make you look like an idiot? ''I know!Wow, there''s no way I''m beautiful, because there''s no way I''m not!I''ve been swinging swords all my life and I''ve grown up being told I look like a man!I mean, and unlike Lilina, I''ve never even worn makeup. I don''t think I need makeup. Jito. And for some reason, Lilia was staring at me and Laina''s exchange with half-lidded eyes while uttering onomatopoeia. ''Gohon gohon!Anyway! Lilia lets out a deliberate cough and forcefully interrupts the conversation. ''Let''s all have a quick drink today!Whatever it is, we''ve been able to protect this guild! For the record, I''m not a drunk yet. I''m not much of a drinker either... ''Then let''s have some good food!Of course the guild is buying it!We''ve made a lot of money, you know! Hmm. If you''re offering me free food, I''ll be grateful. ...you''re annoying. Just then, a one-armed old man, drunk and drunk, walked in. He was Lilia''s father, the former head of the guild here. ''Dad!Ask me!We''ve defeated Dragonfang! ''Oh?Ha, it''s probably two or three troops anyway. No, no!Of course, they weren''t the best members, but they had four A-level swordsmen out there! .... The old man turns his scowling gaze to his daughter. ''''No, no, I didn''t play much of a role, but...'''' Not much, not much, I didn''t do anything. ''Oh, thanks to Mr. Arel!He beat four A-level swordsmen by himself!With Arel-san, it''s only a matter of time before our guild regains its former vitality! "Well think about it, Lilia. The other major guilds won''t tolerate a guy like that. I''m sure they''ll be looking for a better deal from now on. Do you think this is how long you''re going to last? You don''t have to worry about that!Because Mr. Arrell is going to marry me! Hey, don''t make that decision for me. I don''t remember making such a promise. But, that being the case, this old man is irresistibly annoying to watch....... I couldn''t resist saying something. I''m not sure. How long are you going to continue to tease me like that? ...What? ''You could swing a sword if you lost an arm or two. No, two would be a bit difficult. It''s not impossible to think of a way to swing it with your mouth or feet, but it''s going to take some time to be able to fight in a reasonable manner. When you think about it, it''s far better just to have one arm. ''''What do you know about........?'''' The old man raised his voice and crowded in. It was Lilia who stopped him in a hurry. ''''Oh, please calm down, father........! Get out of my way! "What? Lilia was pushed away-----she snapped. What? Revealing her true nature, her straight right hit the old man cleanly in the face. The old man fainted and collapsed to the ground. ''''.....Well!So let''s go celebrate! Lilia told her as if nothing had happened. Hmm. This woman has quite a bit of brazen nerve, after all. 20-Episode 20 Is it a masochist? I could hear the chirping of birds. I woke up in the fresh morning sunshine coming through the curtains. ''''Hmm?'''' I immediately notice that my body is half wrapped in something soft. When I turn my gaze, I see a naked Lilia sleeping next to me. Its eyelids, framed by long eyelashes, slowly open. ''''....Good morning. Last night was very intense, ah, na, ta?. I grab her face with one hand and try to crush it as hard as I can. ''Geez!Hey, your head!My head is going to crack open!Give, give, give, give! He instantly declared a giveaway, so I had no choice but to let him go. Lilia screams with tears in her eyes. ''''What are you doing?!'''' That''s my line. What are you doing in bed? And you''re naked. ''Don''t tell me you''ve forgotten about last night!He loved me so much!So please don''t put an iron claw in the maiden''s face! Then get dressed. Of course, there is no evidence that anything happened between me and this guy. She was drunk and fell asleep at the restaurant, so Laina carried her back here to the headquarters. As it is, this guy should have been put to sleep on the bed in his room. ''''Ugh.......I didn''t expect her to do the Iron Claw without a care in the world against a damsel who had made up her mind and decided to color up.......'''' ''I used to do that to my parents'' stupid, dickhead sister. I''d rather be the cute one, Ironclaw. Your poor sister is too sad! No, no matter what you think, it''s worse to sneak into someone''s bed naked without permission or try to kiss me while I''m sleeping. ''I mean, Are you really fifteen years old, Arel-san?It''s supposed to be normal and healthy for a normal and healthy 15 year old boy to be curious about female bodies and to attack them like a beast when he sees them naked! If you''re going to color me, you''re going to have to grow at least ten more inches on your chest before you can come back. Horrible! I let go of the screaming Lilia and leave the room. Here at Dragonfang''s headquarters, there are several rooms where you can sleep in, and I''m currently renting one of them. I''m grateful for that, since I can save on the cost of lodging. After washing my face briefly, I walked into the training room. It''s a large space with no one in it. It''s a fine training room, as expected of a former top guild, but since there aren''t many members in the guild, it''s almost always booked out. ''''Well, it''s morning training. Stand upside down with one right arm and do push-ups from that position. ''One, two, three, four........'' Nine hundred and ninety-six, nine hundred and ninety-seven, nine hundred and ninety-eight, nine hundred and ninety-nine....thousand. ....wind. After completing a thousand push-ups on both sides, I take a breath. Just then, a girl with red hair came into the training room. "Is Laina practicing in the morning too? Yeah, that''s right. When I called out to her, she looked away and responded with a voice that was heavily upturned. Hmm?As usual, you''re a bit of an afterthought, aren''t you? I wonder if the fact that you lost to me is still a problem for you. I''m a fellow countryman. I''m sure we''ll all be able to get along if we can. Laina! What is it? ''Would you mind hitting me with the sword in its sheath for a moment? What kind of s*x do you have in mind? ...proclivities? What are you talking about? ''And Laina is probably the best person for the job. ''Wow, I''m not the kind of person who enjoys doing that! "...?I don''t need you to say that, I need you to help me. I need Laina''s help. ''Well, you''re that attached to me.........After what you said yesterday, you didn''t think that you were referring to me... For some reason, Laina''s face turns bright red. "...What are you talking about earlier? You''re the one who''s crazy, aren''t you?Wow, you pervert who''s trying to get pleasure from me beating you up! Hmm. At any rate, there seems to be some kind of grand misunderstanding. Your swordsman can learn the skill of sturdiness, right?I''m trying to replicate that. Robust? Sturdy - that''s what I call ''resilient''. And what I think you have to do to get hit hard is to take a lot of hits without any protection. Furthermore, considering the efficiency, it''s better to have someone with as much offensive power as possible to help. That''s why the Rigid Swordsman Laina is the right person for the job. However, as expected, if you get cut with a serious cut, you will die, so I''m asking you to hit me while I''m in my scabbard. You''re going to have to be able to say that quickly!I must have made a strange mistake!I thought you were a masochist... I apologize for that. So, can you help me out? Okay, fine. But I don''t think you''ll be able to learn the Sturdy skill in the usual way. If it were really possible, someone somewhere would have done it by now. Snorting lightly, Lyna dismisses it as ''impossible''. ''Indeed, it would be hard enough to keep up with a normal attack,'' I know. So I''ll have to keep on taking it... not just normally, but I''ll have to take it. 21-Episode 21: Efforts Will Not Betray I had just destroyed all my muscles and was running out of blessings to heal them, so I decided to have Lyna hit me with the sword immediately. ''''Now that I said I''m going to do it, I''m really serious about it too, right?Don''t whine on the way out, okay? Of course. --and thirty minutes later. ''''Also, no more!I''m really going to die any more! Not yet. Come on. You''re covered in blood! Don''t worry. You can''t be too close to death. It''s not as difficult as finding the line of death. ...I''m still five steps away from death. ''My heart is broken as I''m beating it long ago! Don''t whine, ''That was supposed to be my line! For some reason, Laina had reached her limit before him. ''''I knew you were a terrible dominant person!d*mn, it was a mistake to go along with this pervert''s training! Then, when he''d been beaten up enough more, Lyna threw her sword away as if she didn''t want to anymore. ''''Hm. Well, let''s just leave it at that.'''' I was a wreck all over. ''''Haha, that''s a lot of pain, indeed.'''' I couldn''t help but laugh. My mouth was full of blood, so that was enough to send blood splatters flying through the air. ''''........I''ve never seen or heard of this kind of training......'''' Laina slumped to the ground with a blue face. Even for a swordsman, he usually rarely sees blood or injuries thanks to his blessings. So I guess I''m not too used to it. ''''But I''m hungry. Anyway, let''s have breakfast. ''Don''t try to take a meal in that form without a care in the world!Quickly drink the holy water! That won''t be necessary. One of these days the blessings will come back and it will heal on its own. "....stupid, this guy... I''m out of my mind. I''m only doing what''s perfectly normal. If you''re trying to rise to the top of the swordsman''s ladder without a job, this is the least you can do. "But will this really help me learn the Toughness skill? I don''t think so. What? That''s not enough. That''s why we have to do this a hundred times over at the lowest point. "Whew, whew, whew, a hundred times? I said to Laina as her eyes widened. ''So I''ll ask you about ninety-nine more times,'' ''You said, "Now that I said I''d do it, I really mean it, too."'' "Because I didn''t know how crazy you were then!Oh, a hundred times like that, it''s insane by any stretch of the imagination! After breakfast we were back in the training room again. By the way, my wounds had healed. It was because Lilia had forced me to drink holy water. But holy water is expensive. I''m going to repeat this at least ninety-nine more times. I''m not sure how much money I would have to spend if I had to drink holy water each time. In the first place, there was no guarantee that he would be able to master the Robustness skill this way!A skill is a goddess'' blessing!Hence, it''s not something that a human being can acquire on his own! That being said, I could use some of them, couldn''t I? G..... I''m rather curious. It''s not just about Laina, but why is everyone so caught up in stereotypes like this? You don''t know if it''s impossible or not until you actually try it. Impossible. It''s hard. We can''t do it. Only those who have actually tried and tried and tried and tried and tried, and confirmed for themselves that it''s not possible are allowed to say so. To declare it impossible before you even try is nothing short of foolishness. "Lend me that sword for a moment. "?Okay, but it''s too heavy for you, isn''t it? I accept Laina''s sword. It is indeed quite heavy. It''s probably many times heavier than normal. But, well, this is no problem for me. Bam-bam-bam! What...?How can you just shake it off?And that speed.........Because of my monstrous skills, I can unleash a slash as fast as an ordinary swordsman! "Double-bladed slayer. Boom! You''re not going to use that sword to do a double-bladed slash...? No, that was a mistake. It''s hard to cut with this sword, but you''ll be able to do it sooner or later. But you''ll be able to do it eventually. ''Why?How could you, an unemployed person... I don''t have any super strength skills, of course. But I can train my muscles. And the way to do that, of course. Strength training. Strength training...? This guy doesn''t know anything about strength training? ''It''s all about training for muscle strength. Because the more you train a person''s muscles, the stronger they become. Yeah, I know a lot about that!But ... it''s not like that... So this is nothing compared to your superpower as a gift? .... Laina keeps her mouth shut. Apparently, she''s finally starting to realize her firm beliefs. ''Since my rematch with you the other day, I''ve been doing muscle training every day without fail. For example, standing on my head with one hand and doing push-ups from there. That''s one (...) day, one (...) ten thousand (...) times. Ten thousand? And this is the result. I rolled up the sleeves of my clothes, exposing my arms. As I put more effort into it, my muscles swelled up with munchies. ''''~~~~? Laina is stunned. ''Hmm. I''m getting along a bit better there, but it''s not quite there yet. Well, in a week and a bit, this is how it should be. In the past, I used to run 10,000 dashes every day to learn the Agility skill, but I think that took about three months. Agility is essential for the [Sword Princess]. ''''In short, what I''m trying to say is. Effort is not to be betrayed.'''' 22-Episode 22 What a Cold Son "The Sword God''s Cup? ''Yes!Named after the illusory [super-grade profession], the [Sword God], this is the biggest tournament in the Sword City to determine the greatest swordsman in name and reality!Of course, I''d love to have Arrell-san compete in the tournament! Saying that, Lilia held out what was an entry sheet. ''''It''s not the marriage license that was made to look like that, is it? What do you mean, no? Then why are you in such a hurry to look away? No, I was thinking of that option... of course, I dismissed it because it would definitely be exposed! .......You''ve been thinking about it. It''s been a while since that rivalry, but I was still a member of Dragonfang. Training and muscle training with Laina is the main menu these days, and there''s no need for me to move to another major guild in a hurry. As I found out during the recent rivalry, the best way to hone my real-world skills is to fight against strong opponents. Since there are only B-class swordsmen here, it''s a bit lacking. If they could master the Stout Swordsman skill, they would no longer have any use for this guild. ''''No, no, why are you so businesslike!Don''t you have any affection for the fact that we''ve protected this guild together!There are beautiful women like this! No. Assured! Lilia shouts with her head in her hands. ''You say it like we fought together in the first place, but you didn''t do anything about it, did you?Don''t take the liberty of glorifying the past. Ugh. Lilia is frightened because my point is too brazen. ''So, but!This is the guild that your mother was in!I think we can take that into account as well! You''re my mother. I''m me. What a cold son you are! After shouting out loud, Lilia let out a loud sigh, huh. ''''When I found out that Arel-san''s mother was that Sword Princess Fara, I thought it was truly fate....... How could someone with no blood and tears like Arel-san be born from such a kind and receptive woman....... Is that really all you need to know? Just in case you''re wondering, I have blood and tears too. .........Come to think of it, I''ve been shedding blood every day lately, but I don''t remember shedding any tears at all. "I''ve managed to get you out of danger for the time being. That should be enough. ''''Then at least enter the Sword God''s Cup as a member of Dragon Fang! ''''Come to think of it, we were talking about that. When exactly is this Sword God''s Cup thing going to be held? Well, you see. According to what Lilia explained to me, there are qualifiers and finals in the Kenjin Cup. In total, only thirty-two people could participate in the main competition. Twenty of them were confirmed by twenty A-level swordsmen. The remaining twelve slots were to be contested by fencers of B grade or lower in the preliminary round. ''Arrell-san is still a D-class fencer, so he has to win the first and second qualifying rounds and two more to qualify for the main competition. The first preliminary round is said to be held with only C-grade and D-grade swordsmen. In total, there are about 400 fencers competing, and only one of them is allowed to advance to the second round. If a swordsman survives, he or she is put through to the second round, where the B-grade swordsman participates. Again, out of nearly a hundred fencers, only twelve were allowed to compete in the final round. The final round was to be decided by the 32 contestants, consisting of the 20 A-class fencers and the four who had passed the preliminary round. ''It''s not an easy road, is it? ''Yes, that''s right. And the first round will be held a week later. Then we''ll go through the second round, and the final round will be about a month from now. A month later? At the current pace, it would be roughly around that time that he would be able to learn the Rigid Swordsman skill. ''''Also, if you want to gain some real-world experience, I have the perfect place for you! Hmm? Lilia''s guide brought us to a large building in the western part of the city. It looks like a prison, but people have been coming and going without a hitch since a while ago. ''''Is this the dungeon you''re referring to? ''Yes!Here in the City of Swords, there''s a vast labyrinth underneath! Dungeons. It is said that the gods give birth to this world on a whim, and it is a mysterious labyrinth that exists all over the world. Each dungeon has its own characteristics, but the common denominator of all dungeons is a complex maze-like structure with many traps and crawling with demons. But I didn''t expect to find a dungeon in a city. Originally, the dungeon was there first, and then the city was built on top of it. The reason being, this dungeon was the perfect place for sword training. And Lyrina. ''What exactly?'' Well, you''ll find out when you get there. Since he''s so deserving, I had no choice but to follow Lilia into that building. By the way, Laina was also with me. When I told her I was going to the dungeon with Lilia, she said she was going to follow me. ''''Wow, I also wanted to build up some actual battle for the Sword God Cup! She''s going to compete in it too, apparently. Or rather, I heard that more than 90% of the swordsmen in this city are going to compete. ''''........This was our chance to be alone together....... The plan is to use the dungeon effect to mistake the pounding of the dungeon for the pounding of romance and rapidly approach each other............. Lilia is muttering something disappointing, so I think it''s a good thing Laina followed me. 23-Episode 23: There seems to be nothing to learn The interior had the feel of an underground ruin made of stone. The passage is quite wide, more than ten people could pass in line. Even so, it still feels a bit cramped due to the large number of people present, perhaps because of the entrance. ''''As you go deeper in, the more sparse the people become. This level alone is about half the size of this sword city.'''' The dungeon here seems to have a structure that makes it seem like you''re going underground. The entire labyrinth must be frighteningly huge, because even a single level is half the size of a city. We avoided the crowds and proceeded deeper into the labyrinth. After a while, multiple figures stood in front of us. ''What are these guys?They''re trying to block our path. The figures wore full body armor and full-face helmets on their heads, so their faces, ages, and genders were unknown. But they each held a sword in their hands, and they were clearly ready for battle. ''''There is no one among them. This is a moving armor--a type of demon called Living Armor.'''' ''Demons?Are these guys demons? Yes. Oh, here I come, please be careful. He interrupted his conversation with Lilia and intercepted the approaching full body armor. For being clad in heavy-looking armor, they moved surprisingly fast. The leading unit unleashes a slash. The blades approaching from the left and right at exactly the same time.......is this a "double-bladed slash"? Late. My sword took the initiative and shattered the head of the full body armor with the helmet. ''''.......What?'''' But despite the destruction of my head, the full body armor slashed into both of my arms as if nothing had happened. ''''Be careful!These guys don''t have a sense of pain, and they don''t have a kryptonite like humans do! Hmm. Well then, say so quickly. You''ve received a decent amount of swords, and you''ve lost a bit of your blessings. ''Not a great deal, though, after your training with Laina. The lack of human kryptonite is a bit tricky, but that''s something to do. I slashed off the arm of my full body armor. As expected, I wouldn''t be able to wield a sword if I lost my arm. ''''Mm. Let''s go tackle him. It''s quite a gutsy thing to look up to and attack without arms. I think someone should learn from this. I ducked the rush and cut off his leg. It tumbled back to the ground with a loud crunch, and since it didn''t have any arms, it couldn''t get up and was struggling to get up. A second and third body immediately attacked, but I incapacitated them as well as the second body. "Oh, it''s not moving! The full-body armors made a metallic sound for a while, but then they suddenly fell silent, as if a thread had been broken. ''''The dungeon has cut off the supply of magic. So you''re saying that these guys were powered by magic. But they were even using their skills? ''Yes. That''s right. Actually, this dungeon, this living armor is the only one that appears, but it comes with the skills of a swordsman-type profession or a knight-type profession. The current one is the lowest level living armor that can only handle the skills of the [Swordsman] profession. Lilia says that the lower you go, the more powerful living armor appears. ''''I haven''t encountered them yet, but I heard that there are living armors that can use swordsman-type [highest level] skills. I see. That''s quite interesting. Although it''s a bit different from dealing with humans, this would certainly be a good real-world training for fighting against humans. A little further on, the living room armor stood in front of us again. ''''Oh, please let us fight too!'''' Lilia says as she draws her sword. It''s the lowest level of living armor anyway, so it doesn''t matter. ''''Come to think of it, this is the first time I''ve seen Lilia fight. What''s your profession?'''' The Slender Swordsman!Even so, they call her by two names, ''Lilia the Flash''! Oh, "The Fine Swordsman"? The Fine Swordsman is like a backwards-compatible version of the Sword Princess. In other words... ''It looks like you have nothing to learn from Lilia. Horrible! Each level of the dungeon is said to have a transfer magic circle that allows you to travel to and from the ground. It is said that you can fly to a level you have been to once, and return to the ground from there. ''''That''s convenient,'''' Yes, that''s right. So if you''re tired, I recommend that you get back to the ground and get some rest. Lilia convinced me to return to the ground once I got there. When I used the transition magic circle that was set up at the entrance of the second floor, I was back at the entrance to the first floor of the dungeon where there were many people. Next time, he didn''t even have to bother to break through the first floor, he could suddenly start from the second floor. Or rather, they only made it to the second floor after six hours. As I had heard, it''s a tremendous amount of space. It would take a bit more time to fight the powerful living armor. ''''How far have you two dived before?'''' I''m up to the 12th floor. I''m on the 14th floor. Then can''t I just jump to that level with you? I asked, and they shook their heads. ''You can''t do that. The only person who can transfer to that level is the person who went there. Look, I would have started on the fourteenth floor but I have no choice but to go along with you. No, you don''t have to go out with them, Laina, do you? No... no, no, but... but... if you say so, then so does Lilia...! I have to show Mr. Arellu around. I''d be lost without someone who knows the directions. Ggghhhhh... Laina clears her throat in frustration. ''''Would you rather read the air?(I''d like to make love to Mr. Arrell alone.) I didn''t say it out loud, but I could somehow read Lilia''s inner thoughts. Totally. I don''t know what she''d do if she left me alone with this woman. ''I''d be more grateful to have Laina with me. Huh? Laina screams indiscreetly. "Nah.........you.......do you know how far you have to go to make fun of me.......? "?I don''t mean to poke fun at you. Why is this guy turning red in the face? 24-Episode 24: You just have to defeat them all at once Strength training, training to improve sturdiness with Laina''s help, and diving into the dungeon. After living with these three things as my main focus for a while, it seemed like a week had passed in the blink of an eye. Before I knew it, the first round of the Sword God''s Cup had started. As many as four hundred C- and D-class swordsmen were participating in this qualifying round, they decided that it would be too much trouble to have one-on-one matches, so they decided to have ten people compete at once. I''m a newcomer to the city and I''m a D kyu, so I''ll be participating from this first round. ''''Then let''s start the next fourth match!''Players, please come up to the stage!'' Hmm. Looks like it''s my turn. Take your place on the stage. This stage is unusually circular in shape, with ten people lined up at equal intervals. Only one of them is able to advance to the next match. He was the one who kept fighting without losing his blessing until the end. ''''Mr. Arel!Good luck!-- I mean, aren''t all the other opponents, all of them Black Blade swordsmen! It wasn''t really necessary, but Lilia, who had come to support her, raised her voice. ''''Kukku, that''s a shame, Unemployed? That woman was right, we are all Blackblade swordsmen. Well, coincidences can be scary, can''t they? ''''Quite. I didn''t expect that nine people other than you would be swordsmen from the same guild. My opponents grin and say that to me with a smirk. ''What a coincidence!That''s deliberate by all accounts!They must have infiltrated the management with someone who was breathing down their necks and manipulated them to get this kind of combination! Lilia yells at me, but Oh, come on, don''t be a prude. It''s the result of a proper, honest-to-goodness lottery. Then show me the proof. And they denied it outright. Unless they were so dumb, they wouldn''t have left any evidence. As if they understood that, Lilia groaned without saying anything back. ''''You don''t have to go through that kind of trouble separately. I said. ''We''ll just take it all down in one piece.'' My opponents raise their eyebrows at my words. ''Lick me!'' For the record, we''re all in the upper echelons of C-level. ''''No matter how many Grade A swordsmen you kill, there''s no way you can beat this many. ''''Your Kenshin Cup will be eliminated in the first round of the first round! They are indignant, but the bottom line is that they have no idea what they''re getting into when they''ve been using such a mother-in-law approach in the first place. You know what?The weaker the dog, the better it roars. ""What?" Just like you guys are doing right now. ""You...." "Let''s see... The facilitators were confused as to what on earth they should do, but now that they''ve all expressed a willingness to fight, they decided it was better to start the fight as planned. Well, then, let the game begin! Nine people other than me drew their swords at once. And at the same time, they close the gap. ''''Let me tell you one more thing.'''' I dared myself to walk out to the center of the circular stage. ''Fool!'' "You''ve moved yourself into the most unfavorable position! "Hahaha, we won! They are quick to surround me. ''''It''s in group battles like this that the Sword Princess shows her strength the most. Immediately after, they leapt at him from all directions. -- "Sword Dance. ""What?" Hmm. I guess I''m just a C-level swordsman after all. It''s a good idea to have a few of them. "...stupid...? This is the number of times I''ve lost...? That''s a monster... The nine swordsmen whose blessings were totally lost. A shocked grunt escaped from their mouths. It''s about five minutes. I''m sure it''s not too hard for me to keep using the sword dance, but this kind of time is nothing to worry about. It may look elegant and gorgeous on the outside, but it''s not easy for the people who do it. You have to sharpen your awareness in all directions, and do your best to "anticipate" the situation. This is a full-body exercise with intense slow and fast pauses, as if you are continuously executing a contraction. When it comes to the skills of the Swordship Princess, which is considered to be the highest level of skill, the drain on one''s physical strength is intense. Still, thanks to the recent muscle training, I feel somewhat more comfortable than before. It''s probably the limit of one hour. ''''The one who survived was Aleru Swordsman of Dragonfang!The second round is decided!'' The second round of the first round was held the next day. The number of players had been reduced from four hundred to forty in the first round, but it was said that this second round would again be played by more than one person at a time. However, this time, five people would be fighting at the same time and one person would be the winner. ''''Hm?Are they all Blackblade swordsmen again? As my match began, the other four men came at me alone, as if by design. ''Not so!It''s the theory of this qualifier that we have to work together to defeat our biggest enemy in the first place! Apparently, they simply saw me as a powerful enemy and decided to fight with me. I see. But if you''re going to defeat me, at least you''ll need more than ten men to take on me. ""What?" After winning the second round like that, the next round was a one-on-one tournament between the eight remaining players who had won so far. ''''It would be more trouble, so I''d appreciate it if you could do it all at once. I thought, and I suggested to the management. ''Wait, what do you think you''re doing?If you do that, they''ll all come back to fight together again! It would be quicker. ''''These are swordsmen who have come so far to win!Probably, his ability is almost in the B grade swordsman class! That means she''s on the same level as Lilia, right?There''s nothing wrong with that. It''s kind of complicated! And by the way, the management gave me permission to do it. So eight people, including me, went up to the stage at once. ''Lick me........'' "We''re enough of a bunch of C-listers on our own... ''''Fine, they''ll do their best to smash it down...'''' Seven people other than me are looking at me with eyes filled with murderous intent. ........Why are they so angry? 25-Episode 25 Eventually it becomes an open fact You lick it... "We''re enough of a bunch of C-listers on our own... ''''Fine, they''ll do their best to smash it down...'''' Seven people other than me are looking at me with eyes filled with murderous intent. ........Why are they so angry? Hmm?I think it was a mutually beneficial proposition?There''s too much of a difference in competence for it to be any kind of experience. I''d rather spend my time training as an individual than wasting my time on that kind of thing. You little... You''re wasting your time fighting us? Hmm, I think I got angry instead. Why do you think? I see. You won''t gain anything by playing against me, but they would have been competitive in their abilities against each other, and it could have been a reasonably good fight. They are angry that they were deprived of even that opportunity. I''ve been thinking only of myself, haven''t I? All right. Well, I''m going to take it easy on you. That way, it will be a little more productive for you guys. I shouldn''t be complaining about this. Honestly, it''s harder to add or subtract than it is to be serious, but think of it as making up for the last minute change in the original format of the match and getting them involved. ''Tame?'' You''ve got to be kidding me. How long do you think he needs to taunt us, this guy...! ...er... I don''t get it. I have no idea. ........Maybe they''re just stressed out and just want to be angry anyway. I don''t seem to understand even if I think about it, so let''s just call it that. ''''.........Arel-san is the type of person who gets on other people''s nerves in a natural way......'''' ''''It''s also annoying that he doesn''t realize it...'''' Lilia and Laina are muttering something with their half-eyes, and perhaps they too are confused by their opponent''s unreasonable anger. ''''So then, let the match begin! On cue, the seven swordsmen leapt at me one by one. I exquisitely cut my hand and took enough time to take them down. ''''And anyway, congratulations, Mr. Arel!Now that''s a qualifier for the second round! Were there close to a hundred fencers in the second round as well? ''Yes!From there, the tournament will whittle it down to twelve! ...I''d like to have another ten people call me at a time. You know, this is really reckless against a Grade B swordsman! The second round would not begin for another week. ''Then we''ll have to dive into the dungeon. We''ve only made it to the seventh floor, and we''ve finally just started to see a few Highest Level living armors appearing here and there. I want to advance to a lower level and fight the [Highest Position] living armor. ''''Ah!I''ll be there! You don''t need to come. ''You don''t have to be so clear!But I don''t want to!I''ll definitely follow you! ''''No, from my point of view, you have more than enough of a steel mentality as well.......'''' Laina said something. The pairings for the second round were announced. There were twelve contestants who could compete in the main round. So the participants in the second preliminary round would be divided into twelve blocks of about eight people each, where they would compete in a tournament. The winner of each block would be able to participate in the finals. ''''Why are you in the same fourth block as Arel-san! Lilia shouted with her head in front of the combination list posted on the bulletin boards in various parts of the city. ''''........It has been decided that we will miss out on the main competition again this year......'''' ''Don''t be so downhearted. Even if I wasn''t on the same block as you, it would have been hard to qualify for the finals with Lilia''s skills, wouldn''t it? ''Yes, sir!Yes, but I think that''s a terrible way to comfort you! I leave Lilia, who is ranting about something, and I talk to Laina. ''Laina is in the eighth block?'' ''Oh. ........Fortunately, we''re on a different block from the two of them, but there are many strong opponents. Still, last year we made it to the finals of the second round and defeated them, so we''re hoping to win a spot in the main round this year. From a strength standpoint, Laina would have a better chance of winning than Lilia. The second preliminary round has started. A larger venue was used than the first round, and many people who seemed to have come to watch could be seen. There were also many people who were obviously not fencers. Of course, this is the peak of the competition, but around the time of the second round, people start coming from outside the city to watch the matches. Lilia tells me as we head from the waiting room through the players'' only corridor to the fourth block of the game field. There are several match fields in the building, assigned to each block. ''No wonder the city has been so busy lately,'' We reach the game field. There was a stage in the center, and the bleachers around it were already almost filled with spectators. ''Hey!Isn''t that the unemployed guy we hear about? I didn''t know what that kid was like. I mean, seriously, an unemployed person won''t even make it through to the second round! ''''Is it true that you defeated a Blackblade A-level swordsman in a rivalry battle? I know it!I''ve seen it with my own eyes!And it''s one man without ten! You''re getting some kind of attention. Well, it''s not the first time, and I''m used to curious looks like that. ''''Obviously, there''s a lot of audience...'''' Is that so? Yes. Usually it''s about half this many. I guess a lot of people have heard about Arrell-san and come to see him. As she said it, Lilia was hugging my arm. ''''What ... what are you doing?'''' "Hmmm, a lot of people mistakenly thought that if I did this, me and Arel-san would be able to do it, and eventually it would become an open fact, and then it would really be-----baby! Lilia held her stomach and squatted down on the spot. ''''This man punched the maiden in the stomach without a care in the world! It can''t hurt, since you have the blessing anyway. ''''It doesn''t have to be painful, but it will be a shock!That''s not the point in the first place, and please don''t reduce your blessings before the game! A voice could be heard whispering from the audience. ''''Hey, you seem to be getting along quite well with Lilia from The Fine Swordsman. It''s the same guild. ''It looks to me like we''re more than just a guild. ''d*mn, you''re still going out with him. I was a bit curious about you because you''re good looking, regardless of what''s on the inside... I don''t understand why you would come to that conclusion after seeing what you just saw. 26-Episode 26: What is the real intention? The second qualifying round went well. And before I knew it, it was the final. Mr. Arrell, if you win this, you''ll be in the final!Good luck! I knew Lilia would have been eliminated with or without me. I wouldn''t have even made it to the finals anyway! It was the same block, but if they won out, they would have clashed with Lilia in the final. But Lilia lost in the semifinals. My opponent is the swordsman who defeated Lilia. ''''Magic Swordsman, huh? That''s a very unusual profession. I don''t need you to tell me this as an unemployed person. My opponent stared at me with a glare. She''s a woman a little older than me. As a B-class swordsman, she was an [Advanced] [Magical Swordsman] who could learn both sword and magic skills. This is a swordsman''s tournament, but actually you don''t have to be a swordsman-type profession to participate as long as you are registered with the guild. I''m an "unemployed" person, I''ve also been able to participate. And it doesn''t matter if a "sorcerer" uses magic to fight, for example. It is said that the swordsmen do not doubt that the sword is the strongest weapon, and in fact, all of them have been defeated in the past with weapons other than the sword, so they are allowed to use other weapons to fight. So naturally, there is no problem for a "magic swordsman" to use magic. Since he is also a swordsman, the audience''s voice is somewhat calmer than a completely different species. Earlier, the Summoner was summoning demons to fight, "You coward who can''t do anything by yourself! "You can''t even wield a sword, you weakling! And so on. ''''Even so, it''s quite convenient to be able to use a sword at close range and magic at long range. But you''re not giving it much of a chance... To say they''re both halfway through is an understatement. Huh! I''m going to duck both the sword and the magic that the woman throws at me. It''s true that the ability to use both is a big advantage, but with swords, it''s not as good as swordsman-type senior position, and with magic, it''s inferior to sorcerer-type senior position. It could be said to be one or the other. If I could master both, I might be the strongest, though. .........Hmm. By the way, it''s been on my mind for a long time. I''m going to be able to use magic if I work hard? ''''Well I really wanted to save it for the main competition but I can''t help it. "Hmm? My opponent is muttering something significant. ''Don''t worry. You won''t be able to advance to the final round anyway. If you have any hidden skills, you had better show them here and now. If you don''t give it your all and lose, you''ll regret it. ''Make fun of me...! I''m just telling you the truth...? ''I''ll show you!Magic sword! "Law. I couldn''t help but let out an exclamation of admiration. The sword in the woman''s hand burst into flames. I see. The skill to grant magic to the sword? That''s right. It''s the most powerful sword that only a "magician" can use. The woman swung her sword on the spot. Then the flames extended like a whip and attacked her. She quickly jumps back and ducks, but when she returns her wrist, the flaming whip immediately changes its trajectory to follow it. ........So this is how it can be used? I''m sure that if you use this "magic sword," you can fight at close range, mid-range and long range, any range. It''s quite interesting. It''s a good skill to learn. That''s the swordsman''s city! As expected, there is much to learn. ........Will we see even more unusual skills when we go to the main competition?'''' I''m sorry, but you''ll have to go to the finals. I left an afterimage and walked into my opponent''s bosom, and settled the matter with the Swordswoman''s special skill, Piercing Tempest. The woman''s blessing disappears at once. ''''Hm?What did you say? The team made it through the second round and qualified for the finals. Although Lilia was eliminated, Laina, who won the eighth block, also qualified for the final round. ''''I can''t believe two people from our guild will be able to compete in the Sword God Cup finals!How in the world has it been years! How can you be happy that you lost? ''It''s good!He''s a broad vessel who can honestly congratulate his fellow students on their successes! Doubt. What do you really mean? I made a lot of money because I was betting so hard on Mr. Arellu..........No, it''s true that we made a lot of money! All gladiatorial battles held in this city are subject to betting. The qualifying round of the Sword God''s Cup was no exception, and apparently Lilia was betting on me. ''''You didn''t bet on yourself?'''' Yes, yes.... Lilia nodded weakly. But she quickly reopened it. ''Yes, it is!I didn''t think it was going to happen in the first place anyway!What''s wrong with that! In a way, it''s refreshing. The main race is in a week. So we were in the dungeon again. The fourteenth floor. Using a convenient transition magic circle, we were starting again from here, which we had reached before the second round. Rumor has it that around the fifteenth floor, the [Highest Position] living armor will start appearing at a low frequency, but around the fifteenth floor. The only Highest Position I''ve ever met are the Sword Princess and the Twin Swords King. However, the Souken King is Lilia''s father, so I''ve never had him show me his skills. Well, with that skill, even if he was serious about it, he wouldn''t be able to show it to me. The other swordsman types are said to have the "Sword Emperor" and "Exquisite Swordsman". If you''re a knight type, there''s the Hime Knight and King Knight. I''m sure there are other professions that have not been made public. I''m looking forward to it. D-, d-, someone...!It was then that I heard a screaming voice say, "I''m sorry. 27-Episode 27: That line is a bit rude! ? I need help! A young man with a different complexion came running up to us. He was breathing heavily, probably in a great hurry. What''s the matter with you? Hey, buddy!My friends are in trouble!Please!Give me a hand! The young man appeals to me. I''ll tell you the details. I''ll listen to the details as we run. You''ll show me the way. It was Laina who nodded easily. With her strong sense of justice, she would not be able to leave someone in need alone. On the other hand, it was Lilia who showed difficulty in doing so. It''s not a good idea to have a good time. I''m not afraid to lend a hand, but you''ll be rewarded for your efforts later, right? She is quite a fussy woman. The young man looked lost for a moment and then Of course!I''ll give you all the money you want later! ''Then let''s go!Arel-san is good too, right? Yeah. All dungeon exploration is at your own risk. So I don''t really care what happens to them. ''''Because maybe there''s a [senior-most position] living armor. If they have come to this level, then this young man and his companions must be of a certain level of ability. If that''s why they''re in trouble, they probably have a strong enemy. If that''s the case, it''s worth going to help. ''''........I think Arel-san is the same kind of person as me, right? That''s rude. I don''t want to be the only one with Lilia. That line is much more rude than that! Anyway, the young man leads us to the site and we hurry. "Over here!My friends in this room........! We ran into that room the young man said we''d be in. But. ...hmm? Nothing? What do you mean? The scene of fierce fighting as I had expected wasn''t there, just a small room with nothing in it. ''''Hahaha!Fool!You took it! I turn to see a young man smiling mockingly at me from outside the entrance. Immediately after, his feet began to glow. There was a magic circle there. ''''Well, I don''t think this is.......a transition trap! Wha...? Lilia and Laina are gasping for air. Hmm. It seems that we''ve been deceived by that young man. The next moment, we were swallowed by the light that poured out of the magic circle. And after the uncomfortable floating sensation, we found ourselves transported to a completely different space than before. ''''Transition traps........you mean traps that force you to be sent to another place?'''' I mutter to myself as I look around. It''s a fairly large space. Perhaps because of the splendidly decorated walls and pillars, it gives the impression of being inside a majestic temple. ''''........Huh?Nah, why me too! We heard a man''s voice behind us. I turned around and saw the young man who had trapped us for some reason. ''Shit!You don''t think you''re going to get caught outside the entrance!It''s not a joke... Halfway through, the dialogue turned into a scream as Lilia punched him mercilessly in the face. She went from her usual state of catnip to revealing her true nature. What the hell?What do you mean, huh?Who ordered you to do this?Speak up. Or I''ll kill you. Hi! The young man was scared by the change in his leopardopardism, but he revealed it easily. ''''Bu, the head of the Black Blade guild asked me to do it!I belong to another guild, but they gave me a lot of money.Maybe they didn''t want you guys to be in the main competition for the Sword God''s Cup!So I trapped him in a dungeon and tried to take care of him! Okay. BUGH! Lilia punched the young man in the face one more time, then ''Well, I thought it would be something like that but it''s a piece of crap nonetheless. So that''s the best swordsman in the city. ''It''s true. He would do any dirty thing to maintain his position. For such a person to be at the top, the Sword City has fallen a long way.'''' ''''It''s not very convincing coming from Lilia, who''s outmatched by that opponent in terms of strength. ''You have a really good personality, Arel! I don''t want Lilia to be the only one to say that. ''It doesn''t matter, right now we''ll just have to get out of here fast. Where the hell did you get sent to? "Oh, I don''t know!The only thing is, if you fall into that trap, there''s no way you''ll ever get home Yeah, well I shouldn''t have taken the chance after what I''ve done. ... When questioned by Laina, the young man turned pale and responded. And that was when it happened. A magic circle appeared at the back of the room, much like the trap we just saw. A pillar of light rose up and shimmered around the area, and just when you thought it was illuminating, a figure appeared there. ''''Ho. That''s a living armor of a color I''ve never seen before.'''' The living armor that appears in this dungeon seems to have different colors of armor depending on their profession. I''ve encountered red-copper, blue, dark green, gray, and light red, but the "golden color" in front of me was the first time. Somehow, I felt it was quite promising. When I was thinking about this, Lilia looked astonished. ''''........oh, golden armor.......oh, you''re lying......'''' Do you know? With a wawa-na voice trembling, Lilia told him the identity of that Living Armor. ''''Superclass PositionSword GodLiving Armor.......'''' 28-Episode 28: My Life, Owata ''''The Living Armor of the [Superclass] [Sword God]....... Lilia uttered that in a trembling voice. ''''Wow, I''ve heard that too........ The golden living armor is that illusory Superclass Job Sword God.......! It was Laina who nodded as her eyes widened. ''''Jeez, you''re not kidding, whoa!Why........why do I have to do this? The young man who trapped us screams. That''s what you say. ''Well, but thanks to you, I''ve encountered more than I expected. I didn''t expect to go beyond the [Highest Level Job] and suddenly see a [Super Grade Job]. Although it''s not expected in terms of encountering skills I haven''t seen yet, it will be good practical training. Lately, we haven''t been able to fight against opponents who are on par with my mother, so I feel that my instincts for actual combat have been a bit dulled. "Wait, Are you going to fight, Arel-san? "?Of course I''m going to do that. "Mm, this is reckless!No matter how many times Mr. Arell.After all, the other party is a [super-grade job]! ''No, you feel like you can''t get out unless you take that guy down in the first place, right? I took a quick look around the room a while ago, and I didn''t see any doorways anywhere. It''s probably the type of room from which you can escape only by defeating the enemies that appear. ''''Nah.........'''' Finally realizing this, Lilia turned pale. The young man also exclaimed. ''''You mean, this is the boss'' room!Why does the end of the trap lead to the boss, whoa whoa whoa! Come to think of it, I''ve heard something like that about dungeons. That there is a strong enemy in the dungeon that has a strength that sets it apart from other demons and is called a boss monster. ''''Oh wow.......my life, wow.......I would have eaten a lot more delicious food if this was going to happen!I wanted to have a hot boyfriend and make out with him too!Whoa! Lilia, too, calls out in despair. ''They''re so annoying. ........Mm. They''re coming. The golden full-body armor drew its sword with unstoppable speed and slashed through space in a horizontal cleave. It hadn''t moved an inch from where it appeared and was nearly twenty meters away from us. No matter how I think about it, the sword can''t reach us. ''''Huh?Could it be Stupid Armor? You''re an idiot, get down! Huh? Huh! What? The three of them reacted to my words and quickly crouched down as quickly as possible. Immediately afterwards, something passed over my head at high speed. ''What in the world...?My hair! Looking at the screaming young man, only the hair on the top of his head had been neatly trimmed off. By the way, the hair is not judged injured, so the blessing does not decrease or recover. ''''I, what was that?'''' It''s the "swordsmith''s" skill. It''s a skill that sends the impact created by a slash flying. Look at that. Huh? There were sharp scars carved on the wall behind him, as if he had been directly hit by a sword. ''''That kind of power, it looks like it could attack at least fifty meters away. What a load of horseshit...! Mu, we''re moving. Boom! I received a slash from the golden armor. ''''When did you get here!Don''t tell me you''re a shrink? No. It''s a contractionary skill, the divine footpath. As he flicked his sword, in the next moment, the golden armor was already about a hundred meters away from him. For the "Sword God" who can use the "Divine Footpath", that was still a sword interval. So, frankly speaking, there was no need for the Flying Blade. The golden armor is slashing at me again. Gaga Gaga Gaga Gaga Gaga Gaga Gaga! After clashing swords with swords, he takes his distance again. ........I see. It''s true that this guy is a "Sword God". The level of his body language, sword speed, reading speed, and everything else is different from the Sword Skill, Advanced skill. ''''Wait, wait a minute!Hey, why are you cutting each other normally, Arel-san! ? ''No, no, don''t look at me like I''m saying anything!The Sword God is a master of the sword skill!It''s because he should have a ''Sword Technique, Super Grade'' skill that even the most advanced swordsman can''t learn! It is said that there are three swordsmanship skills: Swordsmanship, Beginner, Swordsmanship, Intermediate, and Swordsmanship, Advanced. The basic jobs, such as the Swordsman and Knight, can only be mastered through the Intermediate Swordsmanship. Once you reach the senior level, you can master the Swordsmanship and Advanced. However, the illusory "super-ranked" swordsmanship, the illusory "super-ranked" swordsmanship was also said to be able to learn the illusory "swordsmanship, super-grade". It was said, or rather, it''s true. In the first place, the [Super Grade Position] was not an illusion or anything. It definitely existed. Even the golden living armor in front of me is clearly a [Sword God]. My mother is the god of swords. "...what? Lilia and Laina''s voices overlapped. ''''What do you mean by that...?'''' "Your mother is the Sword God...?But it was supposed to be the Sword Princess! Hmm? Speaking of which, haven''t I mentioned it? "My mother''s current occupation is not the Sword Princess. She''s a Sword God. I heard that she changed her occupation from the [Highest Rank] to a [Very High Rank]. Yeah, I''ve never heard of that, either! It''s not that my parents don''t know about this, but they think it''s the "Sword God" that they left this city right after becoming the "Sword God". Even my parents are not hiding it, but since I don''t dare to tell them, they all seem to think it''s the Sword Princess. Mom was a person who wanted to live quietly with her family and she didn''t want people to know too much about her. ''''Of course, I stole all the skills of the Sword God from your mother. 29-Episode 29: I have already mastered it What do you mean by that?The Sword Princess Phara is actually the Sword God!And how can you use that skill, Arel-san, to use it...? What it means is what it means. It wasn''t just the Sword Princess skill that I spent five years learning, but also the Sword God skill. I also mastered the Sword God skill at the same time. Or rather, I can say that the latter took up most of my time. The Sword Princess skill had become a thing in a little over a year, while the Sword God skill had taken him nearly four more years to master. At that moment, the pressure he could feel from the golden living armor suddenly increased. That alone seemed to put pressure on him, and the young man and the others slumped in place as if he had lost his back. ''''It looks like you''re going to get serious. The Sword God''s skill - divine possession. It is an unstandard technique that temporarily increases its own physical abilities by several times. Although the Sword God is unrivaled in every ability, including muscle strength, agility and dexterity, this boost further strengthens it, making it look as if a god had descended. ''''But I''ve already mastered that. I also responded by being possessed by a god. Those who had plunged into the realm of the gods collided with each other, and the impact alone caused a tremendous storm to erupt. Zugagaagaagaagaagaagaagaagaagaaga! The sound of a roaring sword fight is like an earth-shaking sound. ''''Wait, what is this?This is not a human battle!It''s almost a natural disaster! This is divine possession...? ''''I mean, aside from that one, the unemployed Aleru-san can even use the Sword God skill, so anything is possible already! Lilia and Laina are shouting at each other, almost blown away by the wind. ''''It''s not like anything is going to happen. The skills of the "Sword God" are even more demanding on the body than those of the "Sword Princess". This "divine possession" is especially so. In any case, they are forcing you to draw out a power that should have been unconsciously suppressed considering the burden on your body. Just by maintaining this state, the blessings are decreasing. But thanks to the muscle training or the training of "sturdiness", it''s much better than before. But of course, there''s no such thing as fatigue in front of me. Living armor is armor without substance. Therefore, it doesn''t cause muscle fatigue or loss of strength like humans do. As long as the exoskeleton-like armor is not destroyed, it will probably be able to continue to use the Divine Possession forever. In short, we need to get this over with as soon as possible, but-- Perhaps disliking the stalemate, the Living Armor moved first. Is this........the Sword God''s special skill Infinite Break? A series of blows that would continue semi-permanently until the opponent died. Moreover, each and every one of those blows are so perfectly coordinated that when you take the first one, you''re no longer allowed to escape or even fall down. ''''But that''s a bad move.'''' I''d rather not have the stalemate continue for me. If there was no lack of physical strength, they should have continued to cut each other evenly. When I learned that I could learn the skills of a swordsman even though I was "unemployed", I volunteered to become an apprentice to my mother. However, it''s extremely difficult to teach a person who doesn''t have the skills to learn swordsmanship. To begin with, she''s not smart enough to teach people anything. So basically, I learned the skills that she showed me by simply watching her, but of course it''s impossible to replicate the skills by simply watching. Hence, I thoroughly analyzed those skills. He understood every aspect of it perfectly: stance, breathing, eye movement, sword trajectory, etc. Infinite Break was no exception. Hence, this technique was not effective against me. I''ve figured out the moment the technique comes out, and I instantly crush it. With the first strike, the balance is exquisitely disrupted and the activation of the skill is cancelled. ''''Huh?'''' The mindless golden living armor looked astonished. ''Payback.'' The living armor is slightly stiffened as the special skill is prevented. I don''t miss that momentary opening. It''s only natural that he''s been aiming for the moment when he can reliably hit his special skill from here. I let loose with an Infinite Break. With a loud crash, the full body armor slammed to the ground. You can''t call it full-body armor any longer. The two arms were torn off and rolled over a long time ago, and the legs were bent in a different direction. The helmet is slumped over and is a shadow of its former self, and the body is barely connected around the waist, which could easily be split into two parts if you pulled on it. The golden armor had now turned into a mass of junk. ''''........I''m indeed tired. Convenience, fifty-eight. That''s the number of slashes I fired before I destroyed the golden armor to this point. I feel like the forty-second strike or so was already enough, but I had to be careful and destroy them firmly. These guys are powered by magic, so even if their arms are slashed off or their helmets are destroyed, they can normally continue fighting. I poked it with my sword with a thump, but it seems to have completely stopped functioning. ''''Was I saved...? The young man who set us up muttered in disgust. ''If only this guy was the only enemy coming out. ''No, no, no, don''t be scared! 30-Episode 30: What are you trying to let go of your deadly skills with a sense of Tsukkomi? As long as he''s the only one who comes out. ''No, no, no, don''t be scared!That kind of thing can get flagged and really happen! It was at that moment when Lilia''s voice sounded. At the place where the golden living armor had appeared earlier, another magic circle appeared. ''''See!I don''t have to tell you! ...no, nothing''s showing up? As Laina said, it was just a magic circle that came out. I walked closer to that magic circle. ''''Hm. Can''t we use this to get back to earth? Even though they had defeated the boss, nothing else had changed in this room. There is no door to get out, either. ''''Ho, is it really okay...?'''' If you don''t like it, I''ll leave you. I''m sorry about that! Oh, me too! The three of them rushed over to me in a hurry. We all walked into the magic circle at once. We were swallowed by the light, and then we found ourselves in a familiar place. ''''The first floor of the dungeon?'''' ...is he back? The three of them slumped down, "Thank God! Then we left the dungeon and returned to the base for a while. For now, I''m taking the young man who led us into the trap with me as an important witness. By the way, only the top of his head is still bald. From now on, I''ll call him "Top Top Baldness". "Top Top Baldness". I have a fine name, Deal! I yelled at him and then, for some reason, I was in awe of the "yea I do, sir! ...doctor? You saved my life, you saved my life!Please let me call you Sensei! The top balding man suddenly lowers his hips and says something like that. ''But I refuse.'' What? I''m probably younger than you. Age doesn''t matter!In this city, the best swords are the ones who are strongest!In that sense, you are the greatest man in the city!It''s just a blessing to be an apprentice to someone like that!No, the misfortune of earlier is lightly erased! That''s why I didn''t say I''d take him as an apprentice. ''''By the way, what grade are you at, Mr. Deal?'''' "I''m still a Grade B swordsman!He''s a senior level gladiator, and he''s one of the best swordsmen in his guild, the Wars!I know it''s a small guild! Let''s make an apprentice! Really? In exchange, you must join Dragonfang! Of course I''m coming in! Hey, wait. Then go file a notice of withdrawal with your former guild right now! Yes, sir! The top bald man saluted and ran at full speed. ''''Lilia, don''t proceed on your own. ''We have one more member now!And if two of them compete in the Kenshin Cup, there''s sure to be someone who wants to join!Oh!But first, we need to make a big deal out of this boss monster defeat! It''s not like Lilina''s listening to me. "Infinite-- ''Stoop!Why are you trying to unleash your special skills as a joke?And that''s from the Sword God!You''ll die! When I returned to my home base, I heard some arguing voices. ''What do you mean, my daughter won''t come back from the dungeon again?What the hell did you do? ''No, no, I swear I didn''t do anything, okay?But our group members just happened to be watching. The part where they fall into the transference trap. Yeah, it was just a coincidence, hey. Moreover, it''s the worst trap of all, because once they transfer, the last thing they do is come back. In fact, our guild''s A-level swordsmen have tried it a few times in the past, but no one has come back. Maybe there''s a boss monster waiting for them. It was Lilia''s father, the old man who was the former head of the guild, and the head of the Black Blade guild, GEO... GEO... GEO... something. ''''Screw it!What if something happened to Lilia - Lilia? The old man notices us coming back and rolls his eyes. Geo something turned around and looked back at us, and his eyes widened. ''''Wha... why are you here...?I''m pretty sure it was a trap that sent you flying...? Perhaps someone had seen the moment we were trapped and reported it to this guy. ''Yes, he did!Thanks to you, I almost died, but I came back after successfully defeating the boss monster! Stupid!Wasn''t that golden living armor over there........! ''''It was definitely golden and was the living armor of the Sword God, though! ''What, you mean...?If that''s the case, then we shouldn''t be able to take it down... That''s what I thought, too!Oh, and I would have loved for you to see it!I just saw Arrell-san overwhelm the living armor of the Sword God! You overpowered the God of Swords? Geo something turns its gaze towards me while being shocked. Well, however, it was certain that I could use the Sword God skill, but to be honest, it would be enough to say that that was a degraded version. Or rather, not just that one, but the living armor itself. They lack the cunning, judgment, or battle instincts that a skilled human swordsman possesses, or something like that. That''s why it was easy to spot the moment when they unleashed the Infinite Break, a special skill. And the man who trapped us is safe, and he has made a full confession!He was paid a lot of money by you to make the order!The attempted murder of the Blackblade guild leader!That would be great news!Perhaps it will be difficult for you to participate in the main competition for the Kenjin Cup! Lilia says as she folds over. Before she could catch her breath further. ''Yeah, but!I''d love to see him get defeated unceremoniously in front of a large crowd against Mr. Arrell!You can''t do that if you don''t participate!Oh, yes!If that''s the case, then let''s make sure you''re in the main race, and we''ll make this matter public afterwards! She is still a woman of bad character. Blackblade Guild Headquarters. "d*mn brats.... After returning to his own castle, Georg spat that out as he entered his office. However, his complexion was beyond pale and he looked like a dead man. ''''At this rate.......I........'''' He bites down on his back teeth to the point that he can barely hear them and grunts. If I leave them alone, the status and reputation I''ve built up so far will be lost. ''''Well no, that must be some kind of mistake. That''s true. There was no way that an ''''unemployed'''' could defeat the ''''Sword God'''' living armor. And as long as he won the Sword God Cup again, even if this matter was brought to light, he could somehow rub it out. He tried to tell himself that, but his instincts as a swordsman were not convinced. He must not fight that boy, or so he pleaded. And then the door to the room set up at the back of the office passed through his vision. Georg turned his foot to it. When he opened the door, he found countless swords lined up in a row. It was a collection of swords collected from all over the world. There were demonic and demon swords among them. If we''re going to lose our fame anyway, we can at least be the top swordsman....... Georg muttered to himself. What caught my eye then was a box with a coffin-like exterior. When I opened the lid of the box, as if drawn by something, I found a sword inside. "Use me. It was as if the sword was speaking to him, and Georg took it in his hand. 31-Episode 31: Wouldnt it be wasteful if it ended early? It was the day of the Kenshin Cup Final. There was a father and daughter arguing at the entrance and exit of the arena where the competition was to take place. ''''d*mn it, let go!You stupid girl! No, I won''t let go!There''s a seat available exclusively for the contestants'' guild, so it''s a loss if you don''t see it! It was Lilia and her father. I ain''t gonna watch it! ''You''ve come this far, you need to give it up, for goodness sake! Shut up!I don''t see the point in watching the game anymore! ''Then let''s just watch and enjoy the game!I don''t mind if you have a drink! It''s more painful than it is fun, and it''s nothing but pain for me! ''Oh my god, this is so f*cking annoying...'' --Ptch. Right after such a sound came from Lilia''s forehead. Gosh! Her full length straight right caught her father''s face perfectly. ''........Kyu.... Well. Let''s go. She dragged her father, who had fainted, into the hall. The day of the main competition for the Sword God''s Cup has arrived. The biggest arena in the city of swords. It could hold more than fifty thousand people, and the thirty-two contestants were to compete for the title of the "Greatest Swordsman". Twenty of the contestants were A-class swordsmen, and the rest were swordsmen who had made it through the preliminary rounds. The first match was to be held. As soon as the opponents, who had been kept under wraps until then, were announced, the hall was filled with a great commotion. ''''Last year''s champion, Georg the Sword Emperor, suddenly appeared in the first match! I don''t know who you''re playing against, but it''s not like you''re in a real relationship with your opponent. Arel of the Unemployed!You''re a D-class swordsman who won all of the qualifying rounds in convincing fashion! What a nice card! ''''No, there''s no way an unemployed person would beat the Sword Emperor, right?Isn''t it going to be one-sided? Yeah. I think this is the end of his breakthrough. Well, he''s still going to the finals. I think he''s doing well. Hmm. I heard it was the first match, but I didn''t know it was against that guy. I hadn''t been told who I was going up against either. I go on stage. The auditorium was packed. It was the first time I''d ever received so much attention from so many people. His opponent also came on stage. It was GEO something. His usual fearless or annoying smile disappeared from his face, and his lips were drawn tightly together. Apart from the sword at his waist, for some reason he was carrying another sword on his back. Could it be a spare sword? You seem pretty tense, don''t you? .... I called out to him, but he just responded with silence. ''''Then I''d like to start the first game!Will last year''s champion, Georg, the Sword Emperor, make a strong start to his bid for back-to-back victories?Or is the biggest dark horse in this tournament, the unemployed rookie swordsman Arel, going to show us another astonishingly strong performance! The audience erupted into even louder cheers at the incitement. Oh, right, it was Georg. I remembered. ''Let the match begin!'' At that moment when the signal to start sounded, Georg stepped over the distance that was dozens of meters away in almost a single step, and he was fleshed out at once. Hmm. Don''t let him out of the blue. A special killing skill. ''Oops!Georg the Swordsman!They thought they were going to be the first to win, and then all of a sudden it was a big move!The Sword Emperor''s special skill Emperor Lord!He''s a tough competitor, as I thought.That''s too easy!The Emperor''s sixteenth series of blows that will bring everything to a standstill are attacking the Aleru Swordsman.'''' Gaga Gaga Gaga Gaga Gaga Gaga Gaga Gaga! ''''What a swordsman, Aleru swordsman, you blocked it perfectly! I see. As expected of the Sword Emperor''s special skill. I wasn''t able to completely block it, and I ended up snatching a few of them. However, my blessings were only reduced by about one percent. ''''Ah!Georg Swordsman, without further pause, unleashed another special skill!But Aleru Swordsman, I took that without difficulty, too.'''' Awesome? Seriously, what''s going on? That''s not a jobless person! But you''ve been fighting amongst yourselves. With the Sword Emperor attacking us like that, it would be impossible for us to mount an offensive. As expected, the Sword Emperor won. ''Swordsman Arelle, it sure seems like the best you can do is take it from earlier!In the face of [Sword Emperor] Georg''s ceaseless attacks, he can only defend himself and cannot turn to the offensive at all!Little by little, the blessings are diminishing!If we don''t do this, we''ll be jittery for sure!'''' At that time, Georg, who had been attacking uninterruptedly from earlier, jumped back once he thought what he was doing and took his distance. ''''Ahhhh!Georg the Swordsman, he has dropped once!This is a great opportunity for Arrell Swordsman but he won''t move!'''' Georg is the first to open his mouth there. ''''Well why don''t you just take it and set it up?'''' Though his tone is quiet, there''s an unconcealed resentment in his voice. ''Maybe you can''t afford to go on the offensive. ''Don''t lump me in with those fools!How can you not know you''re daring to be on the receiving end? I was just joking around a bit, but apparently he took it seriously. ''Hmm. Simply put, it''s too good to be true. ...too good to be true? I say to Georg, who raises his eyebrows. ''''This is the perfect opportunity to see and learn the skills of the Sword Emperor in person. Wouldn''t it be a shame to end it too soon? 32-Episode 32: Do Your Best to Die Hey, Lilia.........what the hell does that mean.......? Lilia''s father, Rod, groaned in dismay as he watched the match. Forced by his daughter, he had no choice but to watch the first round of the Sword God''s Cup main competition. It was Lilia''s doing, as her body was tied up with a rope around her body. As expected of a former number one swordsman. While the rest of the crowd was watching Arel''s defense, he clearly realized the trend of the match. ''''Lilia, who the hell is that guy!He had that kind of confidence against the Sword Emperor, the most senior player!And most of all, watching you fight, it''s like you don''t even know your profession.......!What the hell is his profession? Usually, depending on the occupation, there are distinct quirks in the way one fights. Hence, a discerning swordsman could guess the occupation just by observing the fight. Rod was no exception. However, the boy who was blocking all of the "Sword Emperor''s" attacks on stage didn''t seem to be able to make sense of it. I''m sure you''ll be able to see the brilliance and swiftness of the "Fine Swordsman", but he also has the strength and durability of the "Rigid Swordsman". It''s as if there are several professions living together in the same room. It was impossible to do so. If you master that profession, you may be able to move to a higher level profession, but that is only if you inherit the nature of the previous job and reach a higher dimension. Hence, it is unthinkable to have multiple swords made up of completely different characteristics like that. Rod, unable to stay still, asks the girl sitting next to him. He couldn''t believe his ears at the reply that came back. ''What?You didn''t know that?I''m unemployed, Mr. Arrell. Wha...? Silly, that can''t be true. A girl with a bad character is making fun of herself. That was the first thought that popped into my head, but then I said... --or is it that the biggest dark horse of this tournament, the "unemployed" rookie swordsman Arel, is going to show us another astonishing strength! I had been severely irritated because of my daughter, so I had listened to her suitably, but I remembered that I might have introduced her like that for sure. ''''But there''s no way an ''unemployed'' could use a sword like that...'''' Lilia nodded to Rod, whose lips still shivered in disbelief. ''Everyone thought so. Without the benefit of the skill, one would not be able to become a swordsman. Even if you train in the sword, you will never be able to achieve the skillfulness of theSword Techniques. Yes, that''s common sense. That''s common sense. Everyone living in this world believes that, and that''s why people despair if they aren''t given the occupation they want by the blessing of the goddess, and they cry and thank her if they are given it. As you can see, despite the fact that there is no grace from the Goddess, she mastered the "skill" on her own. How in the world did he come to be able to use his skills without a job? Rod asks, feeling a feeling that had long since been forgotten rise from deep within his chest. ''Arel-san says it''s very easy...'' Lilia made a somewhat dumbfounded face and said. ''''--I''ll try my best to die, I hear. ''Ha, ha, ha!Hahahahahahaha! What? Georg just burst out laughing. Could it be that he''s crazy? I''ve been thinking about how unlucky I am. I took the trouble to kick that man off the cliff and take the top spot. I never thought that an insane monster like you would appear... I''m not sure what the point of laughter is, even if it''s explained that way. ''I''m not going to win with me, no matter how I try. I realized that very clearly. ''You''re not going to abstain, are you?You can do it, but at least you have to show me all your skills before you can do it. You''re an infuriating brat to no end..... I''m not giving up on the game yet. Even if I lose my fame, I will defend my position. As he said it, Georg put his hand on the hilt of the sword he was carrying on his back. ''Oops!Georg the Swordsman, he seems to be using a different sword than usual!Could it be a sword with special effects!Although the use of the Sword Emperor is not banned in the match, the entire hall is abuzz with the idea of the Sword Emperor! In the world, there are armaments with various special effects. However, here in the City of Swords, their existence is abhorred. This is because there is a tendency to not appreciate relying on the performance of the sword. It was fine for non-swordsmen to use them and challenge the swordsmen of this city in battles that relied on their armor. But when the swordsmen of this city use such weapons, they are met with a great deal of criticism. ........If you ask me, what is the point of relying on the blessings of the goddess to begin with? Georg draws his sword from its sheath. At that moment, a strange atmosphere erupts. ''''Listen and be surprised. I''m sure you''ll be able to find a way to make the most out of your time with the most powerful sword used by Alexander, one of the legendary heroes who once defeated the demon king. The memory of the sword still resides in the blade, and it gives the power of the sword god to the person who holds it in their hands. Even though it''s quite dangerous for that, though. It''s like a magic sword. "Of course, the wielder must have the right skill to use it. If it''s me, the Sword Emperor, then naturally. Georg suddenly screamed and began to suffer. ''''Hey, what the hell is this?Gah!Ouch!Ahhhhhh! With a scream, Georg''s body transforms. His skin turns gray and a single sharp horn sprouts from his forehead. Hmm. It looks like it was some kind of magic sword after all. 33-Episode 33: The game is still in the first place As Georg drew his sword, he suddenly began to suffer, and his figure transformed into something inhuman. Sharp horns extending from his forehead. Gray skin. His slender body swelled up one or two sizes and turned into a muscular giant. ".........demon, huh? They are similar to demons such as goblins and ogres, but they are more human-like, as they are more intelligent and can use language. They are sometimes called demons. The demon''s eyes were shining brightly and its fanged mouth was exuding an emotion of pleasure. ''''Kukuk........kuhahahahahahaha! He burst into a loud laugh, as if he couldn''t stand it anymore. How long has it been since I''ve been back? It''s not easy to find someone who is worthy of being my body. He spoke the language of people, albeit in a cryptic way. It looks like we can communicate in one way or another. "Let me ask you two questions. First question. Who are you?Second. Why did that man turn into a demon when he drew his sword? When I asked the question, the demon turned to me, cooing and choking. In its hand, it held the sword Georg had drawn. ''''When you look at me, you''re unconcerned, ha. It''s a very peaceful time. The demon muttered to himself in a funny way. My name is Durgelda. As you can see, I''m a demon. As a leader of the Demon Lord''s army, I killed many people. Just hearing the name ''Demon God'', Durgelda, was enough to make the humans tremble. Hmm. So you''re the Demon King''s Army. Hundreds of years ago from now. There was a time of darkness when the human world was threatened by the Demon King, who was said to have been summoned to this world by an evil god, and his subordinates, the demon race. While many people were being killed and many cities and countries were being destroyed, the goddess summoned seven heroes to fight against the demon king. They joined forces and succeeded in defeating the Demon King after a fierce battle. Peace was once again restored to the earth. Even children know this story. However, the content of the lore differs slightly from region to region. "Kukku, that''s right. Several hundred years have already passed since then. That means that those who were alive at that time are buried in their graves. Human life is short. At the words of the demon calling himself Deulgelda, the hall, which had been bewildered by Georg''s transformation, was filled with more murmurs. ''''Oh, hey, didn''t he just call that guy a "demon god"?Isn''t that the leader of the Demon King''s army that was defeated by that "Sword God", right? "You led a few hundred demons to destroy a great nation at the time...? "Don''t be stupid...!The demon that was supposed to be killed by the [Sword God] couldn''t possibly be here...? Hearing his voice, the demon sneered, kukuku. It''s true that he killed me. But in that moment, it was possessed by the sword that used its own blood to cut me down. You could call it a curse. I''m not going to be able to break the curse, because of my intense resentment, he realized that it was impossible to break the curse, so he sheathed it and sealed it up. But now that Georg had pulled it out, this guy had been resurrected, he said. ''Why did he have such a sword?'' A demon sword, or should I say, a cursed sword. It seems that it was true that one of the legendary heroes used it, but in any case, it turned out to be very different from what Georg had hoped for. What did he think at that moment, the demon suddenly slammed his fist into the ground at his feet. A tremendous roar rang out, and the hard stage built with special construction materials easily shattered. A crater-like depression was created there, and dust rose to the surface. ''Maybe it''s because I''m asleep and awake, but I don''t have the strength to do it as well as I''d like. The demon who manifested the overwhelming power of destruction nodded his head as if he was still unconvinced. On the other hand, the spectators who were shown that. Uh-oh! Run! Demigod!The Demon God has returned! I panicked. There were screams everywhere, trying to get away from them. On the other hand, there were those who bravely approached the destroyed stage. These were the contestants for the finals. ''''I don''t know if it''s the ''Demon God'' or what, but we won''t let them interfere with the Sword God Cup! ''''It''s a stroke of luck that I''m back in the midst of a gathering of top swordsmen! They drew their swords and leapt at the demon gods all at once. ''''Yes, that''s right!There are a lot of Class A swordsmen here today! Even if they''re demigods, they can still be... Some of the depression-stricken spectators stopped in their tracks with a look of anticipation on their faces. But the next moment, their hopes would be easily dashed. ''Tepid na.'' ""What?!" The demon cleaved his right arm to the side. With that, the A-class swordsmen were blown together and slammed into the wall that separated the field from the spectator area. ''''Ohhhhhh!'''' The audience is knocked down into further depression. ''Kukuk, good voice. The screams of fear and despair are still very pleasant to hear. Nevertheless, the swordsmen of this era seem to be more small fry than I thought. The demon laughs lewdly. ''''Silly........so easily........'''' This is the demon god. The swordsmen of the same rank were easily beaten, and the main contestants who were trying to chase after them stopped in their tracks, horrified. Some of them spared their lives and ran away. ''''Ah, Arel!Now get out of here, you too! It was Laina who shouted that to me. ''''What?Why should I run? You''re not going to fight me? Of course. We''re still in the game to begin with. The other swordsmen broke in on their own, but that was completely against the rules. ''''But this is no longer the case, is it?This is a legendary demon race!This is not the kind of opponent I would challenge in human flesh! "...hmmm?But you were defeated by the human God of Swords, right?If that''s the case, you''re a good enough opponent to beat. ......... The demon snorted at my words. You''re a proud child who doesn''t know your place. You should have just run away quietly. But in any case, I''m going to kill every last one of them. That evil god of swords is already dead. It''s a good thing that no one is getting in the way of my plans to kill them at will. Hmm. Two corrections are in order. ...? Firstly, there is the Sword God in today''s world. Two, you don''t have to be the God of Swords to defeat him. What?.........? I used my divine footwork to close the distance and cut a swath across the demon. Infinite Break! Gasp! 34-Episode 34: Im just an unemployed person The demon screams in disbelief as he is hit by my slash. Apparently, he realized that this is the Sword God''s special killing skill. I haven''t been defeated by the Sword God in the past, have I? Once activated, Infinite Break will continue to deliver a series of attacks until the opponent is defeated. Moreover, since the time lag between slashes has been cut to the limit, it does not allow for counterattacks. ''''No, it''s not. I''m just an ''unemployed''. Unemployed?I''m going to...There is no way that this technique can be used on an unemployed person.... Even so, as expected of a high-level demon race. Although they don''t have the blessing of a goddess like humans do, their bodies are just as strong as the living armor of the "Sword God" or even stronger. You can''t tell me that he can still talk even though he''s already suffered more than forty slashes on his body. He finally silenced it. Just the seventy-second slash to end the streak. The demon''s body, which had been floating in the air from the sword pressure, crumpled and fell onto the half destroyed stage. ''''So this time you died without leaving a curse. Although my sword is a karma thing, it''s indeed not even comparable to the sword that the Sword God would have used. After unleashing so many slashes, it''s already falling apart, and even if the sword possesses you like it did last time, your life expectancy will soon come to an end. But even if the "demon god" is good, I might have killed that guy too. Well, but he had it coming, so it can''t be helped. !" ""Ohhhhhhhhhhhhhhhhhh!" Suddenly, a loud voice sounded as if the earth had collapsed. ''''Wow!She''s bringing down the Demon God! And all by myself! What a guy! Heroes!He was the hero! The return of the "Sword God"! Apparently, the people who hadn''t escaped yet and stayed in the hall were watching me fight. They were shouting in their mouths in excitement. ''''Hmm. At any rate, I guess we can resume the Sword God''s Cup now.'''' --Dragonfang''s headquarters. Hey, that''s not spirited enough!Don''t just rely on your skills, put more heart into your selfishness! Yes! Sword fights and angry voices flashed through the training room. The one who was still strictly instructing the young swordsmen was a middle-aged man with a ship arm. He was the current guild leader of Dragon Fang, Rod. After that Sword God''s Cup, he returned as the guild leader. His previous lethargic attitude seemed to be a lie, and now, more than in the past, he was single-mindedly striving for the path of the sword, as if his one-armedness was nothing more than a lie. New members had joined Dragonfang. Longing to fight in the Kenjin Cup, more and more applicants came to join. Among them were many of the top A- and B-grade swordsmen. Of course, what they longed for was none other than the Kenjin Cup. That first round of the Sword God Cup. He was that ''unemployed'' boy who had single-handedly defeated the legendary ''Demon God'' that had suddenly appeared and saved the city. "And yet... The woman who had finally reestablished the guild of her dreams and was looking at the crowded training room with a smile - Lilia - suddenly shouted loudly. ''''Why are you, the most important one, gone, Arel-san?! You said you''d marry me!And since the person in question wasn''t there, it was Lilia who also called out whatever she wanted by the way. Sir, are you sure you want to do this? As we were being rocked by the carriage, Gohsa''s father looked back at us over his shoulder and asked, "What''s going on? As the city wall surrounding the sword city was gradually fading away, the old man, who was always there for us, said, "The top swordsman who won the Sword God''s Cup has left the city. ''''It''s unheard of for a top swordsman who won the Sword God''s Cup to leave the city?And tourists are coming in droves from all over to see the hero who saved the city. Hmm. That''s what I thought. No more unfinished business in that place. I respond. It''s been about three months since I defeated the resurrected demon race and won the Sword God Cup. In that time, I''ve mastered every skill related to swords. There is no longer anything to learn here. ''''And there''s no swordsman stronger than me. ''''Haha, that''s true. After all, you have defeated the legendary demon tribe that even the Sword God at that time had a hard time with. You can''t find a better swordsman than our guest anywhere in the world. But that''s not always the case. ? Even before I came to this city, I had mastered the Sword God skill. Probably, at that point, I was already stronger than any of the swordsmen in the City of Swords. But it was by no means in vain that I came here. I was able to learn skills that weren''t available in the Sword Princess and Sword God, so I was able to rebuild my basics and become able to fight in a variety of ways, and without a doubt, I had improved even more than before. I think I''d be able to do that now. My destination is my parents'' house in my hometown. The world''s most powerful swordsman is there. ''I might be able to beat my mother now. Haha, that''s an interesting thing to say, customer," Gosha laughed. 35-Episode 1 This time I want to master magic When I woke up, there was a familiar ceiling. It''s a pretty old house, so there''s a lot of damage here and there, but the most noticeable thing about it is the big hole. It had been created when my sister had snuck into my bed earlier in the morning when I woke up and kicked her as hard as I could. It was the ceiling of my parents'' room. I squinted at the sight of my old room where I had spent more than a decade. ''.........Hmm. My parents'' house is so relaxing after all. The bed is comfortable with my body and I feel like I slept well last night. And that''s when I notice a soft feeling around my waist. I pull off the blanket and find a little girl lying in a hug, hugging me. Nii-sama........how did you leave me? It was my little sister Mira who was talking in her adorable sleep. She was born after I received the blessing ceremony, and she''s almost five years old. She has always stuck close to me since she was a little girl, but maybe it''s because we''ve been away from home for a while, but since we''ve come home, I think it''s gotten worse. Well, you can''t blame her for sneaking into bed without permission. If this was my sister, I would kick her off without a second thought, but I can''t do that to Mira. After all, she''s my sister. ''''Good.'''' ...hmmm.... When I patted her head, Mila''s cheeks loosened up with joy. That sister, by the way, is now away from her parents'' house. After I started my sword training in earnest, she said, "Wait for me, Arel!I''ll make sure your sister creates a world where Arel can live without any problems! He left the house alone, telling me with a prepared look on his face, "I''m not going to be able to do anything about it. Where in the world is he going? Oh, well. It''s nice and quiet. It was only the day before yesterday that I returned to this small town where my parents live. I''ve only been in the City of Swords for about half a year at most, but perhaps because I''ve rarely been out of town, I feel as if I''ve been away from home for a long time. That''s why I missed this town so much. When I returned home, I walked around the town, and for some reason there were many people who knew that I had left for the Sword City, and every time I met them, they called out to me. ''''Arel-kun, you''ve done well........ Humans, everything is a challenge, so you shouldn''t worry too much about it, right?'''' That experience will come with you in the future. So stay strong. "You have a family that loves you. Don''t you ever forget that? I was always given words of consolation, but apparently he thought I had come back soon after my setback. In fact, I corrected him, saying that he hadn''t done that, in fact, he had even won the Kenshin Cup, a tournament to determine the strongest swordsman in the city, but... When I did so, he became more and more worried and looked at me like I was looking at a poor child, so I gave up on the idea that it wasn''t something that would bother me if he was mistaken. Then yesterday. I fought my mother for the title of the world''s greatest swordsman. I won by the skin of my teeth. Well, I had trained for a real battle in the City of Swords and was in a state of solid completion. Mom, on the other hand, has been away from actual combat for a long time and is almost a housewife, although she is occasionally sent out to help the vigilante group in defeating demons. The difference between the two would not have been small, but still, a win is a win. ''''It''s amazing, Arelle!I can''t believe I''m this strong in just six months!'''' Mom was happy to let go of the fact that she had lost. I''d never won before. So it wasn''t a mistake to leave my parents'' house and spend the last six months in Sword City. Nevertheless, even though they should have the same skills, Mom was still incomparably stronger than the Living Armor of the Sword God that she fought in the Sword City dungeon. The Living Armor only follows pre-input commands and unleashes skills, so she couldn''t expect human-like resourcefulness. On the other hand, Mom is top-notch in all of them, such as the way she assembles tactics, her ability to make split-second decisions against unexpected attacks, and her skillful selection of skills according to the situation, and she never relies on her skills to fight. Well, when you think about it like that, it''s no wonder there''s a difference. However, to be honest, Mom, you are not that smart, and although you are usually quite careless, you become a different person only when you are holding a sword, which is surprising. Anyway, I should be able to say that I''m now the world''s most powerful swordsman, both in name and reality. .........Hmm. What shall we do from today? I don''t know, I feel like I''ve suddenly lost my tension, or rather, my sense of urgency. Of course I will continue to train my sword. But now that I''ve already reached the top of the heap, it''s hard to say if I''ll be able to approach it with the same drive and determination as before. I''ve spent almost all of my day training so far, but I''m sure that''s not possible. Then, I''m sure I''ll have some free time. Maybe it''s okay to take some time off to relax a bit but that''s my nature and I''m not comfortable with that. ''''Okay, then, let''s try to master that thing next time. That day. I asked my father for help. "You have to teach me magic. Now I want to master it. My dad and my mom, who was listening to it beside me, opened their mouths with a pop. "...What? 36-Episode 2: Magic is different from a sword Arel. I''m sorry, but that''s indeed hard to do. When I asked him to teach me magic, that was the first thing he said in return. It''s true that you may have been able to acquire a sword as good as anyone else''s, even though you''re unemployed. But that was because of the sword. Magic is not the same as a sword. My dad says that in order to use magic, no matter how rudimentary it is, you have to be a professional who can use magic. This is because people usually don''t possess magical powers. It is only when they are given an occupation such as Magic Master that they are able to possess magic power within their bodies. That''s why you can never use magic in any other profession. ''Of course my dad was the same. I was able to use magic for the first time after going through the blessing ceremony. It''s no wonder, because before that he had no magic power at all. My father tells me. ''That''s what I mean when I say that swords and magic are different. Anyone with arms can wield a sword, and if you train, you may be able to improve without skill. But when it comes to magic, it''s a situation where you have no arms to begin with. It would be impossible to even train in this, right?No matter how much of an allele it is, that doesn''t make it magical. Hmm. Well, I guess my father''s argument does make sense. But I countered. First of all, I want to make a correction. You don''t have to have arms to wield a sword. You just need to use your feet and your mouth. I don''t necessarily have to use my arms. I certainly have two healthy arms, but even if I hadn''t, I would have approached it from a completely different direction. You can''t get too caught up in the stereotypes. ''''Mm........'''' Dad snorted with a subtle look on his face. ''I think you''re the only one who can do that...'' he blurted out. ''And there''s one more thing I need to correct in Dad''s story. ...? I ask my dad, who tilts his head back. ''How can you be sure a person doesn''t have magical powers? Dad looked stunned for a moment, then with a difficult look on his face. ''No, that''s because that''s what it''s commonly referred to as...'' Of course I know that. I''ve done a little homework on it, too, with books and such. But there''s no clear evidence for it anywhere. The best I can tell you is that they can''t recognize magic, so they don''t have magic power. But this shouldn''t be enough to say that there is no magic power, right? Could it be that the amount of magic power is simply too low for you to recognize it yourself? In truth, isn''t it possible that any human being could have magical powers in trace amounts? That''s my theory. ''Ummm ... sure, I can''t say for sure that it''s never going to happen, but ... hmm?Was it? This is the result of actually testing the hypothesis to see if it was correct. ...? In front of Dad, who looks doubtful, I release the evil power inside my body and out of my body. With a very small amount of magic wave, my dad''s bangs float up softly. "Huh? Well, there you go. It took me a while to learn how to recognize the magic inside my body. In fact, I''ve been secretly trying to do this since I saw what they call a ''magic sword'' in the City of Swords. Once you know your magic power, it''s not so hard to focus it, move it around, or release it out of the body. However, I hadn''t yet gotten to the point of actually ''magicizing'' this. Here''s the exception. This means that the commonly held belief that people who are not given a profession to use magic with their blessings do not have magical powers is not absolute, at least not yet. I''ve come to that conclusion. I know that probably every person has magical powers, but I can''t say that much if I''m the only one with a sample. ''''Well, well........'''' What is it, Dad?You look so weird. For a moment, Dad''s mouth was crunching like a fish eating food, and then he suddenly shouted out loud. ''Well, Arel is doing something outrageous again, plain and simple! Even if you are able to recognize your own magic power, it''s still only a starting point. As long as there is only a very small amount of it, you can''t use locks of magic with this. ''''So first, I want you to teach me how to increase my magic power. Okay, okay.... Dad nodded his head easily, but he still seemed a little excited. I''m sure I know a few ways to increase the magic power, but.... I''m sure you''re not the only one who can use magic, and that doesn''t mean you can''t increase your magic power the same way? ''Well, if it''s hard, then that''s the time. But I think it''s far easier to turn one into two than it is to turn zero into one. .... Then my dad taught me how to do it, and it was very simple. Use magic. That''s all, apparently. People with professions that can use magic know from experience that the more magic they use, the greater the amount of magic they have. Hmm. It''s the same with muscles. The more a muscle is used, the stronger it becomes. ''''That''s easy.'''' However, it''s a prerequisite that you are aware of your own magical power, and it''s a lot of work to get there. Let''s try it for now. So, I''m going to release more and more magic power. ? Arel? -- collapsed on the spot. 37-Episode 3 I Want Thousands I see. So when the magic power is depleted, one faints? I woke up on the bed in my room and concluded that I had suddenly blacked out. ''So, I suppose that means that magic is essential for humans, even if it''s in minute amounts. Considering this, it seems that magic power is definitely in every person. ''''Even if I consume magic power, do I have to stop just short of the limit? It would be very inefficient if he passed out every time he trained. It seemed that he had been asleep for nearly half a day, and it was already evening outside. ''''Nii-sama.......you can''t go anywhere else.......mmmmmmmm.... There''s another soft feeling in my stomach. Mila was asleep in my arms, exactly as she was in the morning. She was probably trying to nurse me, but she must have fallen asleep in the process. She''s a really cute little sister. I''ve been sleeping for a long time, and my magic power has almost recovered. But. I don''t feel like I''m gaining at all. Well, it was just one. That''s about it. Then I used my magic power repeatedly. I would use it up until it was one step closer to being completely exhausted, wait for it to recover, and then use it again. And so on for a week. "....it doesn''t feel as if it''s increasing. It''s only been a week, and it can''t be helped. But I''ve noticed one thing that could be called fatal. "Magic power is unusually slow to recover. If it was a muscle, it could be repaired in a flash thanks to the blessing, so it was possible to train the muscles continuously. But magic power doesn''t recover with blessings. The speed of recovery might increase after repeating it many times, but it was very inefficient anyway. This would take a lifetime, just the first step of increasing magic power. ''''Shall I use that?'''' I headed to a certain store in town. Inside the small shop, various items are crammed together. It is an item shop. It''s Arrell-chan, isn''t it? What do you want today? The woman who owned the store approached me in a friendly manner. Because she lives near my house, I''ve known her since I was a child. I''ve even been asked by my parents to run an errand for them. ''I''m here to buy some mana potions. A mana potion is a drinking potion that is used to restore magic power. Instead of waiting for the magic power to fill up naturally, I was going to use this thing to try to increase the magic power efficiently. ''''Did your father ask you to do this?'''' That''s not what I''m doing. I''m going to use it. ...Arel-chan. Auntie looked very sad. There''s definitely something wrong with her. It''s too much trouble to correct her, so I ordered quickly. ''I want a thousand bottles.'' I don''t know why my auntie started crying. ''.........I knew the rumors were true after all....... Auntie is on Arel-chan''s side...so I can give you one or two bottles of wine, as much as you want. But even if you''re a grandmother, a thousand bottles.... Don''t worry about it. I''ve got the money. Mana potions are expensive. They probably don''t think they have the money to buy a thousand of them. But I had a lot of money that I earned in the City of Swords. It is possible to pay for it in a lump sum. I calculated the cost of a thousand bottles and placed a large amount of gold coins on the counter. Auntie''s eyes and mouth widened. ''This should be just fine. We probably don''t have a thousand bottles in stock, but I''ll pay you in advance.'' ''Oh, uh...'' Auntie''s whole body shook with a buzz and she suddenly let out an angry voice. ''''Arelle-chan!You can''t steal!How sad do you think your mother and father are going to be! Apparently, she thought it was stolen money. But after shouting out loud, Auntie got a huff on her face. No, I didn''t take it. And I didn''t get separated from you. ''Goddess, why did you put this child through this miserable ordeal...'' I corrected her, but she started praying to the goddess and didn''t listen to me at all. It took me an hour to convince her that I had properly earned the money myself after this. Thanks to the mana potion, my efficiency has improved dramatically. Every time my magic power decreased, I drank it, and as soon as I recovered, I used my magic power again. Repeating the process. Fortunately, my magic power level was poor, so just a sip of the Mana Potion was enough to make me fully recovered. One day while I was continuing my challenge to increase my magic power like that. I went to my auntie''s shop to pick up a new shipment of mana potion, and when I came home, I found my sister Mira at the door pushing and shoving with someone. ''Please take them away, sir. Ni-sama isn''t here. ''So if you''re not at home, I say I''ll wait a while. Why do you try to get rid of him so? Ni-sama won''t be coming back for a while. He''s going to a place called Keno Toshi. ''It can''t be. I was definitely in the City of Swords, but that guy should be back here now. I''m sorry but Ni-sama is not here. I''m sorry, sir. Hmm? Why is Mila lying? I''ll be here. And more importantly, the person you''re arguing with Mira. That''s Laina with the red hair. He''s back home too? 38-Episode 4 This is just a female pig Laina. What''s going on? I call out to the red haired girl who was arguing with my sister. She looked back at us, rolled her eyes for a moment, and then Huh...!I knew you were there!Why did you lie-- Tsk. Didn''t you just click your tongue? It''s your fault. Mila said bluntly and then stared at me with zealous eyes for some reason. Who is this, Ni-sama, who is this musu........................woman? ''Mesbu I think I just got the feeling that I''m about to be cursed in some terrible way...'' It''s all because of Kiwi. It''s Laina. We were in the City of Swords together. He''s mumbling something, but I couldn''t quite hear him because his voice is so low. Laina asks fearfully. ''Who the hell is this girl?'' That''s my sister Mira. My sister....................... "?What''s going on? ''No I just wanted to make sure everything was okay...'' Laina gives me an unnamable look, but I don''t know what she''s talking about. ''Well, well, she''s just a kid and that''s how it should be!--That''s not the point!You, why did you leave the guild on your own! Hm?I didn''t do it on my own. I''ve already filed a notice of withdrawal. "I didn''t know anything about this! I never told you that. You could have at least said hello! Hmm. Is that how it works? And after all the trouble you''ve gotten into?There''s never been a time when the winner of the Sword God''s Cup has left the city. I''m a stickler for precedent, so I don''t blame you. ...you''re really, really... Laina let out a disgusted sigh. ''So what do you want?I mean, are you back at home too? ''You''re half right. My father is retiring from the neighborhood watch, and he hasn''t been back in a while. Laina''s father was a vigilante leader in this city. ''Come to think of it, you''re a fuzzaholic. ''''You ... you really don''t realize that there are others like it closer to home?'''' What are you talking about? ''It''s nothing.... And I''m not a father figure! What? Mira''s hugging me around the waist. What''s the matter, Mira? Buuuuut. Maybe it''s because he''s been talking to Laina all the time, or maybe he''s a little flustered. ''''Ni-sama''s silly........'''' I pick Mira up. ''I''m sorry. I need you to put me in a good mood. "...a piece of tin. Hmm? Just give me a little music and I''ll let you go. A kiss. That''s about as good as it gets. I press my lips to Mila''s forehead. "Wha... For some reason, Laina is blindsided. ''''Kikki, you, what are you and your siblings doing? "?Isn''t it normal for a brother to kiss his sister?If it''s in your mouth, but it''s in your forehead. You can''t be normal! Well, if my sister tried to kiss me, I''d do my best to fight her off. That''s when Mila looked back at Laina for a moment as she was picked up by me. I couldn''t see what she looked like, but ''What?Now that was a completely winning woman''s face! What are you talking about?Mira is only five years old. That''s right. Ni-sama, that lady must be crazy. It would be better to hurry up and avoid confrontation with her. "Hey! Ummm.........Ni-sama......that lady is scary....... Hey, hey. It''s okay. Your brother''s there. Laina''s guy, what is he so pissed off about with a five year old? As I was about to enter the house with a teary-eyed Mila, Laina stopped me. ''''Wait, wait a minute!I didn''t come for you alone! "Hmm? Your mother, Lady Fara, wants to talk to you! ''''Hmmm, I can''t even put Arelle-chan in the corner. I can''t believe you''d take such a beautiful woman as your girlfriend. When I brought Laina up to the house, my mom happily said something like that to me. ''Ka, it''s not her or anything! Laina hurriedly denies it, but for some reason her cheeks are red. ''No, Ka-sama. This is just an eyelid. I''m not even a pig! So I told him not to fight with a five-year-old. ''You sure are a beautiful girl.'' Dad nodded his head in agreement. Maybe it was because young women rarely had the opportunity to come to our house, but he was a good old man and his nose was a little longer than usual. ''''....Oh dear?'''' It was my mom who noticed it acutely. It''s because your mother seems to be very calm, but she''s actually quite sensitive. As expected of the "Sword God" in that respect. "Mm-hmm, father?Who is more beautiful, me or you? ''Momo, of course it''s your mother!Well, by the way, your mother is still much younger!You still look like you''re about twenty! He''s questioned by Mom, who''s smiling but not smiling only in her eyes, and Dad is desperately trying to praise her as she slurps and sweats. Dad, you''re pathetic. Dad''s all-out praise for Mom finally works, and her smile returns to its normal tone. Then she turned her gaze and Laina, who had been watching from the sidelines with a blue face, shook her shoulders with a jolt. ''''So what is it you''re talking about?'''' Okay. Laina replied in an upturned voice and bowed to her mother. ''Oh, I''ve come to ask you to be my apprentice! 39-Episode 5: I didnt come to train the bride Ni-sama, I''ll be careful with that eyelid. For the sake of the group, it''s not fair to you. Really?It sounds like you''re taking it seriously, for one thing. Mom accepted Laina''s application to become an apprentice with an immediate response. I thought Mom was the type of person who wouldn''t take an apprentice, so it was surprising to me. "She''s my future wife. I''ll teach you well. He was about to start teaching Laina the basics of housekeeping, saying happily, ''''I''m not. ''''No!It''s the sword that I want you to teach me!I''m not here to train a bride! "What?Is it that way? I don''t mind if it''s in tandem with the housework.'''' And so, Laina was to learn not only the sword, but also general household chores such as cooking, cleaning, and laundry from her mother. ''''Why am I cleaning the toilets in your house........'''' Laina is doing her best to do the housework in our house while muttering to herself about it. By the way, for some reason she is a live-in worker. There should be a family home nearby, though. I''m happy to see that I have an additional daughter. And Laina-chan, your housekeeping is so bad that it''s worth teaching her.'' Mom seemed to like Laina a lot. ''Mirra is not happy at all. On the other hand, it is Mira who is puffed up. ''Don''t say that, just get along. Boo. By the way, I''m taking a bath with Mila right now. I was washing her head and doing it. "Do you have an itch somewhere? It''s a true heart. Whole body? Yes. And so, Ni-sama, I will not allow you to abuse my body. ''-Why are siblings taking a bath together? The bath door suddenly opened and Laina''s angry voice roared into the small bathroom. ''What''s going on?'' Hey, don''t turn around!Shush, you can see down there! Laina hurriedly covered her face with her hands. ''I''m watching you through your fingers? Mimi, I didn''t see him!I didn''t see it!That''s not the point!Why are you two brothers and sisters taking a bath together? Hmm?It''s been my job since I was two years old to give Mira a bath, though? Of course, I couldn''t do it while I was in the City of Swords. ''It''s about time you got in there by yourself! No way. I''m afraid to bathe alone. Don''t be so juvenile all of a sudden! ''I mean, it''s not like it''s appealing, Mila''s actually only five years old. It can''t be helped. That''s right. I have no choice. Laina groaned, giggling as she was rebutted. In the end, she didn''t say anything back and quickly retreated from the bathroom. Hmm?What did you say? It''s nothing, Neesama. Then, as we were both soaking in the hot tub, the door opened again. What now? I thought it was my dad. ''Mira and.......can your father come in with us.......?'' No, sir. ''Why, Mira!You used to come in with me! I''ve had enough of this. The time for bathing with your father has passed. And Arell is good? It''s natural. I don''t care how old you are, as long as you''re with your brother. .... hmm? I think Mira just said something strange........well, I guess it was my imagination. ''''........Well, that''s great, Arel. I didn''t expect you to increase your magic power so much in such a short period of time.... Dad rolled his eyes in surprise. ''''Probably the equivalent of the Magician right after receiving the Blessed...'''' It''s been about half a year since I started training to increase my magical power. Finally, I''ve obtained the minimum amount of magic power needed. I think it''s probably more than 20 times higher than the tiny amount of magic power I had at first. How do you feel, dad, can you activate your magic with this? ''Well...'' I ask him, and he cracks up a little bit. ''''It''s true that the amount of magic you can unleash is sufficient for elementary level magic........ But here''s one more problem you''ll have to overcome, a tricky one. "A tricky problem? "My father says. "In order to activate magic, you need something called a ''jutsu'', which is made up of special magic characters. This can be activated by drawing it on special materials, but generally the wielder can picture it in his mind to activate it. Okay. Then I''d like you to teach me that technique. Or rather, in that case, you should have told me about it first. Of course I planned to, but I didn''t think I''d be able to take the next step so quickly. As he said this, Dad pulled something out of his pocket. There was some writing on it that I had never seen before, but it looked like it was handwritten. I wondered if my father had made it. ''This one has magic letters and grammar written all over it. Your father made it up for Arel. Dad says a little proudly. He looks like he wants a pat on the back. "Oh, well. Good. .... hmm. I skimmed through it lightly and immediately realized how difficult it was to understand. "Don''t tell me a wizard has to build such a cumbersome magic formula in his head every time he uses magic? ''No, it''s not. The necessary techniques will pop up in your mind semi-automatically. That''s why you don''t have to go to the trouble of constructing a complicated formula from scratch. I see. So that''s the effect of magic-based skills. But I don''t have any skills. ''Yes. I mean..... Every time I try to activate my magic, it means I have to build all this nasty jutsu all by myself every time I try to activate it. ''''Well, we''ll figure it out. 40-Episode 6 What magic are you good at? The carriage rumbled along the cobblestone road, making a rumbling sound. I asked him, "How much farther are we from the City of Magic? How much farther is it to the City of Magic? You know what?Maybe two or three days to get there. The reply was quite vague. After all, it''s the weather. That''s just a matter of luck. Hmm. Come to think of it, I''ve heard that story before. I''ve heard that the area around the magical city sometimes experiences severe weather that makes it impossible to get to and from the streets. I''ve heard that it''s difficult to predict because it happens irregularly and out of the blue. The magical city of Alsubel. As the name suggests, it is said to be the most magically advanced city in the world. It is said that the city has produced a number of wizards who have left their mark on history, and that even now, excellent wizards gather to devote themselves to researching the essence of magic day and night. I''m on my way to the city to seek out even higher levels of magic. I''m sure my father and mother are having a hard time calming down an angry Mila. Forgive me, Mira. I''ll bathe with you again when I get home. It''s been a little over three years since I started training in magic. I had turned nineteen. "Hey, are you going to go to the magical city too? It was a boy who came to visit me in a familiar way, a boy who had boarded the train at a station not long ago. He was still in his mid-teens, I guess. I can''t speak for him, but he is dressed in a simple, country style, but he has a very competitive face. I''m sure you''ll be able to tell. That''s right. I replied, and the boy laughed as if he was making fun of people. "Hey, hey, hey. What the hell have you been doing since you were blessed until you were that age?I think it''s a little too late to go to a magical city, don''t you? The City of Swords was a place where those who had already learned to use swords were gathered. That''s why the majority of them were experienced [senior positions], and it wasn''t unusual for them to be in their 20s or 30s, even if they were new to the guild. However, the magical city also has the aspect of an "educational institution for wizards". It is made up of several schools called "academies," and the majority of the city''s residents were students of the academies. Therefore, it seems that the only people who visit the city are boys and girls in their early teens who have only been blessed for a few years or so. ''''Don''t do it, Kite. Probably this person has been failing the entrance examinations for a long time now. That''s the result of your hard work, so don''t look down on it too much. The one who seemed to follow up and instead said something terrible was a girl of the same age as the boy. I''m sure he doesn''t intend to do so, since his face is so serious as he chides the boy. It''s a good thing that you''re a good friend. You''re the one looking down on me. What?You don''t think so? The two people become swift and swift in the air. Then the other girl interrupts in a hurry to intercede. I''m not going to be able to get a hold of you, I''m not going to be able to get a hold of you, I''m not going to be able to get a hold of you. I''m not fighting with you, Colette. ''Yes. I''m just chiding Kite. Perhaps the three of us are childhood friends from the same hometown heading to the magical city together. But please don''t interrupt me to argue with each other. "Tsk. Hmph. ''Huh....'' I guess my thoughts were answered, and they quieted down in three different ways. But after a while, the boy opens his mouth again. ''So what kind of magic are you good at?'' You''ve been showing interest in me for a while now. Or maybe you just want someone to pass the time with, or maybe you just have a personality that doesn''t feel comfortable unless you''re having a conversation. ''Hmm. Not that there''s anything special about it. I responded honestly. ''Oh?What are you talking about? You know what you''re good at. I don''t know what you''re talking about, but I''m talking about the skills you have, the skills. I''m not going to be able to get a hold of you. Even if it''s a "basic" job, the skills that can be acquired are different for each person, such as "Red Magic, Beginner" or "Blue Magic, Beginner". It seems that this boy has a red magic type skill. By the way, it is said that there are six types of magic as follows Red magic: magic related to fire and heat, etc. Blue Magic: Magic related to water, ice, cold air, etc. Green Magic: Magic related to atmosphere, weather, etc. Yellow magic: magic related to earth, metal, etc. White magic: magic about light, life, etc. Black Magic: Magic about darkness, death, etc. But I''m just an "unemployed" and of course I don''t have any skills. Hence, even when I was asked if I was good at magic, I could only answer that I was not. ''''To begin with, I don''t have any magic skills. No, it''s not magic, not at all. After all, my profession is Unemployed. What? The boy was stunned with his mouth wide open. The girl who was listening to the conversation beside me, the girl from earlier suddenly gushed out. ''''Phew. Hahaha!Kite, you''re being teased. Normally, an ''unemployed'' wouldn''t want to enter a magical city. Wha...? It was humiliating, or maybe it was humiliation, and the boy turned red in the face. No, it''s true. ''I''m not lying,'' I showed him the certificate. ''Oh, my God.Are you sure it''s unemployed?Isn''t this a forgery? Oh, you''re really here... ''Geehahaha!So you''re seriously trying to get into a magical city?This guy is crazy! As the boy''s laughter catches up with him, the other guests start laughing too. Hmm. I''ve seen this scene before. That time, as I recall, right after this, the King Orc-- Hey, that''s... One of the passengers shouts in a strong voice. I turn my eyes in the direction of his gaze. There''s a rather large one. "And a troll king! Oh dear, now it''s the upper echelon of trolls. 41-Episode 7 Its Better to Cover Your Ears One of the passengers shouted at the hulking figure as it emerged stealthily from behind a rock. ''And the troll?The trolls are out! The troll is a large, fat, humanoid monster. Although it moves as slowly as it looks, it boasts an overwhelming strength that can crush even rocks with just a strong grip. But is that a troll...? ''No wait ... that''s too big, isn''t it? I was just thinking the same thing. Normal trolls can reach three meters in height. But the troll that appeared in front of us now was, by my estimate, lightly over five meters tall. Because of its size, the trolls seemed to be quite close to us, even though they were still more than 100 meters away. ''''Don''t tell me it''s a troll king! Hmm. Looks like it. It''s a high level individual of trolls. Although they don''t lead a pack like the King Orcs, they were said to have a threat level that rivaled that on their own. The troll king noticed our presence, and his face was twisted in an eerie manner, as if he was laughing at us. Immediately after, he approached towards us. ''Let the horses run as fast as they can!Run! Hey, hey! In response to the passengers'' shouts, Gosha put the whip in. The carriage accelerated at once. It is true that the troll breed is not very fast on its feet. If they let the carriage fly as fast as it could, it would not be impossible for them to escape. ''''Yo, good!They''re starting to let go a little bit! The distance between him and the Troll King began to slowly open up. Eventually, the troll king realizes that he can''t keep up, and he stops. The passengers express relief. Even the boys and girls from earlier seemed relieved. K.........well, I was going to use my magic to beat you. Kite, can you hear the shake in your voice? Thank you for the help... I warned them. ''No, don''t be alarmed yet. The troll king stopped in his tracks, but there was still an unpleasant air coming from it. My gut instincts warned me that that was by no means a feeling of having given up on my prey. ''What?What are you talking-- Hmm. I think you might want to cover your ears. I''d advise you to be quick, or the Troll King would take a breath so large that his massive body would swell even more. ''Oaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa! He let out a tremendous yell. ''''~~~~!'''' The sky trembled and the earth shook. The passengers, who were weak in spirit, fell down in a faint from the overwhelming "intimidation". The horse came to a neighing sound. The Gosha tried desperately to quiet it down, but fear took over, and there was no stopping the horse as it ran off at a crappy pace. The carriage swung wildly from side to side and veered off the road. The horse sprained its legs on the unmaintained road and suddenly the horse flipped over, as if it were turning over. The carriage still coasting for a while, but eventually came to a halt when it hit a rock. ''''There it is........what was that, what was that.......?'''' My ears hurt... ''Huh....'' Some of the passengers, including the boys and girls, seem to be safe, although some of them have fainted. Even the Gosha who was thrown from the Gosha''s platform seems to be somehow alive as he is rolling around on the ground but is trying his best to get up. The Troll King was still approaching slowly towards us with an annoyed smile on his face. The passengers hurriedly tried to get away, but Hee.... He couldn''t even stand up, even though most of them hadn''t even been injured. It''s because of that roar earlier. It was probably the troll king''s strategy to scare them with that and make them unable to move. In the midst of all this, the man who was supposed to be riding in the carriage as an escort started running alone. ''''Ah, the escort has escaped! "Hey, wait!I want you to slay that demon! Don''t be stupid!There''s no way you can fight that thing! Ignoring the accusations, he abandoned his mission and fled quickly. Well, everyone''s life was spared, and he couldn''t blame him for his decision. ''d*mn it!I''m going to burn it with my magic........ Kite? It was the boy from earlier who confronted the troll king. Hmm. He''s quite brave. ........although his legs are trembling like a newborn fawn. "Whew, Fireball! The boy activated a rudimentary red magic that shoots out a spherical flame. Red magic, by its nature, tends to be highly powerful, but its hit rate is somewhat inferior. However, if the target is large and slow-moving, this disadvantage is not much of a concern. You can find a number of different types of products in the marketplace. ''''A fireball may be a fireball, but it''s still a blow with all the magical power poured into it!I don''t care how many troll kings you have-- Oaaaah! Gosh! What? When the Troll King let out another yell, the shockwave generated by it easily obliterated the fireball the boy had released. ''''Oh, no, right...?'''' The boy snaps his hips heaving in place. ''''I can''t believe that even Kite''s magic doesn''t work at all...'''' We''re going to die here...? Don''t worry, it won''t come to that. "What? At my words, the girls look back at me. ''Kite, was it?Thanks to you stalling for a little while, we''re going to be able to finish it off with a single shot. What the hell are you talking about?What can an unemployed person do? With the boy, who was raising his voice, behind me, I activated the magic formula I had assembled in my head. ''Explosions.'' Immediately afterwards, the troll king''s huge body was enveloped in explosive flames. 42-Episode 8 Let me call you Master A huge blast of flame completely covered the troll king''s huge body. A tremendous hot wind rushed over to us. ''''Heat!'''' Hi! Ka, God! Some of the passengers were blown backwards. Hmm. It''s a shame. I guess I should have adjusted the direction of the explosion properly. Well, no one seems to have died, so it''s OK. When the dust that had filled the area had cleared, there was a huge crater. As I got closer, I saw that charred pieces of meat were scattered everywhere. Of course, that was the end of the Troll King''s maturity. ''''Looks like it''s a good thing you dropped the power more in the first place. It was clearly overkill. It seems that he was a little too eager to try out the game, because a handful of demonic objects appeared. The best way to do this is to have a look at the actuality of the situation. The boy asked in a trembling voice. ''I just unleashed one of the red magics, Explosions, on the Troll King? ''When you say explosion, isn''t that top-tier red magic?That''s the magic used by the "Magus King" class of the [Highest Rank]! I see. It''s true that I thought it was a pretty powerful magic. In my case, I''ve learned magic independently of my skills, so I don''t have much knowledge in that area. ''''So it was a lie to say that I''m ''unemployed''.......'''' He was actually a famous wizard... No, I''m really unemployed. Didn''t I just show you the certificate? I explained that, but the girls didn''t take it up at all, saying things like, "It must be a forgery," and "They must be hiding their identity for some reason....... And then. S.... Hmm? The boy suddenly knelt in front of me. ''I''m sorry! And then he apologizes loudly. ''I didn''t know you were a great grand teacher, and all the rudeness from earlier!Please forgive me! So I''m not like that. ''And please, let me call you Master from now on!I want to be a wizard like you! I regretted that I should have defeated him with my sword if this was the case. The rest of the trip went smoothly. The weather was also fine, which was a matter of concern, and the magical city was finally in sight. I see. I''ve heard about it, but it''s a pretty interesting place. The magical city was located on an island floating in a huge lake. There was a natural bridge made of earth and sand that connected the island to this side. ''''Master!That bridge, they say they use magic to maintain it!Otherwise, they say it will be gone soon!It''s just like a magical city, isn''t it! He told me excitedly that it was a boy named Kite. Ever since he accidentally defeated the Troll King, he changed his initial attitude and has been like this ever since. ''How could that cheeky kite be like a dog wagging its tail at its owner...'' It''s amazing... The girls with me are looking at me with surprising looks. By the way, the strong-looking one is Koofa, and the one who is frightened all the time seems to be Colette. The bridge was not accessible by carriage, so we had to cross it on foot. The weather was fine today, and there was almost no wind, but I heard that when a storm, which is a specialty of this area, occurs, it makes it impossible to get to and from the island. Eventually, we arrived at the City of Magic. There are six magical institutes in this city. And each academy specializes in teaching and researching one type of magic. Namely. The Red Academy: Red Magic (magic related to fire, heat, etc.) Blue Academy: blue magic (magic related to water, ice, cold air, etc.) The Green Academy: Green Magic (magic about the atmosphere, weather, etc.) The Yellow Institute: yellow magic (magic about earth, metal, etc.) The White Academy: White Magic (magic about light, life, etc.) Black Academy: Black Magic (magic about darkness, death, etc.) The six of them are. Master! What now? ''''Master is a red academy too, right?They say you can just go straight down that road!I''ll go with you! Kite prompts me happily. ''''Well, I guess I''ll say goodbye here then. I''m at the Blue Academy.'''' I''m from the Green Academy. Kufa seems to have blue magic and Colette has green magic skills. ''Oh, bye!You don''t want to end up failing the entrance exam and going back to the countryside! I''ll give it to you straight from the word go. The three of us went in different directions while talking to each other about such things. And I had no choice but to head towards the Red Academy with Kite. ''''What? Master is taking the entrance exam too?! They say you have to pass the test to get in. ''I mean, Master, how on earth did you learn magic?'' Even if one had magical skills, one could not master them without a certain amount of knowledge of the magic formula. That''s why many wizards enrolled in these institutes or studied under their predecessors. ''I learned it from my father,'' Wow, he must be a great guy. He looks like an old man with a dick. ''Ah, Master, there it is!That looks like the Red Academy! After a while, I saw a magnificent gate. Behind it, there is a building that looks like a school building. Well, it''s an entrance exam. I hope I don''t get turned away from the gate like I did with the Sword Guild. 43-Episode 9: Its too easy and boring for me ''Master, it says over there, "Exam room is here"! Yeah. Kite led me to the venue. It seems to be an outdoor training ground. Boys and girls who seemed to be applicants for admission had already gathered there. It is said that the entrance exam is held over a period of several days at this time of year. This is just the time of year, that''s why they came to this city in time for it. There was a possibility that it would be later due to the weather, but since we arrived earlier than planned, it looks like we''ll be able to take the exam with plenty of time to spare. Well, it wouldn''t have mattered, at least the weather. "Candidates, please fill out the registration form here. A woman who looked like a staff member called out to me as I entered the opening area. I obeyed, wrote the necessary information on a form and handed it over. You must be Arel. You must be from the town of Cains. Her occupation is....eh?Um, did I write it wrong? No, make no mistake. I''m unemployed. ''I mean, the fact that it doesn''t say anything about skills or anything...'' I don''t have anything for you. .... The woman on the staff shushed her. Hmm. It''s just what I thought it would be after all. If this is the case, I won''t be able to take the test, and I''ll be kicked out of the gate-- Now, your exam number will be 12, so please wait over there until I call you. Hmm? Are you sure? Whatever your profession is, you have the right to take the test... Apparently, you can take it. Thank goodness. If I hadn''t even received a qualification to take the exam, I was going to head directly to the top brass, but it seems to have saved me the trouble. Kite also seems to have finished the reception and comes over here. ''''Come on, Master!Let''s go! Yeah. ''''But if you''re as good as a master, you should be exempt from the exam. I''m a little concerned about what the staff would look like if they heard this guy''s statement earlier. The content of the test was quite simple. It''s a good idea to shoot a spell at the target - which looks like a metal doll - from a few dozen meters away and hit it. Probably to see the power of the magic, the hit rate, or the time it takes to activate it. One by one, a number is called out in order, and the candidate activates the magic. It''s natural since this is an institute for learning red magic, but everyone is red magic. The majority of them were fireballs, but some of them used fire lance, a magic that shoots out spear-shaped flames. But that doll used for the target, that''s not just any metal. It''s completely unharmed, even though it''s been bombarded with flames from a moment ago. Even iron and copper should have some surface melting. Maybe it''s made of mithril or something. Then, next. Your examination number, eleven. That''s my one number before me. A middle-aged man who looks like an examiner calls me, and a boy comes out. "Oh. So you''re a "mage" at your age? Will the form I just filled out be handed over to the examiner, I muttered in admiration while checking it in hand. A Mage is a [Senior position]. Perhaps that boy was given it with his first blessing. Of course, it was quite rare. ''''........Totally. This kind of childishly deceptive exam is too easy and boring for me.'''' The boy, who has a young but graceful appearance, spits out somewhat unnervingly and gruffly. He wears fine clothing that seems to be out of reach of the common people, and maybe he is a child of the nobility. He asked the examiner. ''''Is it safe for me to destroy that doll with my flames?'''' Yeah, that''s fine. That sounds like a bit of a challenge. Kite said uncomfortably beside me. ''Master, he''s kind of a cocky guy, isn''t he?'' I don''t think that''s something you could say. The boy from the "Mage" held out his hand towards the target. ''''Burn it all up, Irrationality! A huge pillar of fire rose up around the doll, seemingly piercing the heavens. A moment later, his skin was seared by the hot wind that came rushing in, and then a large amount of fire sparks poured down on him. That red magic, which was reminiscent of a volcanic eruption, was far more powerful than anything the candidates had used so far. ''''Wow, wow........'''' That''s the mage... Are you really a student like us...? Beside me, Kite was rolling his eyes too, but I mean, you don''t sound so bad yourself, but my master is a lot better than me. Why are you so proud of yourself for winning? ''Isn''t that right, Master?'' It seems that Kite''s words were heard, and the boy from earlier came over here. I''m not going to ask you about that. I''m not sure I''m going to be able to do that. That''s right! Kite responds. ''''Haha, as expected of a commoner, you tell funny jokes that we nobles can''t understand. What? It seems he was a nobleman after all. But even though Kite knows that, he is not afraid of it, on the contrary, he''s about to strike out at any moment. ''''Hey, calm down.'''' Master.......... It seems that this master still has a decent head on his shoulders. It seems that he understands the difference in ability between us. In fact, it is impossible for a mere "sorcerer" to melt a target made of metal with fire. No, I don''t want you to miss the target. What are you talking about? How could you possibly survive my Irrational--? The boy sniffed at my point, but gasped as if he was astonished to see for himself. The doll stood there looking exactly the same. ''That wasn''t just any metal. It''s probably made of mithril.'' 44-Episode 10: Its not just an raption Mithril, also known as holy silver, is much stronger than iron or copper, and it is also more resistant to magic. I''m not going to be able to say that I''m not going to be able to get my hands on any of them. ''''That''s right. That doll is made of Mithril, which was custom made by the Yellow Academy, and has been used for entrance exams for many years now. But not a single candidate has yet to unleash a spell with the power to melt that thing. The middle-aged examiner told me somewhat proudly. ''''Kuh........it was Mithril.......'''' The boy contorted his face in frustration, then Well, well, if you say it''s made of mithril, it doesn''t help that it withstood my magic. I muttered to myself to convince myself. ''''Pupu, seriously, you''re a hussy. You were so confident, you know! Kite went out of his way to encourage him to do so. ''''Hm........Hm......Then are you saying you can do it?'''' "I can''t do it, but Master can do it!Right, Master! Why do you want me to point the finger at you there? You provoked him, so why don''t you take care of it? After all, you just killed a troll king in the blink of an eye! Kite says something even more superfluous. ''Kukukukukuk!'' Then the boy from The Mage burst out laughing. ''Hahahaha!There are limits to how far you can go with a spiral!Or is that just a plebeian joke, too?A troll king is a demon that our territory''s knights will mobilize to defeat!You can''t kill that in the blink of an eye....chuckle.... It''s not a lie, though. "Hey, this is the time to laugh!Let him see it, Master, please! At any rate, I punched the idiot who proceeded to talk on his own. ''So, next, exam number, number twelve. I was soon to be next in line anyway. The examiner called me to stand in place. Because of Kite, you''re getting a lot of attention from the other examiners and people who seem to be observers....... ''''Hm?This is..... The examiner, who looked down at my hand as if he was looking at the documents I had submitted, had a questionable look on his face. Well......... It''s not that I have to destroy that doll just because Kite said so. But I can throw my magic at Mithril anyway. I''m going to try to be serious here. I''m going to improvise and create a magic formula. Of course, since I have no skills, there''s no such thing as a convenient automatic assist for building a magic formula, so I''ll have to build it all by myself from scratch. Would the Explosions that defeated the Troll King be able to destroy that Mithril doll? Perhaps it''s a subtle place. It''s not a good match for that high-intensity, explosive magic. I''m not sure if I''m going to be able to get a good idea of what I''m talking about. Instead, it would be better to use super-high heat to dissolve the doll. The quickest way to do that is to simply increase the amount of magic power that you pour into it............................but this will take a while. This test should also be looking at the time it takes to activate it, and it looks like we should not go in the direction of increasing the amount of magic power consumed. "Irrationality. I''ve arranged it quite a bit, but I''ll say the name of the magic as the basic technique is the same as the boy before. A moment later, the doll that is the target flared up sharply with a crack. As soon as you think, the flames disappear. ''''I didn''t think that an ''unemployed'' used magic...! It was the examiner who was astonished. On the other hand, a boy who looked like a nobleman roared a loud laugh. ''''Hahahahaha!What was that?That''s Irrational?It just glowed for a second!Instead of beating the Troll King, this is not even an entrance exam to fail!But it was a good comedy!I thought it was going to be a boring exam, but thanks to you, I enjoyed it more than I thought I would! Hmm. What in the world are you looking at, this boy? Look at that. I destroyed the dummy. ...What are you talking about? The boy turns his gaze to where the doll was. ''''--?What? No!Hey, where the hell did you put that doll? Where to do it or not, it would have melted and turned to liquid on the ground, right? The doll had turned into a shimmering, silvery liquid on its pedestal. It would harden again in time, but for now, it was still gurgling and boiling slightly. ''Bah, silly... it''s Mithril...?There''s no way they''re going to dissolve in an irruption! Because it''s not just an irruption, What? I''ve focused the flames to the extent of covering the doll, and I''ve also squeezed the ignition time down. Probably, as a localized power, it would have surpassed even Explosion. Of course, there was a need to incorporate a magic formula for that, but as far as activation time goes, there shouldn''t have been much difference between it and the explosion. Well, it took a lot of hard work to be able to build a jutsu formula at this level of speed. With the current jutsu, it probably took at least enough in the beginning. Moreover, if he had to improvise and think about it like he does now, he would have needed more time. ''''As expected of a master!It''s too much!I never thought I''d melt mithril away! Kite runs up to me. ''That should be a pass for now. ''Of course!I''ll pass the test in a minute too, so just wait and see! No, I''m not going to wait. I just want to go to the next test. Huh? 45-Episode 11: Isnt this a complaint? After I passed the entrance exam for the red academy, I came to the blue academy. It was a school for learning and studying magic related to water, ice and cold air. ''''Looks like this is the exam room.'''' Even though they were the same Magic Master, it was generally said that red magic skills were more likely to be expressed by men, while blue magic skills were more likely to be expressed by women. In fact, the venue earlier was dominated by boys, but the majority of the audience here was girls. ''''Huh?Why are you here? I turned around when I was approached and saw the girl I had just left. As I recall, Kufa or something like that? I''m here to take the test. ...Yes? She raised her eyebrows dubiously. ''''Because didn''t you and Kite go to take the Red Academy exam together? I got in. I got in, and I got in. That''s why I''m here next. ''I''m sorry, I don''t know what any of this means...'' Hmm. Apparently, it''s not common to take multiple exams at the same time. ''''Apart from that, there''s no rule that says you can''t attend more than one institute, right? ''What, wait, you don''t think you''re going to go to the academy over here too...?I mean, can you even use blue magic? Sort of. ''Of course I don''t have the skills,'' he said. But I wouldn''t recommend it. As you know, the "wrong color" magic has completely different magic letters and grammar, and if you try to learn them all at the same time, you''ll get confused. It''s difficult to master even one color of magic, so you need to focus on just one. Indeed, at first glance, the letters and grammar seem as if they are different in color. But if you understand it more deeply, the principles that flow underneath them aren''t that different. With a skeptical Koofa behind me, I finish the reception just as I did earlier. I was surprised by the fact that I was unemployed again, but it seemed that they would still let me take the exam. The content of the exam was similar to that of the Red Academy. However, there are multiple targets here - forty, and each one is small. I see. So you want to see control and continuous firing speed rather than power? In terms of the nature of magic, red magic is still inferior in terms of power. Hence, blue magic often compensates for its weaknesses by placing more emphasis on its hit power and number of moves. ''''Waterball!'''' One girl was just in the middle of an examination. She created a series of fist-sized chunks of water and hit the targets. She missed several times, but managed to hit all the targets in about fifty seconds. ''Examination number eighteen, you have passed. Apparently, it''ll pass. Apparently, you can pass in under a minute. Mine was 30 seconds. Koofa tells me with a bit of pride. She has already completed the exam and seems to have passed it successfully. ''''So, are you really going to take it?'''' Of course. Well, if you say so, I won''t stop you, but... He seems to have a surprisingly meddlesome personality and seems to be worried about me. Eventually, my turn comes around. ''Huh?Unemployed?Wait a minute. You''re disqualified for professional misrepresentation, aren''t you? But then the examiner blamed me for my profession. She was in her mid-20s. She has a high and proud face, and I inwardly let out a sigh of relief that I''m about to get into some trouble. Well, you shouldn''t judge a person by their face alone. ''''It''s not a fraud. I''m definitely an "unemployed". If that''s true, then you don''t deserve to take the test. Hmm?I''ve heard that anyone can do it, just take the test? Even if that''s the case in principle, I would normally refrain from doing so. I''m working as an examiner in my own time, and I don''t want to waste my time. We don''t want you to waste your time. ''I don''t think we''re wasting our time arguing like this in the first place. That''s why I''m asking you to get out of there. I''ll call the next number of candidates in a minute. She''s a very impatient woman. Ten seconds, and then it''s over. "Ice Edge I made forty ice blades appear at the same time. Of course, the same as the number of targets. I''m not sure how many of them are at once........And it''s ice... As the female examiner gasped, I shot at the target at once. Zugagaagaagaaga! Forty ice cubes hit the forty targets almost simultaneously. The sharp blades pierced the targets. ''''........Hmm. About six of them have deviated from the center. I still have some accuracy issues, but this should have cleared the test for now. They said the passing line was one minute, but it probably took less than ten seconds. Come to think of it, there was no need to break the target this time. I didn''t have to go to the trouble of freezing the water. I said, "You''re not going to complain about this, are you? I looked at the examiner with a face like this. But the examiner was just shaking his body with a rut and didn''t say anything about passing or failing. But there is no such thing as a failure at this point. I''m going to leave the exam room, passing by the side of a beaming Koofa. I still have four more exams to take. If you work hard, you might be able to finish them all today. 46-Episode 12: Was there such a scary condition? Hey, wait a minute! As they were leaving the hall, Kufa came running after them. ''''Ah!Master!I''ve been looking for you! Furthermore, Kite appears from the direction of travel. "What the hell is going on?How can you even use such powerful blue magic! What do you mean by that?He said he''s going to take the entrance exams at other colleges! I don''t want them to talk to me at the same time. Well, fortunately I can answer both of their questions with a single word. ''''It''s because I can use both red magic and blue magic. Kite peeled his eyes away. ''What?Master, you can use blue magic as well! Kufa yells at him from the side. ''It''s not like I can use it!'' Then she turned to me. Hey, you definitely need to focus on blue magic! What?What the hell are you talking about? The one who raised his voice was Kite this time. ''''Your master is the one who can take the top spot in the world of red magic!I don''t have time for blue magic!I just melted my mithril with Irrationality! ''What does it matter?I just fired forty rounds of Ice Edge''s ice blade at the same time and hit the target all at the same time!And I can''t believe you went through Mithril!For all intents and purposes, blue magic is more awesome!You didn''t see that!It''s not too bad! "You''re not looking at me!I just got here!I mean, I''m going to give that line right back to you, who couldn''t see your master''s red magic!You''re the one who''s disappointed! Hey, don''t start a fight here. ''''Red magic users are all firepower idiots who think they just need to increase their power!There''s better strategic and artistic blue magic out there! "Don''t you dare mock red magic!I mean, you''re just too low in killing power and can only do a mish-mash of damage, what''s strategic about it!Don''t make me laugh! Ice magic can kill more than red magic! Don''t give me ice magic that''s rarely used just because it takes a long time to activate it! ........And more arguments about the superiority of red magic and blue magic have begun. This argument is one that won''t end anytime soon. I left them alone and decided to head to the next exam room. The closest place seems to be the Green Academy. ''''Hm?That was.... As I was about to enter the hall, I spotted a figure cowering in the shadows of the school building. I tried to get closer. It''s not possible for me to do this after all. .........But........if things continue as they are, I''ll have to return home alone....... ...I don''t want to do that... What are you doing? What? I called out to her from behind, and she looked back at me with a jolt, bouncing her shoulders. It was Colette, the girl who came to this city with Kite and Kufa. Come to think of it, did I mention that I was going to take an exam for the Green Academy? ''''Oh, that...?Oh, Arel-san, why are you here...? I''m here to take the test. "Huh? Colette rolls her eyes. But again, it''s a pain to explain from scratch. ''It doesn''t matter, what are you doing here?What happened to the test? Well, uh....well, actually, I mean... If you ask him, he''s afraid to take the test, and he hasn''t even registered for it yet. But to be afraid of the exam? How hard is the entrance examination at the Green Academy that students are hesitant to take it? They must be more selective than the red school and blue school. It''s a good thing that you''re not the type of person who gets nervous in the past, or else you would be completely lost.... Oh, Arel-san, that........how do you handle yourself when you are nervous or something.......? Colette asks fearfully. Hmm. Tension, huh? It''s certainly a word we use every day, but.... I''ve never had that tension in my life. ''What?No?! Is it really so surprising? ''Come to think of it, I don''t think I really know what a state of tension is in the first place. ''There''s a start?.........or I''m in a state where my body is trembling and I can''t think about anything....... Does your body shake on its own, or can''t think about anything else? That''s a terrible abnormality. ''Can''t a blessing fix it?Or white magic. It''s not like they''re injured or sick, so it won''t work... Oh dear. I didn''t know there was such a scary state abnormality in the world.... ''How do you fall into that catatonic state of affairs? A catastrophe...?Um... well, I think it''s probably because of the fear that I might fail... Hmmm...? Can I ask you one question? Yes, yes...? ''Maybe you''ve never failed in your life?'' ? My question may have been unexpected, but Colette was taken aback. No, I''m the one who''s surprised. If you are trying to avoid making mistakes, then you have never made a mistake, have you? In fact, this girl might actually have an extraordinary ability hidden behind her appearance. ''''No, no, no!It''s not possible!In fact, my life is full of failures, and that''s why I''m afraid! ...? What is it? It''s as if we''re not talking to each other. ''What do you mean?If you''re going to keep failing, why do you try to avoid failure so much? ...What, what, what? I said the obvious to Colette, who had a puzzled expression on her face. ''If you''ve experienced it enough times, you''d know that failure is nothing special...'' 47-Episode 13 What a simple test ''Yea, if you ask me, that''s certainly true...'' At my words, Colette looks like she''s huffing and puffing. ''''Of course, if the result of failing is to die as a result of failing, then it would certainly be desperate. .........Could it be that the entrance exam here is death if you fail......? If that''s the case, you''d have to really hope for it. ''No, I don''t! Oh, man. No? Why is it a bit of a shame that you''re not...?I don''t want to risk my life for a test.... The test so far hadn''t been as taut as it could have been, and I thought that was about right. ''Even if I died, that would be the time, wouldn''t it? Isn''t that a bit excessive, don''t you think? Colette exclaimed and then let out a breath with a slightly sunny face for some reason. ''''.........Talking to Arel-san, I started to feel ridiculous for being so nervous at the level of an entrance exam.......'''' Then he brought his clenched fists in front of his face and muttered a spirited, "Okay, Thank you very much. I think I''ll be able to do my best! Then he ran to the venue. ''Hmm. I''m not sure, but it looks like we''ve solved the problem for now. I''d better get a move on. I''ve got four more exams to go. It''s a bit more modest than red and blue magic, but it''s very useful for farmers and sailors. It''s not as simple as red or blue magic, but it''s a useful spell for farmers and sailors, so the demand for it is high. I''m sure that''s why there were as many examiners in the exam room as there were red and blue. ''Mm. It looks like it''s Collette''s turn next. She stands in place and shouts. ''Willwind!'' The wind has rolled in. The wind pressure caused a four-wheeler with sails like a sailing ship to move slowly. ''It''s passed,'' Yeah, yay! Apparently, all you have to do is to be able to move that four-wheeler. ......................What a simple test! I thought it would be a reasonably difficult test from Collette''s appearance, but that was not the case at all. No, maybe that four-wheeled vehicle is made of steel and is extremely heavy. ........Yeah, I''m sure it is. I have a feeling that it wasn''t much of a breeze that she woke up, but it was probably just my imagination. Colette noticed that I was looking at her and ran over to me. ''Thank you!Thanks to Mr. Arrell, I was able to pass the test! Yeah. Good for you. Yes! After a while, my turn comes around. ''Huh?Are you going to take the exam, Arel-san...? Didn''t I just tell you that? I stand in place with an astonished Colette at my back. Well. If that four-wheeler is made of steel, it should be this powerful. Tornado. The laterally generated wind vortex headed in a straight line to the four-wheeled vehicle-- Zugong! --I blew it to pieces of wood. I was leaving the examination room of the Green Academy and was about to head to the next room when Colette came running after me. I''m not sure if it''s a good idea, but I think it''s a good idea.How can you even use such a powerful green magic...? And then Kite and Kufa came along. Oh, there she is!Hey!Why are you going off on your own! That''s right, Master!Please don''t leave me! That''s probably because you guys have been arguing for a long time. ''''To Kaito-kun, Koofa-chan........?Why are you here... With Colette rolling her eyes behind her, Kite and Kufa crowded me. ''So, in the end, which one do you choose, Master!Of course, it''s red magic, isn''t it! ''No, you don''t!It has to be blue magic! So I''m not going to choose one over the other. Naturally, I''m going to master both of them. ''''What are you saying?! That''s when Colette suddenly shouted. "? I didn''t expect her to raise her voice, and Kite and Kufa were stunned. Then Colette pointed at me and said. ''''For all intents and purposes, Arel-san''s choice is green magic.......! ........This is going to be even more troublesome again. That premonition soon came true, and the three of them began to argue with each other. ''You''re the one who''s talking, Colette!Green magic is even more humble than blue magic, it''s not worthy of a master! ''''Hey, blue magic isn''t plain at all, unlike green magic!It''s rather elegant and graceful artistic magic! Don''t treat me like I''m a simpleton!How useful do you think green magic is to people........!If it weren''t for the green magic in our village, we wouldn''t have a bad harvest and no one would be able to eat a full meal! It had devolved into a three-way race. Naturally, I left them alone and headed to the next exam room. After that, I had come to the last black academy after I had passed the exams of the yellow academy and the white academy. ''''This is quite a stagnant place again, isn''t it?'''' Unlike the other academies, the entire campus seemed to be covered in an eerie darkness. Even though it was only daylight, it was dim as if it was twilight. ''''It''s almost abandoned.'''' The school buildings were all old, with cracks in the stone walls, covered in vine grass, and broken windows. They may not have been cared for at all, or there were weeds growing here and there, and some mysterious items were left everywhere. Black magic deals with dangerous magic such as darkness, death, or curses. It might be said that it is exactly the right atmosphere for it. ''''Hm?But I don''t see what looks like an exam room anywhere? 48-Episode 14: It suddenly appeared from above, so I cut it off reflexively For now, I walked into the black academy building. The inside of the building is dark and dreary and looks like a ruin. And I haven''t seen anyone at all. In the first place, I haven''t seen a single person since I entered the premises. This school may have already gone out of business. Well, it seems that black magic is not a very popular magic. There are many dangerous things, and some countries and cities have even designated it as forbidden. I''m not sure if this magical city is an exception. As a result, there was a possibility that the school had been closed down due to the loss of students. ''''Gee Gee Gee Gee! .........Hmm. Right now, a mysterious creature passed by in front of me, screaming in a mysterious way. To put it simply, its body was like a monkey, its head was like a lizard, and it had insect-like wing wings on its back. ........Is it a demon? I had never seen or heard of him before, though. ''Noaaaaaaaaaaaah!'' Immediately after, a high-pitched scream could be heard from a nearby room. The door opened with a tremendous force and a suspicious-looking woman jumped out from inside. The woman was thin as wire, as if she hadn''t eaten enough. She has a pale face, and there are terrible circles under her eyes. When she spotted me, she ran up to me, shaking out her shaggy hair. ''Hey!Where''s Goo!I don''t know my goo-chan! Her wide open eyes were bloodshot and red. Surprisingly, she was still young and reasonably pretty, but I understood in an instant that she was a badass woman anyway. I don''t know what a goo-chan is, but I respond with a single-minded desire not to get involved with a woman like this. ''I don''t know,'' ''You''re lying!My goochie didn''t pass!I ran out of the room when I was out of sight for a second! .........Could it be that the goo-chan is the mysterious creature from earlier? ''Oh, Goo-chan, where have you gone!Please!Come back to your mom! I wanted to leave the place as soon as possible, but if this Goo-chan was the mysterious creature I mentioned earlier, I could see where it had gone. It hasn''t been that long yet, and if I look for it, I''m sure I''ll find it soon enough. To be honest, I''d like to leave it alone, but I feel like leaving this dangerous woman alone like this is a bad idea as well.... That goo-chan-- ''Who allowed you to call her Goo-chan?I''m the only one who can call you Goo-chan! It''s so annoying. ''Could it be the mysterious creature with the head of a lizard, the body of an ape and the wings of an insect? Yes, yes!I knew you knew about Goo-chan! That''s where they went. ''Goo-cha-ha! When I pointed at her, the woman ran in that direction at a terrific pace. Soon, she will return holding the mysterious creature from earlier. ''Oh, my goodness, just now. You''ve saved my life. Well that''s good to hear. She thanked me. Maybe it''s because I''ve regained my composure after the discovery of the mystery creature, but I think I''m somewhat sane now-- She''s a chimera that I worked very hard to make. Isn''t she very pretty? ''Geeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee! "Mum, I''ll never let you go again, Guu-chan! ''Geeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee! My goodness, are you really that happy? You are so happy to see your mother again? --I take back my previous statement, it wasn''t sane at all. The woman was happily rubbing her own cheek against the lizard''s head, but the mysterious creature only seemed to be desperately trying to escape. ........This creature, was it a chimera? Come to think of it, there is a magic in black magic that can create such synthetic creatures. I wasn''t interested in it, so I didn''t learn it. Perhaps she is studying it. I don''t know, this academy is properly staffed. But the first person from the academy I met was this..... Afterwards, when I asked her about the entrance exam, she told me she didn''t know much about it. But in the meantime, I was able to get her to show me the location of the office. I would find out if I asked there. The courtyard with its black haze and the constant "eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee! I walked down the corridor, where the sound of laughter and strange noises kept echoing, and in front of the bathroom, where I could hear people saying "come on~, come on~" from inside. ''Hm?I don''t have anyone there. I walked into the office, but there was only a row of battered wooden desks in the office. But somehow, there''s a hint of something. Is this.........up? Immediately after, a skeleton fell upside down from overhead. ''''Welcome!'''' I quickly pulled out my hidden dagger and cut off the skeleton''s head as soon as I could. ''''Gyaaah!'''' The skull flies through the air and falls to the floor, rolling over in a heap. The body is left hanging from the ceiling. ''Hmm. Undead. That''s probably why I barely felt a sign of it until just before. But still, how could he make his voice heard if he had no vocal cords? What the hell are you doing? The skull that had stopped me from crashing into the wall turned to me and shouted accusations. ''It suddenly appeared from above and I reflexively slashed at it. ''I was just trying to scare you a little bit, but you''re terrible! I guess that''s what they deserve. But for now, it doesn''t seem to be a bad undead, so let''s just listen to what he has to say. 49-Episode 15: I ask for everything at my own risk I can''t use it because my dad didn''t tell me, but I heard that there is also a so-called necromancy magic that controls the dead among the black magic. Probably the skeletal undead in front of me was created by someone in this academy. As he said it, the skeleton fitted its skull into the top of its neck. The skull is shaken from side to side and a jogging sound is made. It seems to have attached itself. ''Is it a lady?'' For all intents and purposes, she''s not a lady! For all intents and purposes, it''s just a skeleton. It''s strange, though. Where are the voices coming from? Of course, there should be no vocal chords. I stare at the skeleton and observe it closely. Then the skeleton wiggles and shakes its body. I''m going to have to say that I''m pretty, but if you stare at me that much, I''m going to be embarrassed.Both legs were cut off!What are you doing? The movement was uncomfortable. The skeleton stuck its femur together and stood up. ''''........you''re pretty unforgiving with your pretty face.......ugh, but maybe that''s a good part of it...........................buuuut! This time I cut the skull in half vertically. ''Hey, why?What do you have against me? ''Hmm. You can still have a voice in that state? Interesting. Couldn''t you have experimented on a skeleton you''ve never met before? The skeleton screamed and pushed the cracked skull from both sides. In the blink of an eye, the severed surface disappeared cleanly. ''Could it be that something close to a blessing is at work?...Why don''t you remove some of the bones? Stop it already! Oops. Come to think of it, I didn''t come here to do this. ''''I heard that this is the academy''s office. Yeah, that''s right. I''m Lataria. I''m a beautiful office girl. Could it be that these skeletons can''t look in the mirror? Don''t you have any other clerks? I''m sorry, but I''m the only one here. There are only a few teachers and students at this school. But it''s also because I work so fast that I can do it all by myself. The building and the equipment are falling apart for it. We''re broke, you know. You don''t even seem to have cleaned up. A frail lady can''t do that kind of hard work. Lady or not, she certainly looks impotent. There''s no muscle. Only bones. If you ask me, I heard that she is being used by the head of this academy. Perhaps they don''t have the money to hire someone. ''''Really, he''s the worst employer ever!He''s got a lot of bone in his hands.And the pay is low!And on top of that, I haven''t even met a nice guy! I was rather surprised that I was getting paid properly. I was surprised that I was being paid well.He flickers. A guy who is going to fall in love with me and who has a little bit of a little bit of s*x appeal would make me feel a little bit better about myself. I think I''d like.... a glimpse. For some reason, Latalia talks about her desires while looking at me repeatedly, but she''s a skeleton, and I''m sure her preferred partner is a skeleton. But what kind of skeletal hottie is a skeleton? I wondered about it, but since I wasn''t interested in it, I decided to quickly ask about the entrance exam. There''s no exam, okay? What?So you''re not recruiting students then? We''re not recruiting, that''s for sure. But we''re not limiting admission. Skeletons--Lataria says that apparently this academy doesn''t have an entrance exam and anyone who wants to enter can enter. ''''In the first place, there are hardly any kids who want to learn black magic, and I''d rather ask them to enter the school. I''ve heard about you, but you''re not that popular. And all the students who came here ran away when they saw me. Maybe it''s because he''s upside down on the ceiling. Well, if you''re going to run away from it like that, you won''t be able to make it in this academy. Anyway, if you want to enroll in the school, you''re welcome to do so. They don''t have any procedures or anything. It''s quite appropriate. They don''t even have lectures. But you can use the facilities of the school freely. It''s all in shambles. It''s a very good idea to have a good idea of what you''re looking for. Sometimes there are dangerous grimoires hidden in the library, so please be careful about that. Be careful about that, because you could be cursed or dragged into the other world if you''re not careful. Naturally, I ask that you take full responsibility for anything that happens to you. They say there are many other dangerous spots in the academy. I heard that a student''s strange corpse is often found. ''By the way, on the way here, I heard voices coming from the bathroom, what was that? I was about to go into the bathroom, but I had a bad feeling about it, so I decided not to. ''You''re Mary from the bathroom, aren''t you? You''re my friend. Don''t worry, though, he''s a good ghost. She''s a good ghost. Sometimes she''ll give you a little tantrum in your ass as a prank. Hmm. If I learn necromancy, I''ll be the first to purify it. It''s a pain in the ass to use the bathroom outside the academy. You can use the extra room in the dormitory if you need it. See, you can see it over there? Looking in the direction that Lataria was pointing in, I saw, among other things, a building that looked like an aged ghost house. ........It looks like we''d better use the dormitories of the other academy. 50-Episode 16: I passed the exam properly ''Master!I''ve been looking for you! You''re not going anywhere!I''m not done talking to you yet! Yeah, that''s right! We left the black academy, and now, just as we were wondering what to do now, the trio found us again. ''''It''s red magic, isn''t it! It''s blue magic! It''s green magic! You''re still having that pointless discussion. I say, letting out a sigh. ''I''m not going to choose any of them. I''m going to attend all the academies from the start, too. The three of them looked away. ''''Seriously, that''s a crazy idea, isn''t it? Yes!I can''t believe you''re going to three different schools all by yourself... ''It''s not even the first time someone tries to learn two magics...? Hmm. Apparently they think there are only three. ''''Not true. I''m going to enroll in all six academies: red, blue, green, yellow, white, and black.'''' "...what? I''ve passed all six exams. To be exact, though, there were no exams at the Black Academy. ''''Yeah!'''' The various admission procedures have been completed. I guess it''s because each school is independent, but I didn''t hear anything from anyone about being enrolled in more than one school at the same time. I was issued a student ID card from all six, and it was probably not a problem. Although there are some differences between the academies, it seems that all of them are basically divided into three classes (grades). First Grade: the practical skills training and mastery of advanced magic, while the classroom lessons are aimed at mastering the basics of magical techniques. Second Grade: Students enter a laboratory led by a professor to study, train, and research in their area of expertise. Top Grade: Future professorial candidates are given a laboratory to study freely. Of course, all newly enrolled students are in the first grade. By the way, the course lasts for two years, and depending on the grades, students can either repeat the year or skip a grade. I''m sure you''ll be able to find a way to make it work. You''re going to miss your lectures. That''s right, Master!That''s why I said you can''t have six at the same time! I was immediately faced with a big problem. I had to take my lectures at the different institutes at the same time. Naturally, I only have one body, so I can''t attend them all at the same time. But your attendance score is not that high. It seems that as long as you get a high score on your exams, you won''t need to go to class. No, no, you can''t take an exam without going to class, right? ''Don''t worry. As for the content of the lecture, just ask someone to show you their notes. Fortunately, three of them can be guessed. Of course, they are Kite, Koofa and Colette. And since the Black Academy doesn''t have classes itself in the first place, there are only two left. ''''........Well, well, I''ll do that for my master, but.......'''' At any rate, I was going to attend a lecture at the Red Academy today. When I entered the lecture room, I saw a face I had seen somewhere. ''''Wha........you are........'''' Who was it again? He''s staring at me like crazy, but I can''t remember a bit. Well, I don''t care who it is. It doesn''t seem to do any real harm. I go through in front of him and head to the back seat. ''Oi!Don''t ignore me! Hmm? Apparently he wanted me to talk to him. ''Oh, you''re the loser from the exam, aren''t you?'' ''And that''s where Kite, who came into the lecture room late, pointed at him and said. ''Duh, who''s a loser!I have never been defeated by you! You''re losing to your master. Hmm. I just remembered. As I recall, the boy who cried because he couldn''t destroy his mithril doll on his entrance exam. I''m not crying!I know. And that was some kind of mistake!There is no way that a mere "sorcerer" can do what I, a [senior-level] "mage", cannot do! Apparently, he thinks I''m a [Basic Job] "Magician" without permission. ''''I''m not a [Magus]. I knew it. No wonder I thought it was strange. I''m sure they''re all new students, but that''s their age. It''s not strange for a "mage" to be... No, not even a mage. What?If that''s the case, then it can''t be the Magus King?No, no, but I''ve never heard of a Magic King other than the dean of this city, and....... Mage King is the Highest Position. While the students who heard those words were looking at me like "no way.......", I told them. I''m not even the "Magus King". I''m just an "unemployed". ...What? Just then, a man who appeared to be a lecturer walked into the lecture room. He looked around the buzzing lecture room a little curiously, and then Well, we''ll start class now. He tried to start the first lecture as if nothing had happened. ''Wait a minute!'' The one who interrupted that was the boy who just came in. Are you sure about what you just said?No, it can''t be true!I can''t believe your profession is Unemployed... It''s true. ''Don''t lie to me!How can an "unemployed" person be able to use magic! As the boy and I were arguing, the instructor interrupted us. ''Lois. What he''s saying is true. It surprised me too, but it''s been confirmed by the official certificate. Apparently the boy is named Lois. I mean, this instructor, if you look closely, is the examiner who was overseeing the entrance exam. ''''Oh, that''s ridiculous........oh, it''s impossible.......'''' ''I agree. But I believe that perhaps for some reason, I just haven''t been able to make a correct appraisal. From the magic he showed during that test, he is actually a "mage". Obviously, he has the skill of the [Red Magic, Advanced]. I see... .........Hmm. I guess that''s one way to think about it. But I don''t have any advanced red magic skills. I''ve always been building magic on my own. 51-Episode 17: I think its easy to remember Anyway, class has begun. .........Hmm. I''m not sure I''m going to be able to find the right one. Magic letters are the most basic of basics. The combination of these letters makes a word, and the combination of words makes a jutsu, so it''s only natural that a wizard should already have it perfectly in his or her head. But the explanation that followed convinced me. ''Many of you may not have a firm grasp of magic letters and grammar. It''s a good thing that you''re able to use magic even if you don''t know it, because thanks to your skills, you can use magic even if you don''t know it. But to be able to use more advanced magic, you''ll need a deeper understanding of these things. Come to think of it, that''s right. It was different from me, who had to create a magic formula from scratch. Well, but it''s not very difficult. You just have to learn it. Of course it''s not easy to learn. Of course it''s not easy to remember, after all, there are more than a hundred magic letters in total. I think I learned almost everything on my first day, I think. I looked around lightly. Most of the students were staring at the magic letters written on the blackboard with a difficult look on their faces. The same goes for Kite, who sits next to me. ''''Ugh, I have to remember so many of them...'''' No, it''s just magic letters. There are over a thousand words that can be created by combining magic letters. By the way, the magic letters, words and grammar are different for each type of magic. So you can''t use red magic magic letters in blue magic. And as a matter of fact, red magic was relatively easy to use the magic formula. The hardest one is the black magic. After all, there are three types of magic letters. The difficulty of this magic formula may be one of the reasons why black magic is not popular. The blue magic class was similar. We started out with the rudimentary magic letters. Red magic was an ideographic character where each letter had a meaning, but blue magic is a phonetic character. Therefore, the number of magic letters was small, but the number of words made from that combination was far greater than red magic. ''''Hey, are you really going to seriously attend the six academies?Honestly, I think it''s a lot to ask for just one thing... And it''s Kufa who worries me. ''''Well, I can at least show him the notes but...'''' Thank God. It''s going to be a while, though, and I don''t think I''ll need it, because it''s going to continue to be what we''ve studied for a while. The green magic class was with Colette. ''''Whew.......I can''t remember this much.......'''' She was struggling to learn the magic letters too. The red and blue academy didn''t have anything noteworthy in terms of practical skills classes, but the green academy had a slightly more interesting class for me. It was a class on flight magic. The three main employment opportunities for green wizards are farmers, sailors, and the transportation industry. It''s a good idea to have a good idea of what you''re looking for in a new product. It is ideal for transporting letters and light goods, as it is much faster and safer than traveling on the ground. Even if you don''t do that kind of work, being able to fly would be useful in many ways. I was a complete novice when it came to flying magic. I don''t even know how to set up a magic formula. I don''t know if you thought I didn''t need it, but Dad, you never taught me. No, okay, Dad, I guess I''m afraid of heights so... well, I couldn''t teach you because I can''t use it myself. ''First, imagine your body being lifted up by an updraft. If you spread your arms out wide on either side, like the wings of a bird, I think you''ll be able to visualize it better. And the instructor instructs us that this is for skillful people. This is because if you have the skills, you will naturally draw the necessary techniques in your brain through a strong image of the phenomenon you want to cause. In fact, there are a number of students whose bodies have floated in the air just by doing so. "Wow........that''s amazing.......I really can fly......I mean, what the heck? Colette lost her balance in the air and fell, falling and falling on her buttocks to the ground. Perhaps because the way she was doing so was hilarious, she could hear laughter from the surroundings. Colette blushed with embarrassment. But despite her failures, she''ll get better at it if she keeps practicing. On the other hand, I''m not as good as them. I don''t have any skills, and I don''t have any magic formula when I imagine it. "Hmm. The upswing. In that case, I''ll have to make the formula like this....No, I need to make it a little weaker or it''ll blow up. .........is this how it should be? I set up my own magic formula and activated it. ''Okay, this--! Immediately after my body floated up, there must have been a misalignment with my center of gravity, the updraft turned into a force for rotation, and I was upside down at a terrific rate. I hit the ground from my head. ''''I see. That''s a mistake.'''' Thanks to the blessing, it doesn''t hurt at all, but I''ll reflect on it while I''m upside down. It looks like it would be better to not only create an airflow upward, but also to create an airflow that goes inward from all sides at the same time in a way that supports the body to keep it firmly balanced. ''''Hahahaha!What the hell was that?You want to see it?I mean, that ass-cracker was terrible, but I''ve never seen a guy make a mistake like that before! There was a loud laugh. While putting my body back together, I turned my gaze in the direction of the voice. A small boy was holding his belly laughing. It''s a good thing I''m not the only one. It''s the first time I''ve ever done this, but they all suck so badly at it. Okay, I''ll show you how it''s done. The boy said and used his flying magic, even though no one asked him to do so. The small body jumped up into the sky and then swam smoothly through the air. And even decided to do a somersault. Hmm. I''m pretty good at this, considering how confident I am. After flying through the air for a moment, the boy came down with a triumphant look on his face. How do you like it?No one can beat me in flight magic.I''m going to win the race! ...race? 52-Episode 18 Killing You and I Die It seems that the Green Academy regularly holds a "race" for the purpose of testing your proficiency in flying magic. They are said to compete to fly around a specific course in the sky and compete for speed until they reach the goal. The first race is in two months, but anyone can participate, even first-year students, as long as they can fly properly. We''re looking for participants now, so if you want to join us, please come to my lab. My advisor tells me more about it, because it was just brought up. He says that the race is not only for first grade students, but also for second grade students. I''m told it''s unlikely they''ll win the race in their first year. ''''I''ve been practicing only flying magic ever since I became a ''sorcerer''!We''re going to win it! The boy from earlier declared proudly. ''Sounds interesting. I''ll join the race. I can''t fly yet, though. ''Hahaha!Didn''t you listen to what I just said?You''ve got to be able to fly at least decently to participate! Two months is enough time for you to get out of here. "Hey, guys, don''t underestimate flight magic, okay?It''s not that hard to just float, but then it''s the hard part!It took me six months to get there, too! They were arguing, and as the instructor interceded. Well, well, don''t be afraid to apply, even if you''re a beginner. It''s easier to improve if you have a goal in mind, and if it''s too difficult, you can cancel right before. Huang''s classes at the Academy were similar to the others. It looks like they won''t need someone to show them their notes for a while. Yellow magic is largely divided into earth magic and alchemy magic. It''s a little complicated, but even though it calls itself "earth", earth magic deals with metal. The walls that surround towns and villages to prevent monsters from entering are made with earth magic, and bridges over rivers are also made with earth magic. However, unlike blue magic to create water from scratch, earth magic uses the soil and metal that exists there, so materials were needed. In contrast, alchemy magic is a magic that uses commonplace metals to create valuable metals. Research on what kind of metal could be turned into a precious metal by using what kind of material and what kind of technical treatment was used to turn it into a precious metal was being conducted day and night here at the Huang''s Academy. Many of them find employment in the blacksmithing workshop after graduation. It is said that at the first grade, they learn both earth and alchemy magic, but if they reach the second grade, they will specialize in one of them. ........I want to make a golem, which one should I specialize in? Incidentally, the yellow academy had a higher percentage of male students after the red academy. It''s probably not popular with the girls because of its simple impression. Then there was the white academy. This also seems to be a very elementary class at first. In contrast to the yellow academy, the percentage of girls is higher than the blue academy, and there''s only one guy besides me taking the same class. Since I can''t attend every time, he seems to be the only one when I''m not there, and he tearfully complained to me, "You should take the class properly~". The three major magic in white magic are the following three. Light magic. Body strengthening magic. Healing magic. Light magic, as the name implies, is a magic that generates light. It can also be used as a light, but this light has the power to purify dirt and other substances, so it can replace polluted water with drinkable water and cleanse the body. It also works on undead monsters. Body strengthening magic is also just as the name implies. It''s a spell that temporarily raises muscle strength, stamina, and agility abilities. Of course, you can use it on yourself, but most rearguard jobs, such as wizards, are physically weak to begin with, so the amount of damage it can do is limited. Therefore, the most effective thing to do was to apply it to the vanguard position. Its effectiveness was so great that many famous adventurer parties had joined a white magic user. And light magic is also useful for adventuring in some way. As for healing magic, there are few situations where it is needed due to the presence of blessings. The only thing you''ll need it for is first aid when your blessings run out. Some white wizards become veterinarians because they can use it on animals that don''t have any protection. The demand for vets, such as treating injured carriage horses, is reasonably high. The classes themselves do not exist in the black academy. Things like First Grade and Second Grade seem to be vague, and they are completely left alone from the start. But for me, it''s rather easy because I don''t have to listen to too easy lessons. I''m going to study as I please. You can use the facilities of the school freely according to the skeleton in the office. The school building has a lot of empty rooms, and I decided to look for a suitable room because it is okay to use it as a laboratory. It would be nice to be as far away as possible from the toilet with voices coming from inside and the room of the woman making the chimera. ''Hmm. This place looks empty. I find a room that doesn''t look like anyone is using it, open the door and check inside. ''''Die, die, die, die, die, die....'''' "I kill you and I die. The world is about to end. -- A large amount of curse-like words were scrawled on the wall, the wall of the room, in bright red letters. ''''.........I guess we''d better not be in this room. I close it gently and head to the next room. This one looks good. Eventually I found a room in the corner of the second floor. The floor is covered in dust and there are some cobwebs on the ceiling, but it looks like it''s working fine. There are sofas, bookcases and such, as if they were left behind by previous users. For now, we''ve assessed our base of operations at the academy, but cleaning will have to wait. We''ll need cleaning equipment. Do we have any in the academy? Then I made my way to the library that skeleton had told me about. ''This is great...'' Once inside, you can''t help but be overwhelmed by the number of books in the library. At a glance, it''s hard to tell how many books they have in their collection, but there must be tens of thousands of them. Perhaps someone has been cleaning the library, but it was surprisingly clean. "Let''s start from the right end for now. You''re free to read them all, so let''s read them all. 53-Episode 19 I have watched I saw it..... It was in the middle of the night last night. I felt the urge to urinate, and I woke up. Currently, I live in the dormitory of the Green Academy. It''s a new building that was recently rebuilt, but the building of this dormitory is very old and it''s very depressing even in the daytime. The bathroom is so scary that even in the daytime I hesitate to go in there. So I always use the restroom in the school building. But as expected, I cannot go to the school building in the middle of the night. I decided to go to the bathroom of the dormitory. Even in the corridor on the way there, there was an air of "I''m going to come out" and I was scared to death. I prayed desperately in my heart that nothing would come out. But as if to mock me. Suddenly, the windows in the corridor began to rattle. I let out a shameful scream, and at the same time, I almost pissed out the bottom part of my body. And yet somehow I manage to endure it. As a maiden, I must avoid that at all costs. That was probably the work of the wind. I tell myself that. And then I turn my gaze out of the window, afraid to look out of the window, when I should have stopped. I saw it. A shadow in the sky in the hazy moonlight.... ''Hi, hi, hi, hi! When I remembered that moment, I screamed and squatted down on the spot. As I held my head in my hands, a mocking voice called out to me, "What, are you still afraid of ghosts, old man? "Ha, you''re too old to be afraid of ghosts, Colette. It''s a good thing that you''re not going to be able to get your hands on any of these things. I''m not going to call you out for that. Why do I have to deal with you in the middle of the night like this? ''''Because... at first I asked Koofa-chan to help me... and then he said he''d let Kaito-kun help me too...'''' When I revealed it, Koofa-chan, another childhood friend of mine, looked a bit flustered and shouted. It''s always better to have a man around for this kind of thing. You''re just as scared of the ghosts as I am of them. What?No, I''m not!I mean, aren''t you the one who''s really scared?Come to think of it, I didn''t even get to go to the bathroom by myself back in the day. Don''t bring up that old story!You''re still a kid! Kaito-kun and Koofa-chan start arguing with each other. These two have been like this for a long time.... They fight all the time, and I was always in the position to intervene. But even when they quarrel, they don''t back off at all, so they may actually be close to each other surprisingly well. But that''s not the point. Last night, I asked them to come all the way to my room. I don''t think I''ll be able to sleep as it is.... After all, I didn''t sleep at all last night after that. "You just misjudged it anyway, didn''t you?Or a dream. Ghosts aren''t something you encounter every day. I''m sure I saw him!And that''s clear! Hmm. So what if it''s real? I''ll take him down! Hey, Colette. Can you take down a ghost? "I don''t know, I don''t... Perhaps you will need to call an expert. In that case, I heard that some black magic users deal with necromancy, so it would be good to go to the black academy. ''''It happened in the dormitory in the first place, shouldn''t you have complained to the academy instead of us? Maybe it''s a mistake. I''ve only been here a short time and I don''t have any friends I can ask to do this for me. ...It''s partly because I''m extremely shy. My two childhood friends are the only ones I can ask for help. By the way, was everything okay in the bathroom then? "...Come on!It''s still a bit early, but let''s go have a look around the dormitory once! ''Ho, I really feel like we''re about to get something...'' Koofa-chan mumbles in a whisper as we continue down the dimly lit corridor. Her voice seems to be trembling a little. The dormitory students seem to be asleep, and there is hardly any noise. Our footsteps echo loudly. And then, right?This doesn''t mean I can''t go to the bathroom at night by myself, does it? I say, hiding behind Koofa-chan, "I''d like to see a toilet in each room. I wish each room would be equipped with a toilet. It''s nothing to worry about. And, for some reason, it is Kite who is following a little later than us. He''s obviously very strong. His cheeks are twitching. Scared, we move forward in the corridor. It''s like a turtle. Before long, we arrive at the place in question. "Hey, there''s nothing in there, man. Kaito-kun says as he looks out the window. It may be because it''s still earlier than yesterday, but indeed, there was only darkness outside the window. ''''Ya, I knew I saw it wrong, I''m sure,'''' That''s when Koofa-chan said, with a look of how she already looked like she was leaving. Rattling! The window suddenly started shaking. Yes, exactly the same thing that happened last night. "Hey, it''s just the wind! Kite refuses in a treacherous voice, but the next moment........we see a mysterious shadow floating in the darkness. A mysterious shadow floating in the darkness. ""And then it came out!" I shouted out loud. The voice reverberated through the narrow corridor in a rambunctious manner. Could it be that I have responded to the voice? A shadow is slowly approaching towards us. "Hey, hey, it''s coming toward me! Wow, I know what I''m talking about!Attack!Attack! "F*ck, f*ck, f*ck.... Whoa! Whoa! Calm down! We are in a panic and try to unleash our attack magic on the approaching ghosts. Just then, we hear a familiar voice from the ghosts: "Hmm? Hmmm?What are you doing in that place? Oh, Mr. Arrell! 54-Episode 20: Separate the personality into two Hmm?What are you doing in that place? Master? As I approached, floating in the air, the trio of Kite, Koofa and Colette were rattling and shaking their bodies, trying to activate their magic. ''''That''s a line over here! ''Yes, that''s right........!What were you doing at this hour...? He asks with a mixture of relief and anger. ''What, as you can see, is flight magic training. As I say it, I bite off a missing piece. He wakes me up so suddenly, I need to sleep. ''Ku, training!At this hour...? It''s not too late, is it? Considering the position of the moon, it''s probably another five or six hours until morning. ''No, no, no, no, the date has already changed! How long do you think you''re gonna do this? In the morning? Don''t tell me you''re going to train without sleeping...? If it was Mr. Arrell yesterday, could it be that every night? They are stunned, and I deny their mistake. ''No, I''m getting a good night''s sleep, too. Seven hours. ''''Well Master, I don''t know what you mean...?'''' They looked like they had several question marks floating around in their heads, and I told them. ''I''m training in my sleep,'' "...what? I''ve always had weak mornings. And I need at least seven hours of sleep every day to be in bad shape. I don''t dislike sleeping, in fact I like it. But I still thought it was a shame not to be able to do something when I was sleeping. That''s why he came up with the idea of "sleep training". Of course, we don''t train to sleep. The idea was to train while you are sleeping. If you can train in your sleep, you can kill two birds with one stone. You''ll be able to use the whole day. ''''So, so you''re saying that Master was training his flying magic in the middle of the night in his sleep...?'''' I''m sorry, I have no idea what you''re talking about, but... Colette, I''m with you... I was recently training in flight magic as a sleep exercise. But a few minutes ago I heard a horrendous scream, and as expected, I woke up. But why are they in this place? Colette is a student of this academy, so it''s not surprising that she''s here, but Kite and Kufa are in a different academy. ''''What have you been doing here?'''' I''m just here to see if you''re a ghost! It seems that Colette mistook me for a ghost when I was floating in the sky at night. I think I saw something much scarier than a ghost......... What the hell, training in your sleep........ How can you do that...? It''s not that hard to get used to, once you get used to it. ''First you have to separate your personalities into two. ''I''ve got a hell of a lot of stuff coming from First Step...'' One personality has to sleep and the other personality has to train. In this way, they can sleep and train at the same time. ''Assuming we can do such a maneuver, does that mean we''re sleeping? Kufa asks in dismay. ''A fair point. I''m tired and I don''t have a problem with it. To begin with, the important part of sleep is the mental part. Even if you stay up all night, if you feel like you had a good night''s sleep, you''ll regain your strength. I don''t know, but that''s a stretch, but... Anyway, this personality separation method is very useful and applicable. ''I can do two actions at the same time, like building up a magic formula in my head and avoiding the enemy''s attacks at the same time. Of course, it also makes it easier for me to activate two magics at the same time. I only came up with this and started practicing it after I returned home from the Sword City to my parents'' house, but thanks to that, I was able to learn the base(s) of the six-color magic(s) in about three years. If not, it would have taken longer. ''''By the way, now, if I wanted to, I could increase my personality up to four if I wanted to,'''' ''Please don''t say something so outrageous again! Kite exclaims with his eyes peeled back. ''The goal is to be able to hold six personalities for an extended period of time, with a master figure as the command center. This would allow us to handle the six magics at the same time and still be able to respond to events happening in the outside world. "......... What? When did the three of you get a masterful look in your eyes? ''''No, even if I can''t reach my master''s level, I''m going to try my best to at least master the magic I''m good at...'''' ''''........Me too. I''m starting to feel like a fool for struggling with just learning a magic formula... ''Well....'' Hmm. I don''t know, but if it''s a motivational boost, good for them. Then the three of them left, biting down on their absent-mindedness. There''s still some time until morning, and I''m sure they intend to take a nap. ''''Well, I''m going to sleep too. But only while training in flight magic. 55-Episode 21: I think I just have to endure "Sir. What''s the matter, Arel? That technique, the third line from the top, is wrong. Hm?........true. How did you notice that? Upon my point, the instructor in charge of the class - a middle-aged man named Bacchus - immediately rewrote the error in the technique. It was a class on red magic. It had been a month since he''d enrolled in the school. But in class, we''re still going through the basics, and it''s too easy for me. Well, I''m barely out of it, and I don''t really care. It was like today, I would come in to take the occasional class to check my progress. It''s a good thing that you''re not going to be able to find a way to get a good deal more than you''d like. ''''In the first place, if it''s this magic, there''s no need to make it so complicated,'''' What?What do you mean? Explaining it verbally would be too much trouble, so I stepped forward. The magic that Bacchus wrote on the blackboard was ten lines and eighty-three characters in total. Incidentally, it was a magic at the upper level of elementary level. I shaved off as much of the unnecessary parts as possible and wrote a simpler formula next to it. It was reduced to just six lines and fifty-one characters. It''s a reduction of about thirty percent. "Don''t tell me that you can activate a magic formula of this length...? Bacchus raised his eyebrows quizzically. He stared at the technique with a difficult face for a while, but eventually nodded with a breath of admiration. ''''I see........indeed......it''s not impossible in principle.......'''' As expected of a lecturer, he''s quick to understand it. The students don''t seem to understand at all and are pouting. In my case, where I don''t get skill assistance, I appreciate the brevity of the techniques. So, after trial and error, I cut down the waste to the extreme. However, there is a risk of magic power outbursts with this. If we take safety into consideration, this technique is still better. The jutsu that Bacchus wrote about is semi-automatically formed by skill assistance. Or rather, that''s basically all of the jutsu that you learn in class. However, all of the techniques taught by skills have a fairly large margin of safety. As Bacchus said, it was meant to prevent the risk of the magic power going out of control if the magic failed to activate. The activation of magic can fail. And if it failed, the magic power that had no place to go would burst. Naturally, the sorcerer is eaten up by it too, but-- "...?You don''t need to worry about that, do you? Because of the Goddess'' blessing. If the blessing is at maximum, even if it goes off, you shouldn''t die. Of course, it depends on the scale of the magic. So I don''t understand why I''m afraid of an outburst at all. It''s a good idea to have a good time with them. ''''Even if you have a blessing, there will be pain...'''' I guess we just have to endure it...? When I said that, Bacchus looked at me like he was seeing something incredible. I glanced at him and saw that the students had the same look on their faces. ''''What?'''' Sure, I hated the pain when I was a child, but now I find it rather comforting. Isn''t that what usually happens when you grow up? For example, bitter foods. You may not be able to eat it as a child, but as an adult you will find it delicious. ''That''s probably just because my teacher is a special kind of person, but...'' Well, most of the students are in their early teens, and maybe they haven''t reached that stage yet. ........Bacchus is an old man, though. ''If you don''t like the pain, you can reduce the power of your outbursts with a little bit of effort. What did you say?How is that even possible? The amount of magic you can put in should be small at first. The damage is far less than using a large amount of magical power at this stage when it''s going to explode. If it doesn''t seem to be a problem, just put enough magic into it. Oh, no, that''s not the way... Apparently they don''t know about it. ''''I''ve known for a long time that you''ve been a freshman away but where in the world did you learn that? My parents'' house. My parents... I mean, I just happened to discover that one through my own trial and error. I don''t usually use it at all, though, because it takes slightly longer to activate. Bacchus often rubbed his beard as if he were thinking about something, but eventually he made this suggestion. ''Arel, why don''t you take the advancement exam?'' A cramming test? ''Yes. Probably doesn''t make sense for you to be in the First Grade. ''Wasn''t there only one exam a year to advance to a second grade? Yeah. Usually. But only those students who are approved by the instructor are allowed to take a special, timed advancement exam, and if they pass, they can move on to the next grade. I see. I didn''t know we had such a handy system. It''s a wonderful thing. Of course I''ll take it. Okay. Well, I''ll apply for it right away. We could have the test done in a few days at the earliest. There was a murmur in the lecture room as I listened to the exchange, but Wait, wait! You fought me on the exam... Lois?Was it? The guy got up and walked down to the podium. "Let me take that test! 56-Episode 22 Apparently its a perfect score The advancement exam is said to consist of a written test and a practical test. Each has a perfect score of one hundred points, with a total of two hundred points. It is said that you have to get more than 160 points to pass the test. First, the written test was conducted. Then the test begins. At the examiner''s signal, I quickly look through the whole thing first. Hmmm.........I heard that the range of the exam includes the range of lessons learned in the second year of the first grade, but......it doesn''t seem to be a big deal. The exam is one hour long. But with this level of content, it seems like you can solve it all in ten minutes. In some cases, I was going to have my entire personality mobilized, but there would be no problem with just the master figure. And so, as I expected, I filled in all the answer boxes in about ten minutes. Reviewing.............no need to review. As expected, there''s no such thing as being wrong with a question at this level. Now that I had some free time, I decided to do some image training. In my head, I''m going to have the two personalities fight each other. It''s good training to have them each use different magic, and it''s also interesting to make one of them a sword. Since it''s a world of images, I could also become a demon. By the way, right next to me, there''s a guy who''s still desperately staring at the question. It was the Lois boy who wanted to take the advancement exam himself. ''''..........d*mn, what''s this problem.......'''' He seemed to be struggling quite a bit. Eventually the exam was over and the grading was soon done. Since there were only two of them, Bacchus finished the grading in about thirty minutes. Then I''ll return your answer sheets. First, Lois. Lois'' face contorted in frustration as she received it. ''''Sixty-two points........'''' ''You don''t have to be so pessimistic. If you can score that well at this point in your freshman year, it''s enough. It''s essentially an exam to be taken at the end of your sophomore year. Bacchus consoled him by saying so. ''And you still have a chance of passing. Just get a hundred on the practicals. The passing line is 160 points, so if he scored 100 points on the practical test, he got 162 points, which is indeed a pass. In his case, I think he is rather good at the practical test, so it depends on the content of the practical test. Next, Arel. .........I expected it to some extent, but I didn''t expect it to go this far...... When I received my answer sheet, I saw that all the questions were marked with a zero. Apparently, I got a perfect score. ''That was easy,'' ''Some of the questions would have been difficult for even second grade students...'' Lois looked more and more frustrated when she saw my score. But don''t think you''ve beaten me in this! ''I didn''t mean to play the game in the first place, did I? Well it''s the time for you to act like you''re in a good mood!You can''t lose with practical skills! ''Then it was already settled on the exam, right?'' ''Oh, that was some kind of mistake!I am the man who will become the King of Magic!There''s no way we''re going to lose here! But it''s true that you have a tendency to have too much self-esteem, but your competitive spirit is very important. If you think of me as a rival, then do what you want. Then we moved on to the practical test. Me and Lois were taken to the training grounds. It''s an unusual shape. Are you going to run the 200-meter dash? It''s an elongated rectangular space. There are several of them lined up side by side. Each one is surrounded by thick walls on all sides, or perhaps it would be better to say that they are hollowed out in a semi-underground fashion. Only one wall, however, was fitted with what looked like an iron lattice, making it look like a cage. ''Which one do you want to try first?'' I... I''ll go first! Lois wanted to take the lead herself. A ladder was put up and they would go down from there. ''Then we''ll begin the practical test. Immediately after, the bars of the cage opened. A figure emerged from behind it. The minotaur? It was a bull-headed demon, a minotaur. As soon as they found Lois, as if they were starving, they leaned forward and started running. I see. So this is the kind of test. I''m sure you''ll be able to find out more about this. Can you do it? But of course! ''Incidentally, if you can''t beat them, you''ll be rushed by the minotaur. What..... No, no, I think we should take it down, if we take it down!I will burn it all down with one blow!Illaption! Lois had activated the magic that she had used in the entrance exam. But although the flames weren''t as flashy as they were then, the energy was conglomerated to make the blow more deadly. He must have teased the technique, just as I did back then. It was the result of learning the art form. But unfortunately, it was behind the Minotaur that the flames rose. "What?! Well, this time, the opponent is moving. Illaption is a magic that sets location coordinates and generates flames that erupt at that location. During the entrance exam, it would be effective if the target was motionless, but if the target was constantly moving, it would be difficult to get the timing right. And then there''s the added pressure of an approaching monster. ''''Hey, Irrationality!Illaption!ILLUSTRATION!!! The panicked Lois continued to foolishly unleash her selected magic, but it all ended up just blowing hot air at the minotaur''s back. ''''Bumo-ooh!'''' Hi! Finally, the minotaur came within a few meters of Lois and tried to deliver a powerful lunge with a yell. The doomed Lois......but suddenly the ground under the minotaur''s feet disappeared. ''''BMOOOH! Apparently there was a drophole prepared as a safety measure. I''d noticed it, though. The ground was different from the others, and it was obviously suspicious. But Lois, who apparently hadn''t noticed, stumbled backwards, perhaps shattered at the waist, and fell on her buttocks on the spot. Mercilessly, Bacchus told her. ''Lois''s score on the practical test was forty points. A total of one hundred and two points, and she failed. They say you don''t have to be able to beat him to get points. 57-Episode 23: What if you were more pleased? It was my turn to take the test, with Lois hanging in the background after being confronted with a failing grade. I move to the next lane. "BMOOOH! Behind the bars, there was still a minotaur on the other side of the bars. He had already seen many tackles on the bars, and it could be seen that he was quite excited. ''''Hm?Isn''t that different from the Minotaur I mentioned earlier? Of course there''s another one. I know that. The common minotaur has a brown coat, but that one is mostly black. But there are cases where the same species is a different color. Maybe that''s just one example of that... but that one obviously has a different muscle quality and pressure. ''Ha, ha!How pathetic of you to say that and try to keep the line of failure open!You must be rejected for that to happen!Yes!There''s no doubt about it! Don''t expect others to fail just because you''ve been rejected. The bars opened and a minotaur flew out. Its speed is much faster than before. It''s going to get here at about half the speed. ''''What is this...?'''' Bacchus also felt uncomfortable. ''Firelance x 2.'' I fired two spears of fire. They fly toward the minotaur''s lower half of its body. I don''t expect to be able to defeat that minotaur with a fire lance. My aim is its legs. As long as you can block its legs, you''ll be able to block its signature rush. ''''That''s not fair!I can''t believe you''re using that kind of trick...! No, Lois. In fact, that was the right thing to do. The opponent is a demon. You don''t necessarily have to fight it head-on, but you have to find a way to defeat it more reliably and safely. What we need is to find a more reliable and safer way to defeat it. ......... Well, it didn''t matter if it was the way Lois tried to do it, or the way she struck a powerful blow. ''Bumoo!'' Hmm? The minotaur jumped up and evaded the spear of fire. ''''Wha........ducked.......?There''s no way an ordinary minotaur could do that... Bacchus gasped. ''Don''t tell me it''s a higher species?d*mn, what the hell is that thing mixed up in there...?Arrell!The test is canceled!I''ll be right up-- No problem. ''Bumo-ooh-ooh!'' Both spears of fire struck both of the minotaur''s legs. ''''Huh?What does that mean...?It should have been avoided.... I was just setting up my surgery to auto-trace it. After being dodged, they made a U-turn and ran after it. It seems that even the higher-ranked Minotaur couldn''t avoid the spear that came from behind, as expected. ''''Bumooch...! The part I was aiming for was the joints. The minotaur''s thick muscles protected its entire body like armor, but as expected, it hadn''t even reached its joints. Moreover, since they are vital organs, if they were damaged, they would not be able to stand up. Even so, the minotaur tried to approach us with its front legs, but "Irrationality. At that speed, it''s no longer the same as a motionless target. He was engulfed in flames, and a decapitated yell roared out. ''''I''m sorry, too!I think I accidentally brought the Black Minotaur that I''m using for second grade training...! ''''It''s probably a demon that some of the highest-achieving students in the Second Grade handle!If the other party was a normal student, there would have been a major accident...! It seems to be a high ranking species. I even ducked a spear once, and it looked like I could at least jump over a pitfall. ''''Hi........'''' Lois''s cheeks are twitching and her lower body is squirming. If she hadn''t run for office and the order was reversed from mine......................... That black minotaur was now charred black. Minotaur meat is sometimes procured and eaten locally by adventurers who take on dungeons, but it looks like this won''t even allow them to try to taste it. ''''Aleru''s practical test score was a hundred points. With a total of two hundred points, I passed, of course. Apparently, he passed the exam successfully. Shouldn''t you be a little happier? Bacchus says with a dumbfounded look on his face. ''''Anyway, you are now a clear second grade. Due to various formalities, it will take a little while before you are officially promoted, but from tomorrow you won''t have to take my classes. .........although I hardly took any of them to begin with. ''I heard you''re going to be working in a lab somewhere? Yeah. There are currently twenty-one laboratories, both large and small, but there are some that accept students and some that don''t, so you can ask the office for information about them. However, there are some laboratories that accept students and others that don''t, so you can ask the office for more information about that area. If you wish, you can visit them. I see. ''One of the characteristics of the Red Academy is that there are many laboratories of the combat type. Eighty percent of them are of this type, studying and learning practical combat methods and tactics using red magic, and many graduates are assigned to knights or become adventurers. The remaining 20% are theory-centered and are often holed up in laboratories. By the way, I have a lab too, but I''m the latter. I''m mainly doing research on magical characters. ........although to be honest, it''s not very popular. Hmm. Let''s try to visit various laboratories. 58-Episode 24: Mature At the Red Academy, you can now advance to a second grade. I''ll now decide which lab to join........ Let me take the promotion exam. After the class at the blue academy, I asked the instructor for help. Each academy has its own detailed rules and regulations, but just like the red academy here, you might be able to take a progression exam as soon as you receive the teacher''s recommendation. Honestly, the content of the classes at the blue academy are all things I don''t need to listen to, either. ''''........What are you talking about?'''' He stared at me. You have to take the exam once a year. Didn''t you hear in the guidance or something that you had to take it after completing a year''s course? ''Of course I remember. But wouldn''t you be able to take the test as soon as the faculty approves it? ''That''s only for the highest achievers!You rarely show up for class, and yet, unexpectedly, you''re taking a progression exam?You will make me laugh, won''t you? Incidentally, this instructor was a woman who was in charge of the entrance exam for the Blue Institute. Her name was Hengel, I believe. ''''Then what do I have to do to get you to admit me?'''' The first thing you need to do is show up for class. ''Hm, that''s the end of the line. I''m trying to move on so I don''t have to go to classes that aren''t worth getting out of. ... what? Hengel''s first corner of his eye was fished out. ''Is there any point in my class if it''s not worth mentioning...? That means it''s not on my level. How high and mighty do you think you are? With veins floating on his temples, Hengel thrust his long, thin fingers into my face. I''m going to be the one to find out...!We''ll see if you''re worthy of taking the advancement exam...! Does that mean they''re going to let you take the exam to be able to take the advancement exam? It''s a little sluggish but well, you just have to pass both of them. Then she took me to the training grounds with her. ''Hey, is it make-up training or something?'' No, I heard he''s taking the promotion exam. I think Dr. Hengel is going to find out if you''re qualified, exactly. ''What?He''s always skipping class? To begin with, it''s only been a year, right?We''re talking about a pass rate of less than half for even sophomores. Perhaps because it was right after class, the students who were listening to the exchange with Hengel were even following him. It seems that they intend to visit. Among them is Koofa, who for some reason has a masterful look on her face. In the middle of the training ground, I face Hengel. ''What are we doing?'' I asked, and Hengel''s mouth hung up in a somewhat amused manner. You''ll be dealing with him personally, my dear. Are you sure you want to do this? Apparently they''re going to have a mock battle. ''So that means we''ll have to fight and win. ''''What are you talking about?Don''t tell me you think you can beat me, a practical teacher at this academy? I won''t know until I try, but maybe we can win? ''''Apparently, you''re more smug than I thought........ Okay, if you''re that confident, I''ll make it a condition that you beat me! Those who were watching from the sidelines buzzed. ''''C''mon, why is that guy so agitated?'''' There''s no way you can beat a teacher. I also heard that Dr. Hengel is the closest thing to the next Magus King. Hengel and I stand about fifteen meters away from each other. It seems to have originated from the traditional rules of dueling wizards, but it''s common to start a mock battle like this after a certain distance from each other. The use of weapons is prohibited. Physical attacks, such as punching and kicking, are also forbidden, although they may be approached. You win if you can shave off all of your opponent''s blessings. ''''But as expected, you won''t take yourself seriously against a student. That''s right. And then the testing begins. ''You''ll regret your big words against this a**h*le. --Ice Storm! Immediately after, Hengel unleashed his advanced magic. ''''Oh, I''m sorry. Was it just a little too strong? ""No, no, no, no, no, no, no, don''t you go all out?" A fierce cold wind containing ice and debris rushed in amidst the rising voices of the visitors. The most basic method of simulated magical warfare is to set up a magic formula before the start and then use powerful magic to clear it up at once as soon as it starts. I think it''s a good idea to remember that, don''t you? ""That''s not very mature..." Did you say something? ""It''s nothing." I see. Wouldn''t it be all right if I started making my own magic formula before we started? You won''t be able to hear my advice if you''re encased in ice. The blizzard subsided and Hengel peeled his eyes away. I was unharmed and my blessings weren''t diminished at all. Before I was hit by the ice storm, I activated my Ice Shield magic. The ice wards that surrounded me in all directions protected me. Paring. I kick through the ice barrier and get out. My guess was off, and Hengel frowned a little abominably. ''''..........Since you had such a big mouth, it''s only natural that you could at least prevent the current attack. Well, I''m just being cautious of the possibilities. I just didn''t want to be disqualified for it in case it was stupid, so I didn''t want to. 59-Episode 25: About 100 "Ice Edge x 50. I make 50 ice blades appear at the same time. It''s the magic I used in my entrance exam. It''s a very good idea to have a good idea of what you''re looking for. So it''s easy to create a large amount of blades at the same time like this and release them like a rain of ice. Depending on the hit rate, the killing power will be superior to even the advanced magic Ice Storm. ''''What a number!'''' You can''t produce that many at the same time! ...it''s not that hard to do, is it? It''s just the same pattern repeating on the technique, and two, three, or fifty of them don''t make much difference. The crowd gasped and shot them all at once at Hengel. ''''You don''t think I can do that much, this me?Ice Edge x 50! Hengel has countered with the exact same magic. He unleashed fifty blades of ice just like me. Gaga gaga gaga gaga gagan! The blades collide with each other and cancel each other out. Moreover, they have been able to hit almost everything. It''s not an easy feat to hit the target of an approaching blade, as it requires a needle-through-hole accuracy to release it. I see that you are not teaching practical skills at this academy. Perhaps the fact that he completely blocked my attack put him in a good mood, Hengel lifted his lips in satisfaction. ''''Come to think of it, you used it in the entrance exam, didn''t you?It seems that ice edge is your specialty, but unfortunately, so am I. Hmm. Hundred. I can spare a hundred myself. "Ice-edge x 100. What? Next, he shoots out a hundred ice blades. ''''Ah, Ice Edge x 100! Hengel came up against it, too. Blades clashed in the air and a crunching, thunderous sound rang out. Some of them slipped through without colliding and flew up to us. ''''Oops.'''' Evasion. Of course, the blade flies towards Hengel as well. ''''Kook .......Ice Shield! Hengel quickly creates an ice shield to prevent the blade from being used. ''Great!To unleash that much magic and then activate yet another one! One of the students marveled at it, but it was only natural for a skilled wizard to be able to do that much. However, Hengel seems to have lost his momentum on the ice edge, probably because he turned his attention towards the ice shield. Even if he slams into my ice edge, he can''t offset it like he did earlier, and he loses his power and gets played back. One after another, my ice edge pierced the ice shield. However, it didn''t go so far as to destroy the shield. On the contrary, the piercing blades are instead strengthening the shield. Rather, it could be said that it was to Hengel''s advantage. You have created a strong shield thanks to you. Now I can unilaterally attack it!Ice Edge x 120! Hengel came out on the offensive. He shot out even more ice blades than before. ''''Hmm. Then we can attack from the side as well. Ice Edge x 120 x 2'''' What? In the front, one hundred and twenty ice blades in line with Hengel. And from her point of view, he shot out another hundred and twenty ice blades from the right direction. ''''Ice Edge from that place! "And that''s twice as much as Dr. Hengel! Ice Shield.......... Hengel prevented that too with her ice shield. A thick wall of ice formed on her right side. ''Then also from the opposite direction. Ice Edge x 120 x 3.'''' "Ice Shield! This time, Hengel unleashed a rain of ice blades from three directions, including the left direction, and three times, Hengel made an ice shield appear. ''''Also from the rear. Ice Edge x 120 x 4.'''' Ice blades from four directions, including further backwards. ''''Wait, you''re kidding, right?Oh, ice shield oh! Hengel produced an ice shield behind himself as well. By the way, designating the activation point of magic is not easy, because the magic formula becomes more complicated for that reason. Moreover, the farther away you are, the more complicated it becomes. That''s why releasing magic from four directions like this is quite laborious. "What do you mean by that? While being protected in all directions by an ice shield, Hengel peeled his eyes out and shouted. ''''Impossible!This kind of trick, if you''re not good at it, even the dean....... ''You''ll be surprised later, I think you''d better worry about your escape route being lost.'' --Ice Lance. Above Hengel''s head, appearing a few meters in the air, was a huge spear. It fell toward her while spinning at high speed. ''''Shh........'''' A thick wall of ice surrounded her, and there was no way to escape. I used the ice edge to completely seal the gap, so there was not a single rat or hole to pass through. The only means Hengel could take was still to prevent it with the ice shield. ''''Ah, ice shield! As expected, she put up an ice barrier on the ceiling, but It''s no use. This one can''t be protected with an ice shield. Pallyyyyyyyy! The ice spear easily pierced the ice shield. And-- That''s right, I can''t let the students beat me... With a scream, Hengel''s blessing is totally lost. Hmm. This would definitely pass. 60-Episode 26 What kind of practice I got the qualifications to take the advancement exam from Hengel, and I successfully passed the exam afterwards. Oh, can I let you into my lab? For some reason, Hengel said that to me, but I said that I would think about it and put it on hold. Anyway, this means that following the red academy, I''ve been able to advance to the second grade at the blue academy as well. Of course, I''m going to advance to the second grade at the other academies as well, if possible, right away. So, at the green academy, I went to talk to the instructor. It''s difficult. It''s difficult to do that because the exam is held only once a year at the end of the school year. There is no way you can take an exam and advance to a higher grade during this period. Apparently, the Green Academy doesn''t have a similar system. ''''I heard that in the past, there were students who were advanced from first grade to second grade, but it was quite an exception. As I recall, the head of the academy was given permission to do so in person. ''''Hmm. So that means you just need to be approved by the dean? ''''........I don''t think that''s possible unless there''s something very wrong.... Besides, the dean is extremely busy. If one student wanted to meet with him, I''m sure it would take at least two or three months. Really? They need an appointment. No, if we can somehow force him to meet-- ''Please don''t do anything rash?If you''re not good, you could be expelled from school at one point. I guess he knew what I was going through inside and he nailed it. ''Well.......... There''s one thing I''m not without a way to do........ Do you have one? It would be nearly impossible to do. ''Don''t be a pussy and tell me soon. ''There''s going to be a flying magic race soon, isn''t there?The race will be observed by the headmaster and the winner will be awarded in person by the headmaster. So, the point is, if we win, I get to talk to the Dean. And if he wins the race, in other words, he''s proven himself at the same time. The story after that would be quicker. ''''But you couldn''t use flying magic properly in the first place, could you?Even if you''re registered to compete, if it''s too much, you could have your entry withdrawn. Don''t worry. I''ve already got it. Can I show you now if you want? I tried flying lightly through the air. I tried to change direction violently, do a somersault, or just spin around and fly. ''That''s about it,'' When I came down after demonstrating one way, my supervisor was stunned. ''''Ugh, lie........so much in such a short period of time.......?What the hell kind of practice... I''ve been training in my sleep every night. ''In your sleep!What do you mean...? Is it true what you say? Then I tried to lightly explain about my sleep training, but for some reason they didn''t understand me at all. ''''Well every wizard has a secret training method, and if you don''t want to tell me, I won''t force you to ask. They think I''m lying. It''s true. Well, I got the assurance that I would be able to participate in the race, so that''s good. Then the day of the race arrived. The starting point is the Green Academy''s outdoor training ground. The students of the academy, who have entered the race, are starting to upload here and there. A total of about a hundred people are said to be participating in the race. The perimeter of the training ground is used as a spectator area, but students and faculty members who don''t participate in the race have come to watch the race. There also seemed to be spectators from outside the academy. ''''Master!Good luck! Is Colette not on the list? Oh, I can''t do that yet... Among them was the usual trio of people. ''''That''s the Dean of the Green Academy?'''' There was a special seat in the middle of the auditorium that was obviously more luxurious than the rest of the seats, and there sat a primitive man who looked very dignified. I''ve seen his face in portraits before, so there''s no doubt about it. He seemed to have come to watch the game. "Hey, hey, you''re not really going to leave, are you? The man who called out to me was a small boy I''d seen somewhere before. ''Who''s that?'' "Wah, don''t you forget!You''re taking the same practical skills class! Is that right?Hate to say it, but I hardly ever take it. I search my memory. I try to keep unnecessary memories in the back of my mind. I just remembered. The one where you were proudly showing off your flying magic and making fun of the novice students. You''re acting like a total f*ckin'' a**h*le, aren''t you? It''s true, so what can you do about it? And I remember thinking, "I''m going to win this race. I''m Skye and I''m going to be the best magician in the world! I''m going to be the best user of flying magic in the world!Of course I can''t lose here! I''m sorry, but I''ll take the win. Ha, that''s a lot of confidence, isn''t it?Apparently you''ve had some training in your own right? Yeah. And I didn''t miss my sleep training every night. ? The boy - Skyke had a momentary "I don''t know what that means" look on his face, and then There''s not much point in improving in such a short period of time anyway. Well, at best, you won''t be embarrassed in the show. He said that and left. ''''Well that''s handy, sleep training.'''' 61-Episode 27: Probably not learning ability ''At last, the Green Academy''s famous flight race, the first Magic King''s Cup of the season is about to begin!I, Grid, in my third year as a top-grader, will be doing the actual reporting!And the commentary is very popular with the girls for its dandy mask!It''s Dr. Dumble! "This is Dumble. Good day. As soon as a reluctant voice extended by green magic echoed in the hall, a high-pitched girl''s scream rang out, which was surpassed by a high-pitched girl''s scream. ''''Kyah!Dr. Dumble! ''Lovely!Marry me! ''Dr. Dumble is a married man!But I want you to hold me! The crowd seems to be getting more excited as the start of the race approaches. ''So, contestants, please take your starting positions! After receiving directions, the race contestants walked to a white line drawn on the ground of the training ground. It''s a pretty long line, so even if there were around a hundred people, they could still line up properly side by side. I''m almost at the left end of it. The position of the line is determined by the year of admission, and we, the first year students, are on the leftmost side of the line. So, Skye was right next to me. I took a quick look around. Many of the contestants have tools to support their flight. As long as it''s not a magic tool, you''re free to bring your own tools. For example, a long stick. It is said that straddling this will make it easier to stabilize your flight. Some people were straddling a broom. Why a broom?Maybe they didn''t have just the right stick. Some were on surfing boards, others wore capes, others wore bird-like wings on both hands. There was also a young man who was almost naked, perhaps to reduce air resistance. By the way, I''m not carrying anything. Well, I''ve been training in the flesh for a long time, and this is what I''m most used to. The starter came out. ''''Good!'''' --Doooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! The explosive magic was the signal for the start of the race. The contestants jumped out in unison to be the first to arrive. The wind of the flying magic that each of them had invoked rallied and a tremendous storm blew behind them. ''''Oops!Suddenly, it was second grade sophomore Marco, who got off to a great start!It''s accelerating fast, and it''s pushing the rest of the field out of the way!Ah, but without gaining enough altitude, I had too much momentum and plunged into the auditorium!'''' The student, Marco, who crashed into the bleachers, was knocked unconscious and retired. He made the same mistake last year. He''s not a good learner. The contestants fly out of the training grounds, looking downward at the audience as the commentator, Dumble, gives a scathing assessment. Incidentally, the play-by-play and commentary seemed to be done while moving around using their own flying magic. The contestants are said to use their own flying magic to move from place to place from one place to the next, taking shortcuts to get ahead of the competition. The route of the race had been communicated to the contestants beforehand. First, they would circle the academy campus several times before heading out of the academy. In other words, from the middle of the race, they would be flying through the city. ''''One minute after the start!It''s only the beginning of the race, but it''s already starting to fall apart!The lead group is about 15 people! ''Looks like two of them are first grade freshmen. That''s me and Skyke. We were flying side by side slightly behind the lead group. Skyke sees me flying right beside him. What the hell are you doing following me at this speed? We can afford this, can''t we? Flying magic uses both magic and physical strength. The reason why the speed is slow even in the lead group is because the race is a long 20 kilometers, so if you go too fast in the first half, you will stall in the second half. ''The lead group is about to leave the campus soon!And that''s the first hard part!Immediately after leaving the main gate, the players must take a big right turn!'''' "A sharp turn at this speed is difficult even for an expert. "Sharp turns at this speed are difficult even for experts, and even more so with a group. It''s very important to get a good position before you get to the curve. The main gate came into view up ahead. Everyone is pushing each other to get the best position possible. If you are too far inside, the centrifugal force will not be enough to keep you on course. But if you were too far out, the distance would be too great, and there was a danger of falling behind. That''s why everyone is aiming for the middle of the road, which is just the right amount of salt. We passed through the main gate. All at once, they curved to the right. We couldn''t get around, and two of us seemed to veer off course and hit the wall of a house. A few of us who had to take the outside further out lagged a bit, and the group went vertical. Me and Skyke got up to about the middle. ''Now the race is going into town!The current lead group is 13 men!Ah!But one more person is getting separated from the pack!Will they continue to drop out!'''' ''His expression looks pained. Apparently, he was flying at an over pace for him. ''But the two rookies are still firmly in place! It flew through the city. Residents were cheering from their feet, saying "Go for it! They had come all the way out of their homes to watch the race. By the time the race is halfway through, there are seven people in the lead group, including me and Skyke. ''We''re almost at the turnaround point!Many of the leading players are still around, including last year''s winner!And with two rookies in the middle of it all, it''s going to be a very interesting race. 62-Episode 28: Do You Use Your Inner Hands? Just after the turnaround point, someone broke away from the lead group. ''Oops!The winner of last year''s Magus Cup, no, last year''s winner of all three major races, the first Triple Crown winner in decades, Dionne, "Goddess of the Sky", is here!He''s already trying to play the game, and one of them has jumped out!'''' ''You''re the one who held her off so far. "If she had been capable, she could have pulled away from the pack much sooner. It''s a very exaggerated term, but the Goddess of the Sky is probably two names. She was called Dionne, and she was a girl with hair as white as snow. Her age was probably about the same as mine. She leisurely increased her speed with a cool look on her face. ''''Yi, let''s let her go!'''' It was Skyke who followed suit. In order not to be left behind, he also increased his speed at once. Of course, I followed him. And while the other contestants were sticking it out for a while, one or two of them were gradually dropping out. Before I knew it, it was just Dionne, who was flying at the front, and me and Skyk, who were flying just behind her. ''What a surprise, two of us are following Dionne''s high pace!And they''re both first grade freshmen!'' The actual player exclaimed excitedly. ''''With this, if the First Grade First Grade wins, it will be the first time in twenty-three years! Skyke turned to face me as we flew side by side. "You''re not so bad yourself! Really? I''m still pretty much in control here. I''m surprised. Rookie following me around. And though it was a small one that seemed to be drowned out by the sound of the wind, I heard a voice that sounded impressed from before. Dionne, who had been silent all this time, was the first to open her mouth. ''Ha, of course!I''m going to win this race! Skyk''s forehead is covered in sweat and looks slightly painful, but since he''s so strong, he must still have some room to spare. ''''Then how far can you follow me?'''' Huh! Dionne picked up more speed. In the blink of an eye, the distance between them opened up. ''What a surprise, Dionne, he still has some energy left!We''re going to keep the two rookies apart! Hey, I''m not even serious yet... Skyke also accelerated and ate hard. ''My God, my God!Still, the rookies are desperately clinging to it!'' ''Great. I can''t believe it''s only your first year. Are we done with this?Then I''ll give you more. But when Dionne saw that, she accelerated again. ''''Wha.........?Ugh, are you kidding me? Skyk grunts in dismay. Apparently, this was his limiting pace, and he finally lags behind Dionne. d*mn! Skyk was left behind in a flash as he roared in frustration and anger. ''''Skyke, he''s finally dropped out of the championship race here! But to do so well in your first outing is admirable, and I have high hopes for the future. I have great expectations for the future. Well there''s still one person left. Dionne looks at me flying next to her with a sideways glance. She seems to be breathing a little harder, but she still looks cool. ''''I''m on the edge, as expected. Even though he had been training every night without fail, he had only been using flying magic for a little over two months. The other party should have been doing this for many more years, so the years were different. ''''The Dionne players are pulling away at an even greater pace!Arrell somehow manages to stick it out, but he''s slowly pulling away!The difference is five, no, ten meters! "It''s a great performance by Dionne. Arrell did well as a rookie, but it will be difficult for him to recover from this. As per the actual situation, Dionne''s back is gradually moving away from him. Hmm. This is a tough one. He''s already flying with all his might, and if he continues like this, he''s only going to get further away. "It can''t be helped. Is there any way around it? I sped up at once. ''''What?What the hell does this mean!''Arrell, you have suddenly exploded and accelerated! And again. ''Well, it''s accelerated again!But just before that, it seemed to me that he made a strange move...?'''' ''He kicked it...He created a blob of air, used it as a foothold, and accelerated it by kicking it!'' For the first time ever, Dumble''s voice, which had been a matter-of-fact commentary, gets louder. As expected of a commentator. He seems to have figured out what I''m doing right away. I create a mass of air at my feet and kick it as hard as I can. This gave me a new propulsion. ''Kicked the air...?''Dr. Dumble, is that possible?'' "...there''s nothing we can''t do. But people usually don''t try to do it, because the impetus they get from it is very limited. Because the amount of impetus it gives you is very limited. But Arrell is accelerating like crazy, isn''t he? "That can only mean that his legs are so strong... Yes. Even though they use air as a foothold, it is soft, unlike the hard ground. So you lose most of your power. If it''s done poorly, the air resistance created when kicking will be greater, which could slow you down. It takes a lot of leg strength to accelerate like I did. Okay, it''s worth using the back of my hand, and Dionne''s back is getting closer again. 63-Episode 29: It looks like your arms are getting bigger ''Arrell''s unique way of flying, as if he were soaring through the air, makes him go faster!Obviously, we''re getting closer to Dionne!'' I kicked the mass of air and accelerated the gun. The distance between me and Dionne, which was more than fifty meters at one point, is now closer than ten meters. ''''Huh........'''' Dionne glanced back at me. He must have thought he had completely pushed her away, and I could see that she was surprised by the lack of expression on her face. ''''But Dionne, player!What a boost in speed from here!I''m going to show them that they can''t lose to a rookie and keep the Triple Crown!'' You''re still going to be fast. But we can''t afford to lose either. ''Arrell will follow!Yeesh, this is getting even faster!My goodness!Dionne is trying to widen the gap somehow but he''s still managed to close the distance!That sky goddess is showing a pained expression!'''' Eventually, the race entered the final straight before heading into the green academy grounds. And finally, I lined up with Dionne. ''''Arrell, I''ve caught up with him here!He''s going to pull it off in one fell swoop - no, Dionne won''t let him go.He accelerates again, and what a way to get ahead!What a dead heat!I don''t know where this is going to end up!'''' "...this is not good. ''''What?Dr. Dumble? The only thing I can think of to say is that there''s a big curve in the opposite direction from where I was going when I entered the academy campus after this straight line. There''s no way you can go around it by charging into it at this speed. As the commentary says, the final curve ahead of us is in sight. ''Shh, but both riders don''t seem to be slowing down at all!Is this okay!'' Hmm. It''s certainly quite difficult to go around that curve at this speed. But Dionne doesn''t slow down at all. Is she confident that she can make the turn, or is she planning to charge into it knowingly? Well, the other party seems to be willing to go on like this, so I have no choice but to go too. But that was the time. Contrary to my expectations, Dionne suddenly slowed down. ''''Ah!Dionne is slowing down!In one fell swoop, Arrell is pulling away from the field but he''s going into the curve at breakneck speed. It''s a good strategy by Dionne and I think he made it look like he was going to enter the curve at the very last second. I made it look like I was going to enter the curve at that speed until the very last minute. That''s the queen of the Triple Crown. That''s the queen of the Triple Crown, she''s very calm and collected. The inexperienced Aller fell for it. ''Arrell has come out on top with this.........I still don''t think we can turn the corner!I couldn''t withstand the centrifugal force and went off the center of the course in a big way! A tremendous force is applied from the left side and the body is almost taken to the right. Hmm. Then how about this. I put a lot of force into my right arm. It swells up with muscle. I created even more air masses on the right side of my body and slammed my right arm down with all my strength. Zugan! The sound of bursts of air rang out and he managed to regain his position. ''''Eh...?'''' Zugan! Zugan! Zugan! Zugan! Zugan! He repeated it many more times and made it around the curve without going off course. It''s a good thing I''ve been working on my muscles. Otherwise, I wouldn''t have been able to pull off such a feat. "Well, I made it through the turn? The actual situation took my breath away. ''''I mean, it looked like his arms just got bigger...'''' ...I could see it that way too, couldn''t I? Illusion, is it? That would be great. While maintaining top speed, I entered the academy campus. All that''s left to do now is go straight ahead. You can fly straight into the training area where you started and cut the goal tape. The difference between us and Dionne is more than ten meters. When we entered the training ground, we were greeted by loud cheers. ''''Whoa!Master!That''s great! ''I really came back in first place! That was amazing... And now, Arrell has finished first!What a first year winner!It''s an accomplishment!And Dionne comes in just a few seconds later!The Triple Crown Queen finished second in her first race of the year!'' As I flew through the goal, there was an even louder cheer. "Whoa, whoa, whoa! Wow!He seriously won the championship one year! Dionne-sama, Dionne-sama can''t lose! ...wind. But as expected, I''m tired. He''s been flying ten times as far as he has every night, but not this fast. It''s not only that, but it''s also a record time.It''s a hell of a record!It''s a tremendous time, shaving nearly a minute off the previous record! Apparently, it''s a new meet record. "...I''m surprised. I didn''t think I''d lose. Dionne, who has landed on the ground, walks over to us. He has a flat face, but he''s drenched in sweat. ''''That was a good match.'''' Hm. I''ll do it again. I''ll do it again. I''m not gonna let you down this time. We congratulate each other on a job well done and shake each other''s hands. ''Skyke is back!Third place!He''s done great as a rookie too!'' Skyke cut the goal tape, wobbling a little, as if he was wearing out. As soon as he descends to the ground, he falls limp. The first aid team rushes over, but he glares at us. "Shit, shit, shit...Next time I''ll do it again!Guess what? Well, if you have the energy to say that, you''ll be fine. 64-Episode 30 Leave it to me Well. I almost forgot about it because the race had become so heated, but my goal for the win was to appeal directly to the principal to be allowed to advance. When I received the prizes and certificates in person from the headmaster at the award ceremony, I asked him at the last moment, "What do you want me to do? "Let me advance to the second grade. All right. It was easily accepted. ''''Even so, to win in your first year of school. Where did you learn your flying magic?'''' No, not since I came to the Academy. Ha-ha, that''s not possible. He laughed at me once. It''s true. Now I was able to advance to the second grade in the three academies, red, blue and green. Except for the black academy, where the grade system itself has collapsed in the first place, the rest are just yellow and white. To tell the truth, they already had a guess about the yellow academy. In the yellow academy, something called a presentation meeting is held regularly. On the first day, first grade students (but only if they wanted to) would present their results in the first part of the first day, second grade students would present their results in the second part of the second day, and top grade research students would present their results in the third part of the third day. Then on the last day, the teachers would present their research. It is said that students who achieve excellent grades in these presentations may be allowed to advance to the next grade. That''s what I was aiming for. So now that the race is over, I''m getting ready for the presentation in two weeks. As I''ve explained before, there are two main types of yellow magic: earth magic and alchemy magic. It seems that those who specialize in earth magic are mostly the type of presentations that demonstrate how well they can manipulate the earth. I''ve heard that the alchemy magic is not something that can be shown immediately on the spot, so the presentation is basically a report on the content of the research while presenting the results. Generally speaking, golems belong to the field of earth magic, and are used in a variety of situations, such as making them do physical labor in place of people, or making them run into enemy lines during battle. However, they are after all puppets created from the earth, and as soon as the magician releases their magic power, they crumble back to earth. Besides, the magic power is severely depleted, so it is difficult to use it for long periods of time. I came up with a method to improve such a weakness of the golem. It was an idea to create a golem using the metal created by alchemy magic. The origin of this idea was the living armor in the Sword City dungeon. That was a moving metal armor, and unlike the golem, it kept its shape semi-permanently. I wondered if it would be possible to create a golem similar to it. I started by creating the metal that would become the body of the golem. Ideally, the metal should be strong and light. That way, the golem can move quickly and also reduce the amount of magic power it pours into the body. ''''Hmm. Something like this? After much thought and error, the metal created by alchemy magic was a decent product. Even though it is much lighter than steel, its strength surpasses that of steel. Even so, it still bends when I put all my strength into it, so there''s still room for improvement, but for now it''s strong enough to support its own weight. Of course, even if I made a limb from a single lump, it would not be able to move. So I decided to divide it into several parts and put them together. In short, it''s just like a human bone. And if we could provide joints in each part, the robot would be able to fly or run by moving those parts. That''s how the first prototype, a metal golem with the same shape as a human, was created. ''''........Mm. It''s hard to get it to keep its balance.'''' It was fine if he was just standing, but as soon as I made him walk, he became suspicious. And his movements were very awkward. I could hear a squeaky, grating sound coming from the joints. Clank! And then I took a tumble. "Hmm. I should be able to move a little more smoothly. Soon, two weeks passed in the blink of an eye. ''Okay, we''re all set. All we have to do now is present it. And that''s when I realize a major blunder. "...I forgot to register. Apparently, I was too enthusiastic. I rushed into the presentation''s administrative office. ''It''s hard,'' I was kicked off by the secretariat. ''Otherwise, the first part is so large and the schedule is so packed that we can''t very well accept you jumping in now. Please wait for the next presentation. Can''t you do something about that?Or a second part. The same is true for the second part, since there are so many of them. So how about part three? ...It''s absurd to think that a First Grade student would want to present in Part III. I think I''ve pissed him off. ''After all the effort I put into creating the latest golem that no one had ever thought of before...'' ''It''s not that no one thought of it, it''s just that they thought of it but decided it wasn''t worth doing?'' That''s a terrible thing to say. What''s up?What''s going on? Then someone barged in. He was a middle-aged man with a fairly good physique. His face is stern, and he looks more like a soldier-in-chief from some country than a wizard. But in spite of that, he has an innocent smile on his face, like a child. ''Dr. Logwell. Apparently he is a teacher at this academy. Well, I thought that would be highly likely, given his age. ''''Actually.........'''' After hearing the clerk''s story, Logwell nodded broadly and said, "I see, I see. All right!Leave it to me! He slapped his chest and shouted so boldly. Could he do something about it? 65-Episode 31: Thats always you Well. I almost forgot about it because the race had become so heated, but my goal for the win was to appeal directly to the principal to be allowed to advance. When I received the prizes and certificates in person from the headmaster at the award ceremony, I asked him at the last moment, "What do you want me to do? "Let me advance to the second grade. All right. It was easily accepted. ''''Even so, to win in your first year of school. Where did you learn your flying magic?'''' No, not since I came to the Academy. Ha-ha, that''s not possible. He laughed at me once. It''s true. Now I was able to advance to the second grade in the three academies, red, blue and green. Except for the black academy, where the grade system itself has collapsed in the first place, the rest are just yellow and white. To tell the truth, they already had a guess about the yellow academy. In the yellow academy, something called a presentation meeting is held regularly. On the first day, first grade students (but only if they wanted to) would present their results in the first part of the first day, second grade students would present their results in the second part of the second day, and top grade research students would present their results in the third part of the third day. Then on the last day, the teachers would present their research. It is said that students who achieve excellent grades in these presentations may be allowed to advance to the next grade. That''s what I was aiming for. So now that the race is over, I''m getting ready for the presentation in two weeks. As I''ve explained before, there are two main types of yellow magic: earth magic and alchemy magic. It seems that those who specialize in earth magic are mostly the type of presentations that demonstrate how well they can manipulate the earth. I''ve heard that the alchemy magic is not something that can be shown immediately on the spot, so the presentation is basically a report on the content of the research while presenting the results. Generally speaking, golems belong to the field of earth magic, and are used in a variety of situations, such as making them do physical labor in place of people, or making them run into enemy lines during battle. However, they are after all puppets created from the earth, and as soon as the magician releases their magic power, they crumble back to earth. Besides, the magic power is severely depleted, so it is difficult to use it for long periods of time. I came up with a method to improve such a weakness of the golem. It was an idea to create a golem using the metal created by alchemy magic. The origin of this idea was the living armor in the Sword City dungeon. That was a moving metal armor, and unlike the golem, it kept its shape semi-permanently. I wondered if it would be possible to create a golem similar to it. I started by creating the metal that would become the body of the golem. Ideally, the metal should be strong and light. That way, the golem can move quickly and also reduce the amount of magic power it pours into the body. ''''Hmm. Something like this? After much thought and error, the metal created by alchemy magic was a decent product. Even though it is much lighter than steel, its strength surpasses that of steel. Even so, it still bends when I put all my strength into it, so there''s still room for improvement, but for now it''s strong enough to support its own weight. Of course, even if I made a limb from a single lump, it would not be able to move. So I decided to divide it into several parts and put them together. In short, it''s just like a human bone. And if we could provide joints in each part, the robot would be able to fly or run by moving those parts. That''s how the first prototype, a metal golem with the same shape as a human, was created. ''''........Mm. It''s hard to get it to keep its balance.'''' It was fine if he was just standing, but as soon as I made him walk, he became suspicious. And his movements were very awkward. I could hear a squeaky, grating sound coming from the joints. Clank! And then I took a tumble. "Hmm. I should be able to move a little more smoothly. Soon, two weeks passed in the blink of an eye. ''Okay, we''re all set. All we have to do now is present it. And that''s when I realize a major blunder. "...I forgot to register. Apparently, I was too enthusiastic. I rushed into the presentation''s administrative office. ''It''s hard,'' I was kicked off by the secretariat. ''Otherwise, the first part is so large and the schedule is so packed that we can''t very well accept you jumping in now. Please wait for the next presentation. Can''t you do something about that?Or a second part. The same is true for the second part, since there are so many of them. So how about part three? ...It''s absurd to think that a First Grade student would want to present in Part III. I think I''ve pissed him off. ''After all the effort I put into creating the latest golem that no one had ever thought of before...'' ''It''s not that no one thought of it, it''s just that they thought of it but decided it wasn''t worth doing?'' That''s a terrible thing to say. What''s up?What''s going on? Then someone barged in. He was a middle-aged man with a fairly good physique. His face is stern, and he looks more like a soldier-in-chief from some country than a wizard. But in spite of that, he has an innocent smile on his face, like a child. ''Dr. Logwell. Apparently he is a teacher at this academy. Well, I thought that would be highly likely, given his age. ''''Actually.........'''' After hearing the clerk''s story, Logwell nodded broadly and said, "I see, I see. All right!Leave it to me! He slapped his chest and shouted so boldly. Could he do something about it? 66-Episode 32: There is no reason to move properly All right!Leave it to me! I''m not sure, but apparently there is a way to get into the presentation. Please do. I didn''t know the teacher, but since he was so confident, perhaps he could really do something about it. I was at an impasse and decided to jump at his suggestion without a second thought. ''You''re a disaster too........'' Of all things, I can''t believe Dr. Logwell spotted you. After Logwell leaves, the clerk says something like that to me. ''What''s the matter with you?'' ''''I''m afraid I''m going to be the teacher''s assistant on the day. Assistant? ''''Yes. That teacher is top-notch when it comes to his skill in controlling golems but his hobby is to show off his performance at the presentation. Mostly in battle. Apparently, showing off the strength of his own golem is what he always announces. ''Because it''s boring if you don''t have someone to fight, he always grabs a student and appoints them as his opponent every time. And he''s a merciless man.... There are many students who are broken by being beaten to pieces in front of so many people that they probably don''t have anyone to look out for anymore. And these days I''ve been hanging around here all the time, soliciting students as they walk by. I guess it wasn''t a coincidence that he showed up earlier. If it wasn''t a teacher, he''d be completely suspicious. ''''Still, I didn''t think you''d even mess with a First Grade student...'''' The clerk sighed in disgust and then ''I don''t have anything bad to say, so you''d better turn it down now. Your presentation is on the last day, and the audience is large, and it would be a burden for you to serve as First Grade. I shook my head from side to side. ''No, it''s rather convenient.'' If there are a lot of people watching, I''d rather bring it to show off my new golem''s performance. ''''........I wonder why you have such baseless confidence when you''re young......'''' The clerk looked resigned and muttered. ''It doesn''t look like I''ll have any other choice, anyway. The last day of the presentation session has come. Today, presentations by teachers are being held in various parts of the academy. As the time for each presentation approached, the students of the yellow academy fought to be the first to secure a good spot as the results of the top class wizards'' cutting-edge magical research could be seen, and as the time for each presentation approached, the students of the yellow academy fought to be the first to secure a good spot. There was even a large number of people standing in the audience for presentations such as those given by popular teachers, which were over capacity. Today was an important day for the teachers as well. The reason is that the content of the presentation is apparently related to the assessment. Mostly the dean and retired former faculty members will be doing that. Some of the faculty members seemed to be trying to kick the other faculty members'' asses by asking them unpleasant questions during the Q&A session. And here, in the indoor training area set up in the basement of the school building, the teachers were also presenting their results. It was mainly a demonstration of soil magic. It''s no exaggeration to say that it was a show using soil. One teacher built a huge and artistic clay castle in a matter of seconds, while another performed a play in clay form. Unlike the humble presentations of alchemy magic, the flamboyant nature of these performances made them so popular that visitors from outside the academy came to see them. In the midst of all this, it was Logwell''s turn to make his presentation. ''''Good day!This time, what a surprise!I would love to show you my wonderful golems! When he told me that. ((( No, you''re always doing that.))) Many of the people in the hall had that look on their faces. However, Logwell doesn''t take it personally and creates his prized golems from the large amount of dirt on the ground of the training grounds. Five in all. It is common knowledge that golems are rugged and stuffy and can only move awkwardly. But this is not the case with his golem. He has a slim and refined body with smooth movements. And with a single, seamless movement, he performed a magnificent performance. ........well, as a martial art, there was a lot of twists and turns. Although there were some people in the audience who seemed to be tired of watching, there was still a great deal of applause when the demonstration ended. The students, especially those who had just enrolled in the school, were clapping their hands in excitement as they were definitely seeing it for the first time. ''''Of course my golems are strong in actual combat!I''d love to show you that from now on! Apparently, it''s finally my turn. He''s going to do the usual again. Poor thing. You don''t see that guy around much, do you?It''s like a second grade for my age, but... As I walk out onto the stage, the students in the audience give me a pitying look. It seems to be just as that clerk had said. ''I want to have his golem fight my golem from now on!What? Don''t worry about it!As expected, I''m not a demon enough to take my students seriously either!There''s only one golem I can handle!I don''t care how many bodies you use! Logwell declared enthusiastically. ''How many bodies do you use and more...'' Normally, you can''t make more than one golem at a time... Even if you could build it, this time it would be harder to operate it at the same time... I could hear such mutterings from all over the place. I immediately decided to show off the new golem I had prepared for this day. ''Come on, Alpha. The aircraft''s body is named "Alpha. When I called out the name, the bright red metal-armored golem that I had placed at the side of the hall started to move, ripping off the veil that hid the plane. ..........Even if I say it started moving, of course I''m moving it myself. Everyone should have thought that I would create a golem out of the soil of the ground. But that wasn''t the case, and moreover, since a golem with a completely unexpected appearance appeared from a completely unexpected place. ""What?" He opened his mouth with a pop. 67-Episode 33: It seems that its time to get serious Fast! The size of it? The giant golem kicked the ground and approached Alpha with an earth-shaking force. Its unexpected agility caused the crowd to shout in surprise. A rigid arm roared and tried to hit Alpha. But Alpha ducked it with a flutter, and conversely grabbed the giant golem''s arm-- What? --Bunken. The giant golem flies through the air and is slammed from its back to the ground as hard as it can. The impact of the impact caused the hall to shake loudly and screams echoed everywhere. ''''Really?I threw it away! How? It''s like a baby flipping a big man over. No wonder the audience was astonished. Don''t think that''s enough to beat me! Logwell laughed with a twitching laugh and quickly tried to put the giant golem up. No, he spun the behemoth from its rolling position. ''''Tokutoyo!Must kill, big wheel! The giant golem''s legs kicked Alpha. Alpha guarded quickly, but he couldn''t withstand the massive blow, and he was blown wide open, almost crashing into the wall at the end of the hall. ''''Gahahahaha!My boastful golem, as expected, is now finished--what? But Alpha twisted his body just before he hit it and landed on the wall. Then he kicked the wall and leapt with all his might at the giant golem still lying on the ground. He delivered a full-body dropkick to the giant golem''s torso. Zgaaaan! At this, even Logwell screamed with his head in his hands. The giant golem split in half from its body. Alpha, on the other hand, decided to land unharmed. I''m not going to be able to get to the bottom of it. I''m not going to be able to get to the bottom of it. Well, not yet!You still have to! Logwell announced the continuation as his body shivered. ''Looks like it''s time for me to get serious this time around! The audience was taken aback by his words, saying "Really? However, it seems that it was not a bluff. The next moment, a large number of golems appeared from the ground like a bamboo shoot after rain. There must be thirty of them in all. ''''You would think that if you deal with more than one golem at a time, each and every one of them would be weaker for it!But that doesn''t apply in my case! As he said so confidently, each of the golems that Logwell created had a solid amount of magical power in them. Together, it''s a considerable amount of magical power. ''''My strength is the enormous amount of magic power that can create these dozens of golems at once!And yet the ability to manipulate each one at the same time and at will!I''ve got a special treat for you today!Watch the skills of the world''s best golem-user! Immediately afterwards, thirty golems leapt onto Alpha at once. Hmm. In that case, let''s give it our all. What? Shkoshukon! While making such a small sound, the two swords that had been stored inside the body flew out from Alpha''s back. Grabbing them with his arms crossed, Alpha grabbed them and held them in a two-sword stance in front of the approaching crowd of golems. ''Golems are swords!Hahahaha!But what can you do with that stuff! The first two bodies struck the Alpha. Alpha swung his two swords. Shubaba-baba! Bot, bot, bot, bot, bot! The two golems were slashed to pieces and turned into rubble and rolled on the ground. ''''What?!What did you just do! It''s just a normal cut, okay? ''You don''t mean to tell me that you just slashed it in an instant! I wasn''t that fast, but apparently I couldn''t see it. Well, I''m a wizard. I''d rather fight with a sword than hand-to-hand combat. I''ve got to say, I''m still the world''s most powerful swordsman who defeated my mother. It''s a good idea to give the golem that you control a sword in the same way. However, due to the limitations of its performance, the sword''s speed, weight and accuracy are still inadequate. So it''s a little frustrating. It''s a good idea to have a good time with them. The other party is a golem that, unlike humans, has no sense of pain. Slashing off one arm or leg will not stop it from moving, so he has no choice but to slash it until it is almost in pieces. On the other hand, every time Logwell''s own golem was destroyed, he created a new one. Therefore, he must have already defeated more than the first thirty of them, but he had hardly reduced them. At first glance, this would seem to be an endless stream of them. Logwell was breathing heavily and his face was earthy. As expected, if I continued to use this many golems, it wouldn''t be surprising if my magic power was depleted. By the way, my magic power hasn''t been reduced by ten percent yet. Alpha is made by combining metal parts, so unlike ordinary golems, it doesn''t need any magic power to maintain it, and it''s extremely energy efficient. Eventually, Logwell seemed to have reached his limit, and he was finally unable to create new golems. Then Alpha cut down the last one. ''''Ooohhhhhh!'''' A loud cheer deafened me. ''Wow!He''s won over that student-baiting Logwell! What a day! I mean, do they even have a golem like that? That should have been enough to appeal to you. 68-Episode 34: You Cant See the Bottom of Magical Power After the presentation, I was able to advance to the next level. Apparently it would have been difficult for me to be promoted if it hadn''t been my own presentation. So it was going to be a complete waste of time, but Logwell said, "I''d love to have you in our lab! He pushed me hard, and as a result, I was able to move on. He helped me out in some way or another. However, I was automatically forced to join Logwell''s laboratory. Well, since this is a laboratory that specializes in golems, it wouldn''t be a bad choice. ''''Show me how to build that new golem! And although Logwell is willing to take away the student''s research results without shame or disrespect, we have no intention of hiding it. It''s a good idea. I''m not just talking about Alpha, there are four more of them. Beta, Gamma, Delta and Epsilon. What? As I moved the five golems at the same time, Logwell''s eyes went white and he roared. ''''Oh, even that wasn''t serious...'''' The requirements for advancement in the white institute were similar to those of the red institute. After receiving a recommendation from a teacher, you have to take a written test and a practical test. The difference will be that there will be a further practical exam after this. I had already passed the written and practical exams, but it took me a while to get through the practical exam. This is because this test is conducted by each laboratory, so if you pass it, you are automatically admitted to the laboratory. After much deliberation, I chose one of the laboratories that specializes in light magic. ''''I''m Kaede and my name is Kaede. I will be the examiner for your practical test. The woman who called herself Kaede was a beautiful woman of about 20 years old with long and lustrous black hair. It seems that she is from the East, and her occupation is said to be a [senior] priestess. The [Miko] is also a profession where one can learn the [White Magic] skill, and she had come all the way from far away to study at this academy. It seems that she is currently in her first year of top grade. The top grade is given its own laboratory from the laboratory to which it belonged when it was a second grade, and it''s a position that''s right in between faculty and students. That original lab was where I wanted to be, and she was instructed by the professor there to be my examiner. I look forward to working with you. ........Are you blind? Yes, but don''t worry. But don''t worry. She had been meditating the whole time. Apparently, she was blind. I''ve been told that if you can sense the magic, even if you are blind, you can live your life the same as an able-bodied person. In fact, it is even possible to ''see'' more deeply thanks to not being deceived by sight. She smiled flirtatiously. You can tell a lot about a person from your magic. Suddenly, he gulped heavily, as if he was surprised by something. ''''Oh no... it''s as if you can''t see the bottom of your magic power...?We can''t keep it like this... no, each of us has never rebelled against the other... so we''re not going to go off on a rampage, we''re going to balance it out... He is mumbling something to himself. ''''.........Oh, who in the world are you......?You don''t mean to tell me that you''re a legendary magician? I responded to her astonished questions. No, I''m just unemployed. In the basement of the grounds of the White Academy, there are ancient ruins. A kingdom that is said to have been destroyed a long time ago. It is a tomb where the royal family is said to rest, but over the years it has accumulated magic power and has become a dungeon. It is said that a large number of undead are nesting there, and the invasion of these undead is controlled by the white magic method that has the power to purify them. The laboratory I chose was a place that studied light magic specializing in the extermination of undead and demons, and had produced many so-called exorcists (exorcists). Therefore, the practical test was also a matter of diving into this dungeon under the supervision of the examiner and actually defeating the undead. The inside of the dungeon was gloomy and smelled moldy. There was even a rotten smell wafting from somewhere, a place you wouldn''t want to spend too long in. The heavily degraded passages were completely submerged in darkness, and it looked as if the undead were about to appear. ''Light. For now, I put out a light for the lights and illuminate the front. ''''Please be careful. If you look at the light, the undead will come closer.'''' "?Aren''t you going to run away? No. No, unless it''s a strong light, in which case it will try to get close enough to the source to get rid of it. I see. This level of light is more of a temptation. Well, it''s rather convenient. ...By the way, you have done the purification of the undead, haven''t you? Maple asked. ''Never?'' ''What?Juju, didn''t we do this in class? I''m guessing I didn''t do it. It''s not like I was properly present at every class. Maybe they had a class on the undead when I was away. ''Don''t worry. It''s going to be a crash course, but we''ll figure it out. And that''s just when. ''Uh-oh.'' A humanoid monster appears from ahead with a grunt. It''s body was rotting in many places, and it approached us with a wobbly gait. "A zombie? I shot out a compressed light. "Holy Ray. Ohhhh! The zombie screams fearlessly as it is hit by a powerful beam of light and slumps over. Eventually, it seems that it has stopped moving, and its rotten body turns to ashes. Purification complete. ''''Well, that''s about it. 69-Episode 35: This is a fool The deeper one went into the dungeon, the more the number of undead monsters increased. Zombies, of course, but also skeletons with only bones, mummies with full body bandages, or ghosts that were only spirit bodies, and so on. ''''Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray.'''' I will purify all of them with light. When ordinary demons die, their corpses are left behind, so the more you defeat them, the more grotesque the scene becomes. However, all the undead that are cleansed by light magic become ashes, so apart from the fact that they are covered in ashes, the marks are clean. So it''s fun to clean them up. It''s similar to that pleasant feeling of dirt getting cleaner and cleaner. I went deeper and deeper in search of more dirt. ''Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray.'' Mr. Arrell! Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray. Mr. Arrell!Mr. Arrell!Mr. Arrell! ''Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray, Holy Ray... hmm?'' I turned around, suddenly realizing that my name was being called. The examiner, a maple, was catching up with me, gasping for breath. Apparently I was moving too fast and had opened the distance a bit. ''''Um ... you''re really a beginner, right?'''' Yeah? ''''........I think even a professional purifier would have a hard time firing a series of shots that fast......'''' Is that so? ...Now, don''t you think you''re going to run out of magic as usual? There''s still room for more, huh? Maybe he''s worried about the return trip, but he''s not down ten percent yet. I think I could go deeper. With that in mind, I tried to walk out again. That''s enough! For some reason, they stopped me. ''''I''ve seen enough of what you''re capable of, Arel-san, so let''s go back. Hm. Is that enough?I think we''ve only purified the lower level undead yet. ''.........No, no, I killed a few intermediate undead on the way, but.......ghouls, mammies.......'' ''Was it?I didn''t notice that. ''''In any case, as long as we can purify the lower level undead, we''ll pass the test...'''' The maple looked around as he said "........we''ve come a long way....... It''s the first time I''ve dived this far down too.......Please be careful as some nasty undead may appear. Then he asks a little anxiously. ''By the way, do you remember the way back...? No problem. This way. That''s very helpful. Even though I''m blind, I can still keep track of my surroundings, but it''s difficult to distinguish between north, south, east and west, so I often lose track of where I am. We headed back the way we came. Maybe it''s because I''ve purged all of them, but I hardly encountered any undead. ''Skeletons, huh?'' But then a skeleton stood in our path. ''''You''re a skeleton and you''re wearing clothes? The skeleton was clad in cloak-like rags. He has a staff in his hand. The skeletons we''ve encountered so far have attacked us without a second thought as soon as they saw us, but for some reason they stood there and came with a gaze (though without eyes) as if they were observing us. It doesn''t seem to be a mere skeleton. ''''Huh!This strong and evil magic power........well, it couldn''t be that.......that''s a senior undead wai-- The maple was about to say something, but before he could, the skeleton clattered and snapped its jaws. "How rare it is to see a living person. Hmm?I just thought I heard a voice, didn''t I? And not from the ears, but directly in the back of my head, resonating..........well, it''s just my imagination. Whatever it is, let''s purify it as soon as possible. "I am the-- "Holy Ray. "...aaaaah! What?Did you hear him scream this time? ''How dare you attack me before I can tell you my name!It''s only logical to wait for the right moment!Don''t you know anything about that, you young man? This skeleton, it seems to be different from an ordinary skeleton after all. Even if it was bathed in the cleansing light, only a small portion of its bones melted. How about this one? ''''Hmph. You can''t defeat me with that level of magic. "Holy Cross. "Yaaaaaahhhh! A cross-shaped light assaults the skeleton. "I, myself, am a fool... This time he disappeared as ashes. ''''Um ... Mr. Arel?'''' The maple tree calls out to me in a cursory manner. I turn around. What''s going on? ''''Now, I think it was a senior undead wight, based on its magical power...'''' ''Advanced?It certainly didn''t look like a normal skeleton, but it was intermediate at best, right? ...I see. Kaede nodded vaguely for some reason. ''''By the way, did you know that Holy Cross is a high-ranking light magic that can only be used by gifted and well-trained exorcists? You''re kidding me. It''s not so hard to be a Holy Ray, is it? ''''If that''s what you perceive, that''s fine with me I don''t care what you do anymore...'''' He was mumbling in a whisper, with some resigned look on his face. Then we returned to the ground safely. A few days later, we were notified that we had been accepted. We''ve now been promoted to the second grade at all the academies. 70-36. Can a cane cut it properly? There are no classes in the black academy of complete neglect. So I was solely holed up in the library alone, reading grimoire books. The exterior of the library is, of course, a shambles, but the number and quality of books is very good. By the way, perhaps because it is imbued with magical power, I am grateful that the deterioration of the books is not too severe for the building. Admission (?) It''s been about six months since, and I''ve already read about a third of the book. Thanks to that, I''ve become quite familiar with black magic. In fact, I''m probably making much more progress than taking classes. Of course, magic is not something that can be said to have been mastered simply by reading books and acquiring knowledge in one''s head. That''s why the library had a special room set aside for the actual use of magic. It seemed that there was no problem trying out magic there. I put the book with the hoary title of ''Magic to Turn Humans into Deformed Monsters'' (as well as the contents) back in its original position, and picked up the next book, which I had finished reading in about ten minutes. ''Hmm?Weird book, huh?It doesn''t say the title or the author''s name, does it? It''s a book that''s solid and heavy, and looks like it''s quite a good read. Other than that, at first glance, it looks like a nondescript grimoire, but there was nothing written on the cover. The same goes for the back cover and spine. I opened it up. ''''Huh!'''' In the next moment, an enormous amount of magical power flooded out of the book, and every hair on his body stood upside down. ''''........What is this?'''' The book was all blank. He looked around as he stood up. The same scene of the library as before. No--. Who are you? There was a presence on the bookshelf that hadn''t been there a moment ago. It was sitting cross-legged and graceful. A human? That''s a strange sign for that. That''s a much worse presence. I see. A demon. Yeah, that''s the answer. Crackle. The guy clapped loudly, as if on purpose. He looks like a human man in his early twenties. He has a thin body and pure white skin. His black hair is pulled back sharply, as if in rebellion to the heavens. The eyes with sharp eyes are reddish, and they look down at me while twisting their bright red lips as if they are enjoying themselves. ''''Thanks. Thanks to you, I could go out there. It''s a shame that what I did with you is now locked up in a book. Apparently it was my opening the book that got me out. I never thought I''d be locked up for this long. None of the people in the academy have ever picked up a copy of this book before. Well, it was at the bottom end of a bookcase in the back, on the bottom row, which was even less obvious. If you''re not someone like me who reads through them in order, you''re not likely to pick them up. The people in this academy only seem to be interested in their own area of expertise. I''m sure you''ve been a big help to me. I owe you a debt of gratitude. ........we should thank you for that, shouldn''t we? I don''t need it. Don''t be so harsh. By the way, I want to return to my hometown in the demon world, and to do so, I need a fresh sacrifice.--Yeah, that''s it. The demon looked around to lick my body with its red eyes and collected them like it was deserving of it before saying ''''You''re going to be sacrificed to me, aren''t you!So that''s how you thank me for helping you!Heehahaha! Sacrifice? You see, we are only using your flesh and blood as a catalyst. I won''t even take your soul. But your soul will be forever wandering the earth.Heehahaha! I say flatly. "Hmm. I''m sorry, but I have to say no. Why should I have to sacrifice myself for a demon who doesn''t know what horse''s bones I am? The demon cleared his throat, "I''m sorry, but you have no veto power! "I''m sorry, but you don''t have the right of refusal! Speak for yourself. --Explosion. I aim at the demon and unleash my magic. But ..... "...?Not activated? The technique should be correct, but the magic power doesn''t converge as it should, and it ends up being a dud. ''''Gahhahahaha, useless, useless, useless!You''re already inside the wards I''ve deployed.It''s a wizard-killer''s ward that blocks all kinds of magic. I had an uncomfortable feeling as if something sticky was covering my entire body from earlier. Apparently, I was already in the middle of this guy''s magic. I''m sure you''ll be able to find out what''s going on in the world," he said.You can''t do anything about it, can you?Of course it''s no use trying to escape! Surely, this isn''t going to be able to use magic. ''Then we''ll just have to fight with this. I pulled out the wand that I was holding at my waist. It is an auxiliary staff for wizards. It seems to be cheap to set the direction of magic with this, and most of the students have it, but I didn''t have it because I didn''t need it. Then the teacher of the blue academy, Hengel, who found out about it, gave it to me as a gift for some reason. I haven''t used it yet, but I''ve been carrying it around with me like this, just in case. I''m going to be able to make use of this device. Of course, it''s not to be used as a magic wand. I held the staff up like a sword. You can''t get away with it.Using your magic wand as a bludgeoning weapon!It''s a pretty good idea, huh? The demon sneers like a fool. The atmosphere is such that they don''t even think they can fight with such a thing. You know what?A true swordsman does not choose his sword. It would have been a little more convincing if the swordsman had told you that.By all accounts, you''re a magical... I kicked the floor, closing the distance between me and the demon in an instant. "It''s a shrinkage. --? Perhaps because I was completely caught off guard, the demon wasn''t even able to react. I unleash a slash() shot with my magic staff to its defenseless body. Zubak! The demon''s torso was sliced cleanly off from his right shoulder to his left side. ''How''s that?You can slash with a cane, right? 71-Episode 37: Are You Impressed by Saving Your Life? What an idiot!How can you cut with a magic wand? ''I told you.A true swordsman does not choose what he gains. "That doesn''t mean you have a wand.Normally, you''d have to hit them, huh? By the way, you can cut with your hands and feet too, okay? Then why do you don''t need the wand anymore? That''s certainly true if you ask me. It has the advantage of a slightly longer attack range, but to me it''s just an error. In the first place, you''re a wizard, aren''t you? That''s right. But I''m also a swordsman. I see........you''re a magician....... No, he''s just unemployed. What? .........Hmm. But still, how can this demon talk normally when it''s been cut in half by its body? And then I thought. ''Kwahahahahaha!That''s a shame, though, because they are a bit of a surprise!I don''t die from being cut down! The devil found himself standing there, unharmed, as if nothing had happened. A deafening humor echoed through the air. ''Is there a power similar to blessing at work?Just like that skeleton clerk. At any rate, I decided to try slashing again. Next, a flash around the gut. The upper body and the lower body separated............................ ''......Hee, hiyahahahahaha!As you can see, no damage!Don''t even think about it. In that case, this time I tried to cut his head in half. ''''Hey--'''' I''m going to cut off his head. "Come on... I''m going to try to cut off both arms and legs. Stop-- I try to chop it up into pieces. ''''........Hmm. Demons seem to have quite a strange nature. There was still an unharmed demon standing in front of me. But for all intents and purposes, it has gotten smaller. In the beginning he was supposed to be taller than me, but now he can''t even reach my waist. The more I cut my body, the more it gradually shrank. It seems that when you take damage, your body gets smaller. ''''Heeeeeee!No more! The demon''s earlier bluster is nowhere to be found, and he tries to escape with a pathetic cry. Of course, I''m not going to let it escape. I caught up with the back of the fleeing demon, flapping my short limbs, and easily overtook it. He turned on his heel and stood his ground. ''Hee!Come on, that was a joke!I apologize!So forgive me!No, please forgive me! This time he is desperately begging for his life. Before I know it, even her voice has become so young that, combined with her appearance, it makes me feel like I''m tormenting a child. ''''Please... please... please...'''' I sent a stab into the face of the demon that was pleading with its moist eyes. ''''Ughhhh?'''' The demon''s body becomes even smaller as it penetrates the head with a bang. ''''No, no, no!How can you attack me in this form normally? I guess demons are demons when they''re shrunk. This is the same demon that had declared me a sacrifice. I had no intention of condoning it. And it was a mockery, mostly because they wanted to catch you off guard and make a last-ditch effort. ''''Since we''re here, let''s see how small we can get. ''Gah!We''re going to disappear! Apparently, it will not be able to maintain its existence and die - or rather, it will disappear. "d*mn it, I can''t hold my wards in this way anymore! The uncomfortable feeling that had enveloped my entire body was gone. Apparently, I was forced to break the wards that had sealed my magic. The demon was now small enough to ride in my palm. It''s about the size of a fairy. ''''Ugh........I''m seriously going to disappear.......'''' You hate it that much? You''re an idiot! It may have been angry, but it was so cute and loud that it was bleeping and little birds chirping. ''Then you can let him off the hook,'' Oh, really?No, really! Yeah. And the alternative is this. I''ve built a magic formula. Then I activated the magic. Magic letters appeared on the demon''s tiny torso. ''Huh?--Pigaaaah! The letters glowed strongly and the demon screamed. ''''Ko, this can''t be right! Looking down at his own belly, the demon looked down at his own belly and his eyes widened in astonishment. There was something like a branding mark etched into it. ''''Slave magic! Yes. Slavery magic is a form of black magic. As the name suggests, it allows you to enslave a subject to you through a magical contract. And the enslaved person must obey his master''s orders from now on. It is often used against slaves as well, but if the other party is a human being, there are many areas where the scope of what can be bound by the contract is defined by law in order to limit too inhumane behavior. But if the other party was a demon, there was no need to take such considerations into account. ''''I was just hoping to get a messenger. You were lucky.'''' You think I''m a demon of the human race? The demon is shaking himself with a buzz. ''Are you thrilled that your life was saved?'' Of course not!I''d rather die than be humiliated like this!I''m still a high lord of the demon world, Giaaaaaaah! ''By the way, I''ve made sure you''ll be in a lot of pain if you''re defiant. "f*ck you, agaaaaahhhh! It''s not physical pain. The devil can endure any number of things. That''s why I made it a severe pain of the type that affects the mind. The demon bowed auspiciously as if in contemplation. ''''Oh, nice to meet you,'''' 72-Episode 38 High, Master Sama The demon I used as my errand boy was named Mastima. So I decided to call him "Matty". "Matty, the bathroom is getting dirty, I need you to clean it up. Hi, master. Matty, I need you to wash these clothes for me. Hi, master. "Matty, go get some bread for lunch. Hi, master. He was very helpful. ''All you do is chores!What the hell do you think the devil is? His figure is still small. This is because I dare to keep him in a state of deprivation of power. In the form of an adult demon, it could cause a bit of a stir outside, even if it''s inside the black academy. With its current size, it was less likely to be scared. Perhaps they would mistake me for a fairy or something. I showed it to the trio of Kite, Kufa, and Colette, but they didn''t seem to think it was a demon. ''Is this what Master used to do?You look pretty weak, but... It''s Kite who says that while looking at Matty like he''s stepping on a price tag. ''d*mn brats!Who the hell are you talking to--gasp! He seems pretty high and mighty for a guy like you. You?You''ve got a big fat pin on this guy! Kufa chides Kite. ''Come on, Kite. You shouldn''t torture your pet. I''m not a pet!You poor skank! ...Apparently you have no discipline, do you? "Idideddeddeddeddeddedd! Koofa picked up his head and Matty screamed. ''''Kuufa-chan, the messenger is dying!I''m sorry, Mr. Arrell! Don''t worry about it. It''s probably not going to kill you like this. Koofa''s Iron Claw (?) Matty, freed from the What did you say? Sorry about everything, master. You gotta be kidding me! I''m a high lord of the demon world! He''s a bona fide demon with tens of thousands of demons under his command! Why do I have to play the role of a lowly human messenger? As he himself claims, Mastima was actually a high-ranking demon in the demon world, holding a title and being given a territory. That''s why they are treated as human messengers like this. It''s nothing but humiliation. If the other demons found out about this, they could be the laughing stock of the entire demon world. But by no means did he despair over this situation. ''Slave magic? It will take a little longer with the current state of losing most of your power, but it''s still not impossible. "When I''m freed, I''ll take revenge on you in a way that''s more frightening than death, you know...?Heehahahahaha! He was scorching his chest with the fire of vengeance, and he was waiting for the moment with a tiger''s eye, even as he complied with Master Sama''s orders. It would be troublesome if he was noticed on the way, so he needed to find the right moment. Fortunately, he had heard that humans, unlike demons, were creatures that would always sleep. While they were sleeping, they were completely unprotected. Now go to sleep. That will be your last moments! --a week has passed. Unfortunately, master hasn''t slept a wink. d*mn, this guy doesn''t sleep well.... But it''s only been a week, and I don''t think we''ll get our chance that soon. Okay, enjoy your last moments. --It''s been two weeks. And you still don''t sleep. Now go to sleep! I mean, how long do people sleep in the first place? Well, I think I heard that you sleep reasonably often...? --A month has passed. Still no sign of master-sama going to sleep. Oi, oi, oi, oi, what''s going on? It''s been a month, man. Wasn''t the story about humans sleeping with each other a lie...? d*mn it!Who let that gossip get out? Mastima shudders in anger, but of course the story is not a lie. Humans usually get their sleep at night. Of course, Arel was unusual. However, if you ask him, "I sleep properly every night, ''''Um, master-sama........'''' What''s up, Matty? With no other option, Mastima decided to ask Arel one day with a clinging thought. ''I''ve heard that people sleep regularly...'' "Hmm. That''s right. Every night I sleep until morning. About six to eight hours. Every day?And for eight hours! Mastima was surprised. It was unthinkable in the harsh environment of the Demon World. If she was exposed to defenselessness for that long, she would soon die in the demon world. ''''........But it looks like Master Sama isn''t sleeping at all.......'''' He had been watching for an opportunity all night, every night, and he had been training in magic without any interruption at all, day or night. ''I simply train in my sleep,'' said Arel, absent-mindedly. ''I simply train in my sleep. I didn''t understand what he was saying, Mastima thought. Oh, I can''t do this........ 73-Episode 39: Does Someone Tell Me Rumors? In the magical city of Alsubel, there are six academies evenly distributed in a circle. The majestic tower-shaped structure located right in the center of the city is the city hall that manages the city''s operations. A conference room is set up on the top floor of the tower. Six wizards were gathered there around a round table. All of them were [the highest level]. ''''Looks like we''re all here! The one who confirmed this in a loud voice was the Dean of the Red Academy, the Magic King Redra-Ackermen. He is a big muscular man, not unlike a wizard, and his age is forty-two. Of course, he is a master of red magic. He is loved by his subordinates because of his big-hearted nature, but he loves fighting and was known as the most belligerent person among the six. ''''I don''t need to tell you every single thing, but anyone can see it when they see it. The one who said coldly with a slight frown at Redra''s voice was the Dean of the Blue Academy, Witch King Bruna-Aoline. She is a stern at best, a nervous female wizard at worst, and her age is forty. As a user of blue magic, she is incompatible with Redra, both in terms of personality and magic, and they are so-called dog monkeys. ''''It''s an important dean''s meeting that will decide the future of the city. Don''t be so tense between the two of you.'''' The one who intervened between the two glaring at each other was the Dean of the Green Academy, the Magic King Glynn-Elmidori. He was a primitive man with a beard growing around his mouth that exuded dignity. His age was fifty-one. A user of green magic, he is the most sensible person among these six academy heads with a strong habit. Inevitably, he often had to break a bone to bring everyone together. ''''Kakka. ''''It''s better for the young ones to be a little bloodthirsty,'''' That''s what the Dean of the Yellow Academy, the Magic King Ieroa-Kilesh, smiles cheerfully. He is a short, gray-haired old man, and his age is by far the oldest of all of them, at eighty-five years old. It is a cunning man who is a good-natured wielder of yellow magic, but he is a cunning man who has a thing or two in his heart because he has been one of the leaders of this city for many years. It is a cunning man with a cunning stomach that holds a thing or two in his hands.Do you think I don''t know that you''ve tried to get to my students? The one who nailed Ieroa like that was the Dean of the White Academy, the Saintess White-Alshiron. She is a blonde beauty, and even her charming smile is said to have healing powers. She is the youngest in this group at thirty-four years of age. It is said that she is an expert in white magic to the extent that she can even repair physical defects, and patients come to her from all over the world. A whispering voice came out. The one who uttered it was the head of the Black Academy, the Dark King, Brag-Lacro. Although nearly two meters tall, he has a physique as thin as wire. I''m not sure what he looks like because his face is covered by his all-stretching, pitch-black hair. His age is unknown. He is the most famous black magic user of his day, but as you can see, he is a commie. ''''Then let''s get started. And it was a middle-aged man with a beaming smile who announced the start of the meeting. His name was Noel. He was the only one in this group who wasn''t the dean of the academy, and he was the mayor who was responsible for running the entire magical city. He was here as a facilitator of the meeting or as a mediator between the deans who tended to have conflicting opinions. Perhaps he was the only one who could remain undaunted in front of the highest-ranking wizards gathered together. ''''First, let''s talk about the grant. As soon as I started to say that, the atmosphere of the place changed. Today''s meeting was nearing the end of the fiscal year. It was expected by the deans of the academies that the amount of grants to each academy would be discussed as usual. This is why the air was more tense than ever even before it began. Currently, more than half of the taxes the city collected from its citizens were distributed to the various academies. Since the city is a magical city that has a magical academy, it is only natural that they are given preferential treatment, but the problem is the ratio of distribution to each academy. There is no way the six academies can receive the same amount. Since the number of faculty and staff, students, and contributions to the city were different, it was inevitable that a disparity would be created. Naturally, each academy director would try to get as much as possible. For that reason, it was a tradition in the dean''s meeting to exaggerate the achievements of their own academy and to further discredit the other academies. ''''As a matter of fact, we got a hell of a new student in our school this year! Noel responds to Redra, who says loudly and happily. ''''I didn''t know you were as much of a student as Redra-sama says you are. I see, it''s very exciting.'''' Hey!Seriously, he might be capable of succeeding me as dean! Then it was Bruna who interrupted him. ''Is it my imagination that I''ve heard the same thing five times before?And unfortunately, it''s not as if we hear about what those people are doing now. What? Redra raises her voice, but Bruna ignores it and continues. ''''Actually, this is a genuine candidate for the future dean of the academy who has been admitted to my place. ''How. Even in the Blue Academy?That''s very promising. And that''s when Glynn opens his mouth. ''''Mm. As a matter of fact, we have a very promising student coming into our academy. To the Green Academy? It was unusual for Glynn to be so confident, and Noel looked surprised for the first time. Furthermore. Actually, I have one too. Oh, it''s quite a rare occurrence. My school is one of them. Even Yelloa and White said the same thing. ''That''s ... well that''s certainly unusual. Noel nodded his head at the assertions of the deans of the various academies, as if they were in agreement. "Heck! For some reason, I suddenly sneezed. Is someone gossiping about me? 74-Episode 40: There are still many weird people in this school Then the next Festival of the Demon God will have great expectations. At Noel''s words, the deans nodded confidently. The Mage God Festival is a festival held once every two years to honor the Magic God, which is considered to be a fantastic Super Grade Job. It is held at the end of the fiscal year, but this year was the year to hold it, and preparations were already underway for the entire city. The "Six College Magic Tournament" sponsored jointly by the six colleges was the highlight of the event. It''s not just a matter of time before you''ll be able to get your hands on a new one. The amount of grant money for the following year, which is currently being discussed, is often finalized based on the results of this competition, so all the academies will do their best to win. This was what made the tournament so exciting. ''''Currently, here''s what we think the percentage of grants for the coming year will be,'''' As he said it, Noel handed out the materials to each of the deans. The basic flow is to use this as a basis for discussion and a final decision. It''s a good idea to be able to have a good idea of what you want to do with it. It''s a very good idea to have a good idea of what you''re going to do with it. It was partly because they were confident in the magic competition, but more than that, it was because the distribution rate of all the academies had increased significantly from previous years. No, there was only one person who looked at the data and shuddered with anger at the wawa. He was the head of the academy, the only one who had been forced to take a large cut in the grants from the other five academies. It was the dean of the Black Academy, Brag-Lacro. ''''What do you mean by this...?Why, why, why is it that there is more than 40 percent less than last year...? Brag glares at Noel with his gazing eyes through the gaps in his overgrown bangs. It looks like he''s about to curse and kill at any moment. Noel is somewhat pressured, but he says once and for all: ''It''s rather too much. ''''Rather, there have been too many so far. The Black Academy is less than a tenth of the other academies in terms of the number of faculty and staff, the number of students, and the contribution to the city. And yet, we''ve always heard from other institutes that we''re receiving too many grants and that we should be receiving less. The five deans, except for Brag, nodded in agreement. ''''Therefore, we have decided to rectify the amount to be appropriate for next year. It''s impossible for me to do this kind of research for this kind of money... Brag insisted, his voice and body shaking. It was Redra who snickered at that. ''''Oh, come on, to begin with, have you guys ever done even one proper study in the past?They''re all just crazy, crazy magic. I''m going to insult black magic with......... Brag shouted angrily in a flipped-out voice. ''''It''s true that black magic is a dangerous magic that has been designated a forbidden spell in some countries. Maybe it''s time for this city to have a second thought. White says. As a user of white magic, she hated black magic, which was the exact opposite of that. ''''You mean you''re going to ban black magic........? Of course you do. No, of course it''s just a suggestion. ...for now. Noel coughed loudly as if to cut through the sour mood. ''''Well, we''re not planning to discuss that area at this time,'''' ''Oh, yes, that''s right. I''m sorry for saying something so unnecessary. ''''For now, tentatively, is the plan I mentioned earlier correct?Of course, in the end, it depends on the outcome of the magic competition. ""No objection." While everyone nodded their heads, naturally, only Brag stared at Noel with a look of disagreement. ''''No, no, Dean Brag. As I said, there''s still the magic tournament to come. Depending on how well the black academy performs there, it''s quite possible that the amount will be the same as usual. Noel said so, but the deans were all convinced that there would not be a single possibility of that in all likelihood. After all, the Black Academy kept shrinking in size year after year. Even so, Brag hadn''t taken any measures, and he didn''t have the dexterity to reform it now. Eventually the meeting ended, and everyone busily returned to their respective academies. Brag also went to the black academy with a half-empty mind. However, his initially wobbly steps gradually became faster and faster. ''''Bump, bump.......'''' He seems to be thinking about something and walks away, letting out an eerie voice. People on the street are looking back at him with a start, but he doesn''t even seem to notice them. By the time I came back to the academy, which is lined with abandoned school buildings, I was almost running. On the way, he bumped into someone and stumbled, but he didn''t care and headed to his own lab. ''Hm?As usual, there are a lot of weirdos in this academy. That''s one way to talk about people. What did you say, Matty? It''s nothing, master. And so when he reached the laboratory, there was a light in his eyes that wasn''t despair, but a dangerous madness. ''''Kukku, kukku, kukku... kuhahahahahaha!Gehohohohoho........ He sweltered, probably because he let out an unfamiliar laugh. ''''.........This will work. 75-Episode 41 Lets Introduce The Magic God Festival and the Sixth Academy''s Magical Congress has begun. The magic city is bustling with tourists from all over the world. It''s just like a Sunday market held in a public square, with stalls and stalls lining the main streets. Among them, the most remarkable event is the magic competition of the six colleges, which is held for five days from the second day of the festival. The organizer is each academy, and this year it was the Green Academy. Of course, the venue is also in the premises of the hosting academy. Each academy competes with each other in various ways, and finally the winner and the runner-up are decided according to the overall results. One of them is the rookie division, which is held by six students chosen by each academy under the condition that they must be in their second year of schooling. Each student will use magic to complete several tasks and compete for excellence, and the best student will be chosen. The officials usually select these students carefully. The reason for this is that only one student is allowed to compete, but since it''s on the first day of the competition, if you can get a high score here, you''ll have a big advantage in this competition. Today was the first day of that tournament. The heads of the six academies had gathered at the dignitary''s table set up in the largest stadium of the Green Academy, the venue for the competition. It''s a good thing that you''re not going to have to worry about this. We''re going to push them off in one fell swoop at the start. ''I''m sorry to say it, but I have no doubt that the blue academy will take the top spot on day one. ''''No, I have great confidence in our school this year. Let us take the top spot for sure. I''m sorry, but I feel the same way. After all, we have the best players in the last ten years, or even twenty years, by far. Well, now that you mention it, the student I''ve chosen is the best one we''ve had in our entire history. All the principals seem to have no doubt that their students will win. That may be why they are more enthusiastic than usual. You can''t say that now. .........And isn''t one person missing? ''You don''t have Brag from the Black Academy. He''s probably tired of watching them lose so badly, as usual. Or maybe he''s just given up. It looks like the Black Academy will be closed soon. Well it looks like we''re here. Newcomer of the Year. Redra, the head of the Red Academy, turned her attention to a young man. He walked towards us. There was a tradition that participants would come to greet the dean''s team before entering the competition, and he must have been taught that by a faculty member or staff member, and he was about to come here to the guest room. He is about 18 or 19 years old. He is a bit old for a newcomer, but as long as he meets the requirements of being within two years of entering the school, there is no problem. ''''It looks like my institute''s contestants have arrived as well. And the head of the blue academy, Bruna, said. The one who nodded his head to that was Glynn, the head of the green academy. ''''.........?From the looks of it, it seems that the only people coming towards us are the contestants from our academy.... In addition, the Yellow Academy''s Yelloa and the White Academy''s White That''s odd, isn''t it?I can only see the contestants from my academy, but... That''s my line, isn''t it? While they all insisted on the same thing, the young man came to them. ''I came because you told me to go and say hello. Right after the young man said that. I''d like to introduce you to someone!This is the contestant from our academy, Arel! ''Let me introduce you. This is Arel, a contestant from the Blue Academy. I''d like to introduce you. This is the contestant that our school has chosen, Arel. Hmm, let me introduce you. This is the representative of the Yellow Academy, Mr. Arel. Let me introduce to you. He''s the man I''ve chosen to be the best contestant, Mr. Arrell. The voices of the deans overlapped. ''''........what? It was not long before the other academy heads realized that the person they had assumed separately was the exact same person. Brag, the dean of the Black Academy, was the only one who had not gone to the stadium where the competition was taking place, but was inside a certain building on the grounds of the Green Academy. It was currently undergoing renovation work, but since it was closed during the festival period, the workers were also absent. A magical laboratory was set up in its basement. In the gloomy but spacious place, Brag hadn''t rested at all since last night and was simply absorbed in a certain task in silence. ''''It''s done...'''' Eventually, he stopped his hands, and he laughed with the corners of his mouth hanging up in satisfaction. ''''Kukku........this.......this.......should be able to.......remind......those......ah, those fools......of.........the awesomeness of black magic. Almost overnight, he drew a huge magic circle on the floor. And as Brag poured out his enormous magical power, the magic circle composed of intricate patterns began to glow. Immediately afterwards, a tremendous light erupted and dyed the underground laboratory black. Yes, it was a miserable black light. When Brag, who had been meditating unconsciously, opened his eyelids fearfully, what was summoned there was-- "Oh, whoa.... I couldn''t finish saying its name because the demon that appeared suddenly reached out and grabbed Brag''s thin body. The reason for this is because the demon that appeared suddenly reached out its hand and grabbed Brag''s thin body. ''Wait, wait!I am your master.........I didn''t order you to do this...?S-su, s-su, let go of me now! He hurriedly ordered that, but Why?Why, why don''t you listen to me...? There is no sign of compliance at all. On the contrary, it pulls Brag closer and tries to take him inside. ''Ka, ka, body!No, no, no, no!Owwww-- The scream was interrupted. That demon, which had sucked (...) the body of Brag, was not satisfied with that alone. --It was hungry. Just driven by that desire. Searching for tasty prey, the demon crawled out of the underground laboratory. 76-Episode 42 No, is that true? The first day of the Sixth Academy magic competition. It seems that I have to participate in the rookie division of the competition. The other day, the head of the academy personally told me that I had to participate in the competition. And from five academies. Well, I don''t know what they''re going to do, but it''s okay to do it all at once. "...Is it the type of thing you can do, master-sama? The contestants seemed to have to greet the deans, so I headed to the guest of honor section of the convention hall. There were five deans there, and as I approached, they seemed to have noticed me and all eyes were on me. Apparently, the dean of the black academy has not yet arrived. ''''I came because I was told to go and say hello. When I tell you that. I''d like to introduce you to someone!This is the contestant from our academy, Arel! ''Let me introduce you. This is Arel, a contestant from the Blue Academy. I''d like to introduce you. This is the contestant that our school has chosen, Arel. Hmm, let me introduce you. This is the representative of the Yellow Academy, Mr. Arel. Let me introduce to you. He''s the man I''ve chosen to be the best contestant, Mr. Arrell. The five of them said in unison. And at the same time let out a dumb voice. ''Huh?What the hell are you guys talking about?This guy is one of my students.He''s a gem of a student who, as soon as he entered the school, passed his progression exam to the second grade with a perfect score. The head of the red academy, who had first changed his mind, said with an irritated look. ''''What do you mean by that, sir?He is undoubtedly a student of the Blue Academy. Not only did he advance to the second grade in his first year at the school, but he is already a master of blue magic to the point where he can overwhelm even the practical skills teachers. It was the Dean of the Blue Academy who countered that. ''''Well, wait, wait. He was the contestant from the green academy. Although he is a rookie, he is one of the best in fifty years, winning all three major flying races. I personally made a special exception and promoted him to the second grade. The headmaster of the Green Academy interrupts. The headmaster of the Green Academy interrupts him, "Oh, what are you people saying?He is the genius behind the development of a new type of golem that has never been conceived before.Next year, I''m going to move him up to the top grade and give him a lab to work in. The dean of the Yellow Academy also insisted on being defeated. ''''What do you mean...?Even in our academy, he has jumped to the second grade and is now known as an expert in white magic that surpasses even the teachers...? It was the head of the White Academy who said in a bewildered manner. ''''Hey, hey, hey!What is it then?Are you telling me this guy has been admitted to five different academies and has an unheard of track record in all of them?Ha, this is ridiculous!It''s not going to happen! The head of the Red Academy sniffed and kicked him off, but there was nothing wrong with that. ''''No, you''re right, though?'''' And that''s when I dismissed his idea. The ground shook violently as a roar came from somewhere. I turned my gaze in the direction of the sound and saw a cloud of dust rising beyond the wall that surrounded the stadium. ''''What the hell is going on?'''' The dean of the Green Academy used a flying magic and flew into the sky. I soared after it too. Looking down from above, I immediately realized what had happened. One of the buildings of the academy had collapsed. It was a building that was under construction for renovation. But the construction work must have been closed during the festival. ''''Whaaaaat?'''' What the hell is this? There was a scream. Something had crawled out of the rubble. It was a huge, shaggy mass. It was two or three meters long, the visible part alone. Considering that parts of its body were still buried in the rubble, it could be even bigger. It was a disgusting mix of black, purple, and dark green, and the mucus covering its surface glistened in the sunlight. It''s probably a living organism from the fact that it''s moving. "........slime? I utter my guess. Next to me, the head of the Green Academy grunted. ''''Oh, you think that''s slime?I''ve heard that there is a slime species called King Slime, a slime species many times larger than normal slime... but those colors... ''I don''t know what he ate to make him look like that, but he''s probably discolored. The slime changes color depending on what it''s eating. But how did they suddenly end up here? People run away from the giant slime as it suddenly appears, eating bubbles. Meanwhile, some skilled wizards went against the flow and approached the slime. Firelance! "Ice Storm! Windcutter! He unleashed an attack spell. "What? As if it''s not working? Shh.... The giant slime was unperturbed by the direct hit of the magic. It didn''t appear to have taken any damage. Slimes are known for their high resistance to blows, but their resistance to magic should not be underestimated either. ''''Hm?But that one didn''t work, rather than... ''Oh my God! Before I could utter a word of discomfort, a single loud scream rang out. I thought the slime had reached out like a tentacle and grabbed the closest wizard and dragged him back to his own body. The wizard flailed frantically. Other wizards attacked the tentacles in an attempt to help him, but it was still as if they were ineffective. ''''No, no!I-tah, I-tah, help-- As it was, it was taken into the body of a slime. ........Hmm......it seems that this wasn''t just any king slime. 77-Episode 43: This is the bag mouse A huge slime appeared out of nowhere and turned the Green Academy, where many people had gathered to watch the tournament, into a screaming street. Moreover, the wizards who seem to have some experience in their craft are trying to repel it with their offensive magic, but it doesn''t seem to be working at all on the slime. On the contrary, some of them were caught by the slime''s outstretched tentacles and became prey. ''''Quickly take shelter!'''' Leave this to us and take refuge! At that time, there was a new group of people who rushed in. ''''Oh, it''s the Dean of the Red Academy! ''''There''s also the dean of the Blue Academy! No, the deans are all coming towards us...! They were the deans of the magic academy who had gathered for the tournament. To be exact, though, except for the dean of the Black Academy. They were all [Highest Position] wizards. The people who knew this were convinced that they would be able to defeat that slime. ''''Haha, the d*mn slime!Don''t interrupt the tournament! The first person to come to the scene was Redra-Ackermen, the Dean of the Red Academy. ''''--Prominence! He delivered a tame blow - a top-grade red magic. Red lotus flames covered the huge body of the slime, and a scorching wind blew across the area. Despite being exposed to the scorching heat, the people who were on the run involuntarily stopped in their tracks and shouted oohs and ahhs as they cheered. The prominence was said to damage even dragons protected by scales that were highly heat-resistant. No matter how much resistance that slime had to magic, everyone was sure that as expected, there wouldn''t be a single pause in this. But the next moment, for some reason, the flames suddenly disappeared and a slime appeared from inside as if nothing had happened. ''''Wha...?Well, you don''t think that even the prominence is going to work...? A reasonably intelligent looking woman stands right beside Redra, who grunts in astonishment. ''''It seems that this is where blue magic comes in, isn''t it? It''s Bruna-Aoline, the dean of the Blue Academy. She assembles the magic formula with a speed befitting the Witch King. ''''--Permafrost. Immediately afterwards, this time the huge body of slime froze. A fierce chill blew across the area and the area instantly became extremely cold. But. ''What?The ice is melting... The slime was thawing at an unbelievable rate. Before they knew it, the giant slime had regained its viscosity and was shooting its tentacles at Redra and Bruna. They couldn''t move in the face of the approaching slimy tentacles. ''Groundwall!'' A thick wall that suddenly emerged from the ground prevented them from doing so. ''''Hoho. That was a close call. The Dean of the Yellow Academy, Yelloa-Kilesi, was catching up with him. It was so fast that it was hard to believe he was eighty-five years old. It''s just like the White Magic of the Saint. It''s as if you were 20 years old again. Apparently, he had been given a body enhancement spell. Right behind him was the head of that white academy, White-Alcyron. In addition, there was an elderly man coming down from the sky. It was the Dean of the Green Academy, Glynn-Elmidori. He had rushed here after issuing an evacuation order to his men. Furthermore, Ieroa created multiple walls around the slime behemoth. ''''This is the rat in the sack,'''' Tornado! While flying in the sky, Glynn unleashed a green magic at the slime that had been deprived of movement. Redra and Bruna also aimed at the inside of the wall and launched their attack magic. ''''Wow....'''' The deans are fighting with each other. The people who were running away involuntarily stopped and were fascinated by their fighting style. ''''Haha, with this, that big slime won''t even be a pile--'''' Someone was so sure of their victory that they were about to say so. ''Ha!The walls....? Glynn was the first to notice it and shouted. The earthen barrier created by Yelloa was being melted from within at a terrific rate. The thinned wall was unable to withstand the slime''s huge body and collapsed easily. ''''.........Oh, hey, hey, seriously, you can''t care about magic at all, can you? Bruna denied Redra''s stunned words. ''''No........it''s not that that wasn''t working.......'''' White takes over her thoughts, which have been slipping away from her buttocks due to her avoidance of the worst expectations. ''....absorbing magic? A shiver ran through the Hundred War College Deans. It is well known that slime has the ability to absorb substances. They absorb plants and animals into their bodies and use them as nourishment. But I''ve never heard of it absorbing magic. But the fact is that the slime in front of me was clearly getting bigger every time I attacked it with magic. Compared to the first time I saw it, it would now have swelled to twice its size. If our magic is not only ineffective, but also absorbs it and increases its power-- There''s no way we''re going to win in any way... Redra, the most belligerent of the five, unintentionally let out a weak word. After all, this is a magical city. All of them only know how to fight with magic. If they couldn''t use it, they were completely out of control now. ''''Whoa!'''' What? The moment they showed an opening, the slime reached out its tentacles again. Five in all. It was aimed at all of the deans. Glynn quickly ducked it and escaped into the sky. Ieroa and White also avoided it easily, probably thanks to their enhanced physical abilities. But Redra and Bruna are caught. They are wrapped around my body and pulled. ''d*mn!Get the f*ck off me!Firelance!Firelance! Oh, Ice Edge!Ice Edge! They unleashed their magic without restraint, but it was still as if it was ineffective. Glynn also tried to sever the tentacles with wind magic, but he couldn''t even scratch them. ''''Yah, stop it, whoa! ''No! When they screamed furiously in front of the fate that would follow them, that''s when. BOOM! Glynn saw something snatch his side and swoop down at the slime. A person. And a sword in its hand. ''''Arel!'''' Shortly after Glynn realized his true identity, the sword he swung at severed the slime''s tentacles with unbelievable ease. 78-Episode 44: Isnt he a Wizard? A giant slime was rampaging below them. The wizards who were nearby were fighting. But none of the magic they unleashed seemed to be working. On the contrary, the slime seems to be getting bigger every time it eats magic. ''''Hyahahaha!You''re wasting your time!Magic is counterproductive to that!--Buggy? He plucked up the head of the messenger who was laughing loudly beside him. ''''Idee-dee-dee?'''' Hey, you know that slime thing?Speak up. Get the f*ck off me before I do.No, let go of me, master. Matty told me with tears in his eyes. ''''........That guy is the strongest and worst slime that is feared even in the demon world, Death. It''s called the Gratney Slime, and it absorbs everything and anything that''s possible and grows infinitely huge. Magic is no exception to this. It looks like he''s eating magic, but he''s actually eating magic. ''How do you defeat it?'' Sirimasen. Oh, it''s true!So don''t try to grip it! Matty screams and struggles to escape from my hands. Then, as if remembering something. ''Keh, but I can''t absorb physical attacks, so I guess I can handle that...'' Oh, right, a physical attack. I take out my magic wand. ''No, no, no, I don''t think that''s going to work, right?It''ll just melt away easily, that''s all. I''d rather he was dead.... Do you hear me, Matty? What are you doing here? Hmm. It''s true that this staff is not very reliable. If it''s just a simple demon, a proper sword would be better to deal with that slime. "A simple demon...?You treat me, a high-ranking nobleman, like an equal demon........ With Matty muttering something, I decided to use alchemy magic to create a sword on my own. This is a magical city, and it would be hard to find a sword even if I looked for one. The sword blade is slowly appearing. With a metal that wouldn''t easily melt with that slime mucus, it would indeed take a little time. In the meantime, the deans of the academy had begun to engage the slime. All of them are [Highest Position] wizards. They are unleashing magic with a bang of power as expected. But it was completely counterproductive. More and more, the slime became huge, already almost double its original size. Apparently, they too had noticed the characteristics of that slime and stopped attacking and stood there aghast. ''''Alright, it''s done!'''' Finally, the sword is finished. It''s not bad for the first time to make it by myself. The sensation of holding the sword feels good in my hand. "No, stop! ''Oh no! Then I heard a loud scream from below. When I looked, I saw that the two deans had been caught by the slime tentacles and were about to be preyed upon. Bang! Kicking through the air and swooping down, I slice through two tentacles with my freshly made sword. ''''Hm. You managed to cut them properly.'''' The trial slash was successful, and the severed tentacles waited in the air and blurred to the ground. ''''Nah, nah........'''' Oh, are you? The two freed deans are on their asses and look up at me as if they are stunned. ''''What, why the sword...?'''' You''d be better off staying away from that. I turn towards the slime. Since I have no sense of pain, I was unperturbed by the slashing of my tentacles. ''''Mm?'''' I couldn''t help but raise an eyebrow. The two tentacles that I had cut off seemed to have approached the main body while slumping on the ground, but they went straight back inside my body. There were no marks left. In other words, the body was completely restored to its original state. I see. It''s nasty. Then why don''t we take it apart? The slime shoots out its tentacles and attacks me. I ducked it as I approached and slashed into its body. ''''What''s that body language!I can hardly see any movement on my part! Wow, me too... ''''And he''s slicing through a slime with a high level of physical resistance with his sword with such ease! Isn''t he a wizard? ''Body strengthening magic...?No, that''s not enough to get you there... If it''s body strengthening magic, I didn''t use it. It''s not that I don''t need to use it, but this is an excellent trick. The part you cut off will stick together quickly if you leave it intact, so I''ll kick it away as far away as possible. I stole the skills of the Sword Fist Fighter in the City of Swords, so I''m reasonably confident in my kicking as well. The huge body of the slime was cut into pieces as I looked at it, and before I knew it, there were chunks of blubber lying everywhere. Each chunk was smaller than the size of a fist at most. ''''As expected, if we shredded them to this size, they would have died. Wow, people around me cheered. ''That''s awesome, dude!He took down that giant slime all by himself! ''He''s probably a famous swordsman!I don''t know why we''re in a magical city! No, I''ve seen you at our school. Nonsense, you can''t use a sword if you don''t know how to use it. Wait, isn''t that guy the Triple Crown champion of flying? Such voices could be heard from all over the place. ........but in the next moment, the cheers froze. The countlessly scattered masses on the ground began to move at once. They gathered in one place and then regained their huge bodies in a flash. ''''Hm. You can''t defeat it even with this? 79-Episode 45: I would like to correct one before that I shredded it with my sword, but the slime returned to its original form. ''Even a physical attack does zero damage, huh? Well, unlike magic, it''s better that it doesn''t absorb power and become even bigger...'''' ''Hihahahaha!It''s the slime of the magical world!Eat this disgusting piece of shit up, idee-dee-dee-dee! What did you say? No demons, my master. Matty with an iron claw to the head. Weren''t they demons if my eyes could see them? You''re not going to use a demon as your...? "But it''s supposed to be black magic... That''s right, a demon, a messenger, and black magic? But he''s still a rebellious messenger. Shall I punish him a bit and let the slime absorb him? This isn''t some kind of punishment!Never!No, no, not even close, master. Puh-leeze! Hmm? Even though it didn''t do any damage, the slime escaped, shaking its huge body bobbing in fear as it was dismembered. Of course I can''t let it escape. It seems to be growing infinitely, and if it continues to grow more and more huge, the entire city will eventually be swallowed up. However, the question is how to defeat it... If you can''t use a sword, then I guess magic is the only option. ''Gah hahaha!I just found out that magic doesn''t work, it just absorbs it! I flew through the air with my flying magic and chased the giant slime. ''Green magic!How come he can even use green magic? No, I used it earlier when I was swooping down from the sky. We''ll need to slow them down for now. --Groundwall x4. Four walls appear to surround the giant slime. They are huge walls that are twenty meters high and ten meters thick. It would be absorbed anyway, but it would probably hold them back for a while. ''''Wha, now it''s yellow magic? He landed on the wall, still ignoring the startled voices coming from behind him. The slime reached out its tentacles and attacked me. While flicking it off with my sword, I began to form a jutsu in my head. Moreover, six complex jutsu in parallel. Through my relentless efforts since arriving in the City of Magic, I was now able to hold seven personalities at the same time. As a result, I was able to activate six types of magic at the same time. But if you simply hit the six spells, no matter how powerful each one was, they would just be absorbed by this slime. So, the last thing you need to do is to apply the jutsu formula to a single item. Okay, that''s it! The walls were already less than half as thick as they were, but they trapped the slime in place. There was no need to worry about dislodging it. A lot of high-level magic was accompanied by intense explosions, but it happened in complete silence. The slime and the walls that temporarily blocked its movements. They were extinguished in an instant. Immediately afterwards, a tremendous breeze arose. This intense air current heading towards the point of magic activation was due to the fact that even the air was obliterated. Annihilation magic - Illumination. As the name implies, it is the most powerful magic that makes everything disappear. ''''As expected, you could defeat it with this. It was a troublesome slime that would stick to you and revive you even if you cut it into small pieces, but there shouldn''t be an ounce of hope if your body is made to disappear. ''''Annihilation magic, you say........ Well, the illusory [super-grade job] and the legendary magic that is said to be able to be used only by the [Demon God]... As I soared into the sky again, I forgot to rejoice that I had successfully defeated the worst slime, and the deans were talking about the magic I handled in a daze. It''s true that annihilation magic is a magic that only the Mage God can master. Essentially. But I was looking for ways to reproduce it without skills. Although I soon figured out how to do it, it was only recently that I was able to actually do it. I knew the technique itself because my father taught me. Well, my dad is a "Magic God". Annihilation magic requires six different magic formulas to be assembled simultaneously. With no skills, I had to create multiple personalities and be able to think in parallel. At least six at the same time. For all intents and purposes, it''s a person, right? When I landed on the ground, the headmaster and others rushed over to me. "Hey, are you really a "magician god"...? What do I do...!How can I become a mage god?Tell me about it! ''Wait!That kind of information, let''s be taught for free, is too much of a bug!Arel, I will pay you enough for your services! Wow, the fantasticSuperclassified jobthat I have pursued for over half a century and have yet to reach...!How did you get there, Lord?Tell me about it!I''ll trade you for whatever fortune I have! "I''ll give it all away too!So, please...! Forgetting their position, they desperately plead with me. ''I don''t mind teaching you, but...'' Dad didn''t seem to have any intention of hiding it. Once you know how to do it, it''s up to the person to actually become a [super-grade job] or not. ''''However, before I do, I want to make one correction. I said, "I''m just a nobody. "I''m just unemployed. 80-Episode 46: Why? "Learn all kinds of magical skills to the advanced level...? That''s right. At least that''s how your father became a grimoire. The dean and the others begged me to tell them the conditions under which I could become a [super-grade job]. It''s only a possibility, so I don''t know if I can actually become one. "In other words, no matter how many times you pursue just one type of magic, you can''t become a [Magus God]... ''''That would make it fundamentally difficult with the current style of separating the academy for each magic...'''' ''''No, who in the world would think of learning multiple magic skills to an advanced level in the first place...'''' They are stunned. In the midst of all this, the dean of the Red Academy Hey, hey, are you sure your father is Leon? You know my dad? I know you and I are on the same page! Apparently, he was at the Red Academy around the same time. Indeed, this old man is about the same age as my father. Because of that guy, I''ve been second-best ever since I entered the school!The one who was being promoted as a candidate for the future dean of the school was not me, but him!And yet that bastard quit the academy in the middle of the second grade...! And then the head of the Blue Academy interrupted him. ''''Leon?Could it be that the little.... Do you know? ''''Or, he''s a junior who entered the school when I was still in second grade! I had heard that my father was in the magical city, but I didn''t know the details. After the red academy, he moved to the blue academy? ''''Despite the fact that he was expected to have a future, he dropped out during his second grade...'''' This time it was the Dean of the Green Academy. ''''It was back when I was a top grade research student. I remember well that there was a rumor throughout the academy that there was a ridiculous student. But he moved up to the second grade and left the academy after a while... ...So you came to the Yellow College afterwards. The dean of the Yellow Academy will take over. I was already the head of the academy, but as soon as I saw his yellow magic, I thought that my successor had finally appeared. But before I knew it, I dropped out of school. So you entered the white academy next........No wonder I thought you were so old for a new student. After all, he was older than me.... The headmaster of the white academy says as if he is nostalgic for the old days. And Dad said that the white academy also quit in the middle of the second grade. Perhaps he joined the last one, the black academy. ''''Hmm. So my father went to all the academies too? That''s probably how he learned all kinds of magic. "...and Dad? The deans of the academy came together. ''''I''ve been to all the academies just like my dad, you know. ""I thought it was ridiculous in a reasonable way!" I mean, you didn''t know? ""There''s no way I''m going to know!" Apparently the academies are independent of each other, so there''s no way they could know even if they shared the same students. ''''.........It''s impossible to assume that there are students attending multiple academies at the same time. To begin with, "in order" and "at the same time" are not the same thing. "Just like my father... ''And yet you jumped to a second grade in your first year of enrollment.......you''re way off the charts.......'' Even Leon''s in the dark... It''s a good thing I had my father teach me magic in person. I think that had something to do with it. It still took me three years to learn all the advanced magic. " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " No, we can shorten it considerably by using the separation of personality method. "''What is the "Separation of Personality Act? I explained simply. " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " That''s rude. As Matty told me, I''m a genuine human being. ''''Oh, I see. In other words, if you become a "Mage God" you can learn this skill called "separation of personality", right?No, that doesn''t seem to be in the right order... To begin with, the Separation of Personality Method is not a skill. Also, as I said before, I''m not a "Magus God" either. I''m unemployed. ""There''s no way!" Why don''t you believe me? The conversation was then put to rest once the mayor came running in. The first day of the convention was postponed to tomorrow or later, and the deans scattered in three or five places to try to fix the confusion or find out what caused that slime to appear. ''''But then again, I wonder where it came from? Some idiot didn''t know what he was doing and called you out. The only type of magic that summons something is white magic and black magic. However, if you were to summon a slime that dwells in the demon world, it would be the black magic one. Of course, it is impossible for a half-hearted wizard to summon such a powerful demon. ''''Come to think of it, wasn''t there the head of the Black Academy?........hmm? That''s when I saw a small chunk cross from rubble to rubble. I quickly followed it. Purrrrrrr! It was that fist-sized slime there. Hmm. It seems that you failed to make part of it disappear. He tries to run away quickly, but I quickly extend my arm to catch him. ''''If you''re this weak, your slavery magic might be able to get through. ''What?Don''t tell me you''re going to make this guy an errand boy too! 81-Episode 47: Something like a transparent body That''s what I thought. Pullls come in handy for pest control and garbage disposal. It absorbs all the dust, dirt, and dead insects that come out from cleaning after a long time. Thanks to this, I don''t have to go out of my way to throw them away. Puru puru puru! Poppin'' heads (?) When I stroked Pullle, she was happy to shake her body from side to side in a big way. I had named the slime of the demon world that I had enslaved Pullle. At first she was rebellious, but now she''s completely taken to me. ''''Same pet, but it''s a lot different from Matty, who only thinks about retaliating against me. Master, it''s never like that, is it? (...who''s your pet, you bastard!) I just heard who''s your pet, you son of a b*tc*. It''s just my imagination. Pullle absorbed a lot of things and got bigger, so I used annihilation magic to erase about half of his body. ''''If I don''t do this, I''ll get infinitely bigger and bigger. "I wonder why this slime misses me so much when it''s being treated so badly...? But he''s a slime, he won''t feel any pain. I don''t think that''s the point... Then there was a thump, thump, thump on the door. ''Matty,'' Yeah, yeah. Matty unlocked the door and it opened with a tremendous rush. ''''Bugeye!'''' A swing of the door blows Matty away. ''Thank God!He''s still here! It was the trio of Kite, Kufa, and Colette who rushed into the room with a change of blood. ''''Master!Is it true that you''re quitting the Red Academy? ''The blue academy too?I went to my dorm room and I was surprised to see that nothing was missing! ''Could it be that you''re moving out of this room too?Then the Green Academy too..... It seems that I heard the information from somewhere. I''ve already finished cleaning up the rooms I rented in the dormitories of the red academy and the blue academy, and I''m currently in the middle of organizing the rooms here at the green academy. I''ve been living in the six academies in turn, so of course I had to clean up all of them before I left. ''''I mean, I''m going to quit all the academies. I''m leaving this city in the first place. There doesn''t seem to be anything else I can do here. I''ve read through all the books in the library, and I can now use annihilation magic. There will be nothing more that I can learn from staying in the magic city. ''''Well I still had a lot to learn from my master...'''' I don''t remember being a master in the first place. Well, maybe you''ll stop by sometime soon when you get a chance. What are you going to do with this...? I''m going home for now. I''ve been away from him for a year without telling him. My sister Mira is going to be mad at me, and I need to take a bath with her. And after enough comforting. We''re going to the monster city. Demon City...? Isn''t that, as I recall, the city where all the demons of the world gather? What the hell are you doing in there? I said to the three of them, who looked at me curiously. ''It''s because I want to try to be a demon trainer next. ""What?" He left the city! It was Noel, the mayor of the magical city, who shouted in a screaming voice. ''''What in the world do you mean by that?A wizard as great as he is, a man who is said to be a ''magic god'' would never leave this city, how could it be possible for him to leave? The normally calm man raises his voice and questions the deans lined up. That''s just as it should be. He had estimated that the appearance of a wizard who had attained the illusory Super Grade Job, the appearance of a magician who was said to be the Magic God, would attract a large number of tourists from all over the country. The economic effect of this was immeasurable, and it was a great opportunity for the mayor, who was responsible for the city''s economy. Well, calm down. In the first place, we''ve already confirmed that he''s not a "magician" after a thorough appraisal. That said, the one who was unusually appeased was Redra, the Dean of the Red Academy. ''''The facts don''t matter!What''s important is the rumor that he might be a ''Demon God''! Noel counters. ''In any case, he said he was going to drop out on his own. The academy has no right to stop him from doing so.'' said Bruna, the dean of the Blue Academy. ''''Well, it''s your job to do something about that...! No, that''s not the Dean''s job. Dean White of the White Academy prodded. ''''It''s certainly a big blow to us, too, that we''ve released a wizard like him. But that''s probably inevitable. After all, there''s nothing we can offer him. Dean Glynn of the Green Academy admonishes us, "Kakashii, I''m afraid we are no match for him even if we are united. Unfortunately, even if we were united, we are no match for him. The Dean of the Yellow Academy, Yelloa, laughs pleasantly. ''''.........Mi, everyone is right.... But Mayor Noel.........don''t worry about it....... Because from now on, our six academies will join hands with each other, removing the ties of the past. Ah, the birth of a new "Demon God" is not far off... Then the Dean of the Black Academy, Dean Brag, spoke more passionately than ever. ''''........I understand. But in order to do so, we need to come up with a new system. We''re going to be very busy from now on, Dean Brag! Noel let out a deranged scream. Six seats for the deans to sit in. One of those seats was supposed to be empty. It was because the dean of the Black Academy had gone missing. ''''He came back too, didn''t he?Then you should have told me first. I was worried because I thought that you might have passed away. But you weren''t there just now, so when did you get there....... Ah, that?It''s like my body is transparent... Brag''s body was indeed thin and translucent. From his abdomen, the back of his chair was faintly visible. ''Kukukuk... wow, when you''re as old as I am it''s just as easy to come back from the other world...'' .... ..... Well, you''re not gonna... Something cold passed down Noel''s spine. 82-Episode 1 This is such a city After leaving the magical city, I was heading home as planned. Flying in the sky. I''ve learned flight magic, so I have no choice but to use it. It''s also much faster than driving a carriage around the city streets. It''s not only the simple speed, but also the ability to go straight ahead is significant. Since the city road bypasses forests and mountains along the way, the distance traveled is inevitably increased by that amount. If you fly through the sky, you can even pass through unbridged rivers. This would only take about a tenth of the time it would take to get there. ''''........Hm?It''s a city. I spot a city up ahead. Since I don''t remember, it''s probably the city I didn''t stop by on my way out. It''s a small city compared to a magical city, but it''s still protected by a fine wall, and has a population of a few thousand people. Since it''s a good time, I decided to stop by. I''m starting to feel hungry, and I want to eat. I have plenty of food, but I''m getting tired of preserving it all. Landing. Most cities charge an entrance fee. You might not have to pay it if you entered the city by air, but that''s certainly not going to happen. It''s not like I''m in a money crunch. ''''Hmm. You have two gates. I stopped dead in my tracks. Both gates were probably set up to enter the city. But their construction was different. The one is a magnificent one, beautifully arched, as if dozens of people could pass through it in a row. The ceiling was also high, and upon closer inspection, the walls were beautifully carved. The other was so cramped that if two people tried to pass through at the same time, their shoulders would bump into each other. The ceiling was low, and if you were tall enough, you might have to bend over. There was no decoration, just a shabby rectangular hole dug in the ground. In both cases, there was a screening process for entrance, but the more respectable gate was empty and people were walking through the gate in a hurry. There seemed to be no need to wait in line. On the contrary, there was a line at the shabby gate. I guess I''ll have to choose one. I head to the gates of the respectable one. But why bother standing in line? Then the gate guard stopped me. ''Are you a traveler?'' Yeah, but, ''Then you''ll have to pay for admission. What''s your occupation? I don''t know why they ask me what I do for a living all of a sudden. I don''t mind answering the question, but it''s very impolite. As I was wondering. If you can''t answer, you can''t enter the city. Oh, and false declaration is a felony. A felony?That''s about it? This is that kind of city. Hmm. If you don''t answer the question, it''s no use. Unemployed. When I told him that, the gate guard looked stunned for a moment. ...Is that true? Really. I can show you the certificate if you want. ''No, it''s not necessary as you''ll be appraised on entry anyway. Why do they even bother asking for an appraisal to enter a city? It''s a big deal, but it''s probably to prevent criminals from staying in the city. If you want to get into the city, you have to go through the gates over there. Saying that, the gatekeeper pointed to the shabby-looking gate. ''''The other gate seems to be more open? ''I can''t get in from there, I''m afraid. I don''t mind going over there, but I''ll just get chased away and have to do it twice. Really? It''s odd, but it doesn''t sound like you''re lying. And I don''t think it''s a good idea to lie about this stuff. ''I won''t say anything worse than that. This won''t be a comfortable city for you. If you can, I suggest you find another city. .... though if you still insist, you can do what you want. The gatekeeper said that advisably and left. What did he mean by that? Well, it''s no use thinking about it. I was rather curious, so I stood in line for the shabby gate as I was told. Because of the fact that each and every one of the entrants are being appraised, it is difficult to go forward. It seems that they are using a magic tool called an appraisal tool, but this is a rare magic tool. The larger gate has more than one, but this one seems to have only one. After waiting for about forty minutes, your turn finally comes around. ''''I will appraise you about your profession. Yeah. .........this is....... The examiner gasps when he sees the results of the appraisal. Then he snorted, "Huh. Then here''s the short-stay card. The price of admission is three silver coins. I pay the admission fee while taking my card. I looked at the card carefully and saw that it had the words "Short Term Visitor" (Grade 6) written on it. What is this grade? ''It''s like status in this city. There is always a grading system in place, even for short-term visitors. It''s an odd system, I thought, as I ducked through the narrow gate and entered the city. From the looks of it, it''s a very ordinary city. However, many people were looking down and walking down the street as if they were scared of something. On the other hand, there is a person who is cutting the wind with the shoulder like a very arrogant person. I have the impression that it''s a bit of a hiccup. It''s hard to believe they are residents of the same city. I''m sure you''ll be able to find a way to make it work. The devil''s best city in the world. Matty was muttering something fun. I walked off, trying to find a restaurant for now. I soon find a restaurant. It''s small and neat, and seems to be rather popular with the female demographic. I was hungry, and I didn''t care where. With that in mind, I decided on this restaurant, and as I walked in ''Oh?Sixth grade?No, no, no. We only allow third grade and above. They kicked me out. ''Gahhahahaha, you''re getting kicked out of the gate--geez! I mutter, clutching Matty''s torso. ''''........There are restrictions on entry based on grade?'''' 83-Episode 2 Im confident only in taste I don''t want anything less than fourth grade! No way I''d feed a sixth-grade cook to a sixth-grade cook! ''We''re an upscale shop specializing in second class and above!Get the hell out of here! I went to several more restaurants, but they all refused to let me come to them. I couldn''t find any restaurant that offered a sixth-grade meal. What can I do? Just when I was beginning to wonder if there was a restaurant that would allow the sixth grade to enter in the first place, I found a restaurant. It was so shabby that I wondered if it was really open. ''If it doesn''t work here, it''s probably not going to work,'' Thinking that this would be the last time, I walked into the restaurant. Perhaps because it was already past lunchtime, there wasn''t a single customer in the store. ''''........hmm?Welcome. A middle-aged man who was rowing a boat at the back of the store wakes up to find me. Perhaps he is the owner of the shop. ''It''s the sixth grade,'' ...the sixth grade? The man was blindsided. ''Can we eat here?'' Yeah. Hold on. The man nodded and stood up, put his apron back on and walked into the kitchen. I finally found him. I sat down at a nearby table and ordered a proper set meal. A few moments later, the food is brought to me. It was a dish of minced pork wrapped in cabbage leaves and stewed in tomato soup. The savory smell, with just the right amount of acidity, tickled my nostrils. ''Delicious,'' As soon as I put it in my mouth, the juices poured out of it. The cabbage was well seasoned and the tomatoes had just the right amount of acidity. Thank you. I''m proud of the taste, though. And this is how the customers are coming in. Apparently, there are usually not enough customers. Why? No wonder people don''t want to eat at a sixth-grade restaurant. The owner said as a matter of course and shrugged his shoulders. ''''You don''t seem to be a city dweller by any means, do you? I''m sure you must have realized that this is a city where there is a clear distinction between the first and sixth grades of occupation, and those in the lower grades are discriminated against in many places. That''s the kind of city we are in, you know. It seems that in this city, all professions are always assigned to some grade. That''s why that gate soldier warned me. He must have known that I, as an unemployed, would not even be able to use it for most of the shops as I would be in the sixth grade, the lowest grade. ''''It''s a city that''s like heaven for upper grade people, but for lower grade people, it''s hell. It''s a paradise city for the higher grades, but hell for the lower grades. It''s exactly the same as slavery. Discrimination based on occupation is not uncommon. But this is the first case that is so blatant, or rather, the city itself is promoting it. I''m sorry, but they don''t even treat me like a human being when it comes to the sixth grade. Do they think they have some kind of bad disease or something, to the point where they don''t even want to come near it? ''Then why did you let them in at grade six? At my question, the shopkeeper often looked like he had swallowed something bitter. My daughter is also a sixth grade. Then, as if to break the dam, the shopkeeper vented his anger. ''He''s no different than any other human being!She''s pretty to look at, and she''s a sweet girl who cares about the feelings of others!By the time I was ten years old, I was very popular with the customers, and the neighborhood kids even confessed to me once or twice!And yet........the moment the occupation given to me by the goddess was "Unemployed" and I reached the sixth grade, all of them seemed to have changed their hands......!He himself hasn''t changed at all! Hmm. I see that the owner''s daughter is an unemployed woman like me. .... but there is hope. "Hope? Yeah. Have you ever heard of the Empire? No, I''ve never heard of it. There is a country that was established only a few years ago and is now a great power, with one place after another under its control. It''s a dream country for my daughter. It''s a dream come true for my daughter. Is there such a country? It would certainly be nice for people who are struggling for their profession. Well, it''s not my problem. ''I''d love to go there right now, but unfortunately, citizens of the sixth grade don''t have the right to go outside the city. But the country is close by, and rumor has it that they''ll be targeting this city next. It would be bad if someone of a higher grade heard about it, but I''m hoping they''ll attack us as soon as possible. And then the owner looked up as if he noticed something. ''''Well that''s strange, isn''t it?I think it''s about time you came home. Is this about the girl? ''Yeah. I''m having the market go out to buy some things for me... The proprietor twists his eyebrows anxiously. ''If you''re worried, why don''t you go see?Thanks for the treat. He had finished eating while he was listening to the owner, so I paid for it while suggesting that. I came to the market with the shopkeeper. Many stalls are lined up in a row. A lot of people are coming and going, it''s quite a busy place. But even so, there are only a few shops where you can buy the sixth grade. That''s when the owner blurted out in frustration. ''I''m sorry, I''m sorry, please forgive me! I turned my gaze towards the voice. A girl, about sixteen years old, was frantically apologizing to the young man with her head down. The man had what appeared to be a whip in his hand and was about to strike the girl. The proprietor of the shop shouted with a hint of blood. ''Melia! "...hmm?Oh, Dad! 84-Episode 3 Apparently, the girl is the owner''s daughter. Melia! Oh, dad. The owner rushes over to him. And then he crowded the man who was about to whip his daughter. ''What are you doing to my daughter?'' Oh, so you''re her father. The man sniffs fearlessly. The hair on his head is beginning to thin, but his age is probably in his mid-twenties. He''s obviously well dressed and exudes an air of arrogance all over his body. ''''Look at this.'''' The man pointed to his feet. But there was nothing there. At best, there is mud on the expensive shoes. This woman stepped on my new shoes," he said. She said, "She stepped on my new shoes, and they are the sixth grade. I''m a 2nd grade man, but I was stepped on by a 6th grade woman. It''s a terrible humiliation, isn''t it? The man says, as if he is really sad. Nah... On the other hand, the shopkeeper seemed to be frightened by the word second grade. ''''That''s why I was just about to punish this guy. Oh, please... no, please!Please, please be lenient with me! The shopkeeper hurriedly knelt down on the spot and pleaded with the man to bow his head. The man cleared his throat happily at that. ''It can''t be that way. For the sake of the future, we''ve got to make a good show of it here. You know what would happen if a sixth grade were to show disrespect to a second grade? The man is grinning. He''s talking about a great cause, but I guess he just likes to be tasteful. ''No, no!I''m not... I''m not trying to step on your foot!Suddenly he stuck his foot out...! ''Oh?You''re not going to blame me for this, are you?At the sixth grade? The man kicked the girl''s body. ''''Sh........'''' The slender body collapsed. Unfortunately, it was the ground that was terribly muddy from the rain, and the girl''s body was stained with mud. Or rather, he dared to kick her in that direction, knowing that it would happen. Then the man raised his whip. The girl cowered. A whooshing sound cut through the air and the whip was swung down on her body. --Passion. ''''Hmm?'''' The man raises his eyebrows, probably because the sound that rang out was surprisingly small. And soon, he senses my presence standing on the other side of the room with the girl between us. "...what are you?When did it get there... what? The man gasped as he realized that I was plucking the tip of the whip with my fingertips. ''Mmm, you caught the whip...?No, no, there''s no way you can do that. The man shakes his head and dismisses his own speculation, but there''s nothing wrong with that. He just approached and grabbed the girl''s body before she struck him. In general, the tip of a whip is much faster than a sword due to the force of the wrench, but this man''s impotence is not much of a stretch. It was such a trivial matter that he could only grab it with his fingertips. ''''You said you''d tell me what happens if the sixth grade is rude to the second grade?'''' I ask, while lightly pulling my arm back and snatching the whip from the man. "Yeah, what about it? The man glares at me, clearly scared and strong. ''''My occupation is Unemployed. In other words, I''m of the sixth grade too. ......... ''By all means, tell me. For example, let''s see what happens when you punch a second grade man in the face and make him spew a bloody nose. I slammed my fist into the man''s face. ''B-Gooh!'' It blew away about five or six meters and the man was knocked into a nearby stall. Merchandise littered the area. ''Did you faint?'' The man was white eyed and passed out. A lot of blood is sloshing out of his nose. Of course, all of the blessings that would take care of his injuries are gone. It''s surprisingly difficult to do damage with just enough salt to cause a bloody nose like this. If it''s too strong, you''ll die, and if it''s too weak, your body won''t be damaged by the blessing. ''''Well, seriously, that guy........'''' If a sixth-grade student does that to a second-grade student... The onlookers who had gathered there were buzzing. The shopkeeper and his daughter were also stunned. Apparently, in this city, it is that unlikely that a person of a lower grade would turn against a higher grade. Well, it was none of my business. ''''Hey, wake up.'''' I spray the man with holy water that restores his blessings and then slap him back and forth on the cheek. ''''Hmm........'''' The man slowly opened his eyelids as he seemed to regain consciousness. ''You''re awake.'' Huh? As soon as he saw my face, he made a twitching noise and jumped up. Then he hurriedly took a couple of meters away from me. ''''Ki, ki, you!Don''t think I''m going to get a free pass for doing this! The man raised his voice, but he was completely out of his depth. ''So you''re asking me to tell you what''s going to happen? Get out of here. Get out of here! I stepped out of the way and the man took a couple more steps back. And that''s when. ''Nah, the security forces are here! Oh, my God, run before this thing goes sideways! I heard such a voice. Then the man suddenly becomes vigorous and starts laughing. ''''Ha, ha, ha!I think the security forces have arrived!Now you''re done! Immediately afterwards, a group of armed men appear in place of the onlookers who had fled in a hurry. ''Security forces!To the higher grades, where is the one who has committed an act of violence! That''s him! Soon I was surrounded by them. ''I see. So this is what happens.'' 85-Episode 4 Of course, the death penalty The place where I was taken by the security forces was the castle of the lord who rules this city. I''ve been using white marble, which is rare in this area, and gold and silver jewels are shining here and there. It''s a gorgeous and opulent display of one''s power. Upon entering the castle, I was taken into a small windowless room. The reason why the freedom of my arms and legs are not taken away is probably because I''m proud that I can''t do anything at the level of "unemployed". ''''Wait here until you''re ready. A respectable bearded man, who seems to be the leader of the unit, announces in an intimidating voice, ''''You will now receive a ruling from your lord. ''''You will now be subjected to an adjudication by your lord. I see. You don''t know this, but the only first class lord in the city is the Magnate. You should know that there is no point in getting upset. Because the skills of the Grand Lords are irreversible to anyone. "Hmm. Perhaps, as the name suggests, it''s a skill that forces an opponent to carry out an order. No wonder the majority of people in this city are of a lower grade, and despite the fact that they are unfairly discriminated against, no one is trying to rectify that. So, if they have such skills, they can''t revolt. By the way, I was the only one taken away, and the owner''s daughter, who was accused of stepping on my shoes, was not looked at. The man, who said he was of the second class, only cursed and ridiculed me, and I guess he forgot about the girl after being punched in the face. A short time later, I was moved through the castle again. I came to a luxurious room. At the back of the room, I sat on a throne-like chair. The man sitting on a throne-like chair was around forty. He was not very tall. But because of his wide width, he is quite a big man. His abdomen is unusually large around his belly, and his neck is barely visible due to his terrible flab. In short, he was insanely fat. But he has no intention of losing weight, and on the pedestal beside the chair is a plate with a large amount of fruit and meat on it. He didn''t look at me as I entered the room, and was devouring the meat on the bone with gusto. I handed the finished bones to a beautiful woman nearby and she turned to me, licking her greasy fingers with her tongue. Then, for the first time, the security forces open their mouths. My lord. We have brought this man in. Mm, thank you. The lord nodded pompously and looked down at me and sniffed. ''''Hm. Sixth grade, huh? Death penalty, of course. The best way to show the public what happens when they disobey my laws is to let them know as much as possible. Well let''s wrap the rope around his leg and have the horses pull him. Let the bodies sit in the square for a while and let the birds eat them. Apparently, he was going to be executed for that one. ''''Hahahaha!I don''t believe it!Now you know what would happen if you harmed me in the second grade! I hear laughter from behind me. I glanced back and saw that man, who looked sincerely happy. He seemed to have come to see the ruling. ''''Master-sama, are you perhaps planning to accept it quietly?'''' No way. Of course. Hey, why do you look so sorry? I turned on my heel, tightening my hold on Matty''s neck. ''They also say to follow the township, and if it''s the rule of this city, I thought I''d go along with it for a change, so here we are, but it was still a trial I didn''t have to follow. I''m sorry, but I have to go home. The security forces will soon be surrounding me. ''''You, you''re trying to defy my lord''s ruling! Of course I will, though? ''Hahahaha!Apparently, that''s just too stupid to be true!You have no job, so what can you do?The members of the security forces are all third grade, combat-type [senior positions]! I used my shrink ray to get past their security net. ...what? He''s not here...? He was stunned by the sudden disappearance of the figure. ''''Ha!There she is!There! How the hell did you do that? By the time he noticed us, I was already near the exit of the room. ''''Stop...! Then the lord''s "mighty words" echoed. My body went rigid. It seems that he has been using . "You are not to be bound...! In response to the words that followed, my body once again moved on its own against my will. I went back to the security forces by myself. ''''I see, this is certainly irresistible. It''s even more compulsive than I thought it would be. I try to resist, but it''s as if even that will has been taken away from me, and I can''t muster up the energy to resist in the first place. But how about this? I switched personalities. ''Bugger?'' I kick one of the troopers who approached to restrain me. ''Huh?Silly me. Why aren''t my lord''s orders working! And I thought this man was unemployed!What was that kick?! Hmm. It seems that changing one''s personality allows one to escape the compulsion of Absolute Command. Stop the resistance...! ......... The lord''s flies in again. He quickly switched personalities again, but there were a limited number of them. ''''Do you want to take down the lords first?'''' I kicked the ground. A mimicry of the top skill of the Shrinkage, Divine Footpath, but right in front of my lord. "What? To the other party, it might have looked like I had jumped through space. I slammed my fist into the thick belly of the lord who was exposing his dumb face. ''''Hidebu! 86-Episode 5: Lets go straight ahead Hindu? The chair pulled back and the lord''s massive body rolled on the ground. He blew a bubble and passed out. ''''My lord-sama!'''' The exclamations of the troops echoed. ''Well, let''s let them go home this time, shall we? I walked past the stunned security forces and headed for the exit. ''''Hey, what are you doing?Don''t let him get away! The one who shouted angrily was that man who said he was of the second class. The security forces regrabbed their respective weapons and hurriedly surrounded me. As before, it''s easy to get out of the way if you use a shrinkage, but-- ''Hmm. You said they were all combat-based [senior positions]. I continued to walk straight and normal. Immediately afterwards, attacks were launched from all directions with various weapons. ""What!" I played all of them with a single right-handed sword. ''Why?Are you not an unemployed person? I''m not employed? Then how the hell do you prevent it from happening? With normal hands. That''s not possible! No, but you''ve actually done it. I had easily broken through the siege. ''''Even so, you''re still a few steps inferior to the [senior position] of the Sword City. He was probably sitting on his [senior position] anyway, and hadn''t trained well. ''''Sword City...?'''' ''''Come to think of it, I''ve heard of it........ A few years ago, there was a boy who was unemployed and yet stood at the top of the Sword City... That''s probably me. "Uh, don''t lie to me!That was supposed to be just a rumor! There''s no way you could do that! Well, if you don''t believe me, that''s fine. With them behind me, I went out into the hallway. The immediate area was like a balcony, which was just fine. The flight magic sent me soaring into the sky. Let''s say I leave the city like this. ''''Oh, that''s green magic! Do you think you can do magic? d*mn it, he''s going to get away! No, don''t worry!The sky is their territory!Get them out there now! As they were flying out of the city, something was rapidly approaching from behind. ''''Oaaaahhhh!'''' That thing that let out a roar is a wyvern, a type of dragon. A person with a spear is riding on its back. It''s not a bad idea. Or is it just a trainer? That''s three sets in all. Apparently, he''s been chasing me. He''s not going to let me get away with it. It was a wyvern, small for a dragon, but specialized in its ability to fly. It flew through the air at a breakneck speed and caught up with him as he watched. ''''It''s no use running away!'''' If they catch you quietly, you won''t be food for these people! The riders will advise you. "Hmm. If you can catch it, try to catch it. I''m reasonably confident in my flying magic. I accelerated. The distance that had been closing begins to open up again. ''Bah, you idiot, why can''t you catch up with me? "This is a wyvern!d*mn it, more acceleration! ''Kueh-eh?'' Well, that''s about it. I just pulled away from the wyvern and said goodbye to the city. . Why did you...?Why weren''t my skills working on him...! The awakened lord - Grezzo - slammed his wild arm against the desk as if he were throwing a tantrum. The abomination of letting the man who had beaten him, who was supposed to reign supreme in the city, get away with it. But more than that, he was terribly upset. To him, the Absolute Order was absolute. He was born the third son of a low class nobleman, and no one expected him to have a future, but he was able to rise to the top of the city because he was given the profession of the Great Lord and mastered the highest skill of Absolute Order. Furthermore, he was able to transform the structure of the city into the strict hierarchical system that it is today. And yet, if an opponent appears for whom those skills are ineffective, it is a problem so great that it will shake the very fabric of the city. Of course, that man must be the only exception, but he issued a strict gag order to the people who were watching that scene, and he absolutely must not let the citizens know about this fact. ''''Li, my lord!Oh my God! Just then a soldier with a change in blood came running in. Gresso yells in frustration. ''''It''s bad news?Now I''m thinking about the most important thing!What could be more difficult than that-- ''The Empire!The imperial troops have invaded this city! What--what did you say? It was only a small unit of about a dozen or so people that the Imperial State had sent to bring down the city. But just when you think it was easy to invade the city, they defeated the enemies one after another and reached the lord''s castle in the blink of an eye. And before they knew it, they were confronting their lord. ''''I am one of the eight imperial generals, my name is Elenella. I have come at the behest of His Majesty to bring our city under the control of our country. It appears that you are the lord of this city, Lord Gresso. A tall, silver-haired beauty identified herself on behalf of her unit. Even though she had gone through a fierce battle up to this point, she didn''t break a single sweat and had a cool look on her face. Moreover, around her, the soldiers of this city were falling down while moaning. ''''........How true, I am Lord Gresso. ''''Let''s be blunt. If you are under the control of our country, if the previous lords are competent, they may leave you as the head of the city. However, after reviewing the politics of the past, I have determined that this is not a case that is appropriate. Therefore, I am asking you to vacate your position as soon as possible. 87-Episode 6 You Are Kneeling ''Kukukuku........hahahahahahaha! Lord Grezzo shook his huge, flabby body and started laughing out loud. ''Foolish woman!No way in hell you''d let me walk in front of you.You''re going to kick me out of my own land?If you can do it, do it. ''''........I see. I''m a lord who rules a city, even if it''s rotten. I expected you to have at least the minimum level of judgment to understand your position. The silver-haired beauty, Elenella, sarcastically sarcastically addressed her opponent in a matter-of-fact tone. ''''I''ll tell you. Greso sent a lowly gaze to Elenella. His thick lips lifted as he licked her well-proportioned limbs. ''What do you think?How about you quit being a general and become my personal property?I''m going to give you plenty of loving care every night, okay? ''It seems that you have been cornered and your cognition has become abnormal. Do you think anyone would want to serve the one who is about to be exiled from the city? d*mn it, I don''t care if you want it or not. You will do what I want you to do. Greso activated the Great Lord''s skill . ''''Nude...'''' ''''Kneel in front of your...'''' This woman is mine! Gresso is strongly excited at the prospect of being able to cage the enemy''s beautiful army of female generals who have invaded the country. After having a great deal of fun, you secretly plan to send them in as assassins. I don''t know if it''s the empire or not, but it''s just my luck that they''re after my territory, Gresso scoffs. Elenella approaches. Gresso''s lower abdomen swelled at the thought of her naked body that was about to be exposed in front of him. But. You''re the one who has to kneel. ...What? Immediately after, Elenella''s sword was thrust into Gresso''s crotch. ''''Gyaaaaaaah! Gresso falls out of his chair in tremendous, intense pain and flips back to the ground. ''Hee!Hi!Yay! The blessing quickly healed the wound, but the residue of pain alone made Gresso scream and scream. Elenella stomped as hard as she could on his large buttocks as he squeezed his crotch and squatted down. ''''Buggya!'''' Could you stop yelling at me?The ugly pig''s squeal is very annoying. Despite her neat face and polite air conditioning, Elenella spat harshly. Gresso exclaimed in disbelief. ''W-why?Why don''t you have my "absolute orders"? ...for you too? Elenella latched on to it and raised her eyebrows slightly before Don''t tell me we''ve come this far without knowing that your profession is the Great Lord and that you possess the skill of Absolute Command? What? Of course you knew that and still showed up where your orders came from, didn''t you?That means we have complete measures in place. What an idiot?Then how the hell are you getting around my absolute orders?Bugui? Elenella said while stamping on Gresso''s head this time as he buzzed. ''''Our Lord, Her Majesty, the occupation of the Empress is the Empress. The Empress? Yes. In other words, he is a high ranking member of the Grand Duke. As long as we''re protected by his skill, the Heavenly Decree, the pig''s "absolute command" can''t possibly be effective. The Heavenly Decree is the top skill of the Absolute Order. As long as she was ordered to bring down this city by it, Elenella couldn''t take any action against it. ''''Oh, no...'''' Elenella didn''t know it, but after his own skills, which he believed to be the strongest twice today, were broken, Greso completely lost his will to fight. He had quietly surrendered the position of lord. ''''First of all, the complete abolition of the grading system. Then, let''s take away the power and wealth from those who have been sitting on their professions and owning all the interests, and redistribute it to all the citizens. Having successfully conquered the city with just a few dozen people, Elenella was about to decisively reform the city by assuming the position of interim lord himself. ''''Elenella-sama!'''' Then one of his subordinates rushes up to him, looking flustered. ''What is the matter with you?'' Well, I found this thing in the castle a while ago! Saying that, he handed me what looked like a card made of thick paper. ''''This ... looks like a residence permit. Apparently, it is issued to those who are staying in the city for a short period of time. But it''s not that unusual. It''s a good idea to be able to have a good idea of what you''re looking for. You''re not going to be able to get it right. What? Elenella''s eyes widened. What was written on it was the name "Arel" and the occupation "Unemployed". ''''Where on earth did you find this? Elenella asked her men, looking unusually flustered. ''Shh, it''s the castle balcony!'' You must speak to the people of the castle at once! Yes, sir! His subordinates hurry to run. Without looking away from them, Elenella looks down at the permit. She checks again to make sure she''s not looking at it incorrectly, and then "Unemployed Arel there is no doubt about it!I didn''t expect to find those footprints in this place...!.........Ha, I must report to Your Majesty soon! 88-In Episode 7, be patient After scattering the Wyvern''s pursuers and leaving the city, I took it easy and enjoyed the air travel. There was no need to rush back to my parents'' house. It was especially nice to fly while lying on my back and looking out at the open sky. It was also interesting to see the sky upside down if you lift your head up a bit. Every once in a while, a bird-like demon will attack, but I will use the "flying blade" from my sword to put it away before it gets too close. Before I knew it, the sky had turned reddish-blue, and soon it was night. I would have liked to fly through the night looking at the stars, but I would have preferred to rent a place to stay for the day. The sun had been shining all day and the sun was strong, and I was sweating, so I wanted to wash up. A dip in the water would be fine, but preferably somewhere with a bathhouse. Just as I was thinking about this, I saw the city. I landed on the ground, thankful that the city wasn''t as troublesome as it was yesterday. I was able to enter the city normally, without being rated according to my profession or having different gates available. Let''s find a place to stay as soon as possible. ''''Hmm?'''' Then I suddenly felt a look and I looked in that direction. ''Do you want an apple?It''s a sweet, fresh, delicious apple! A town girl, who seemed to be everywhere, was selling apples to people on the street. The apples in the palanquin were red and certainly looked delicious. ''Is it my imagination?'' Thank you for your purchase. While bowing to the elderly man, the apple-selling girl followed a certain young man out of the corner of her eye. "Mr. Maple, Mr. Maple. This is Sakura from the city Rayen. I have just witnessed someone at the entrance of the city who I believe to be the target. Then, while covering his mouth with his hand, he muttered in a small voice. Its content was as if he was reporting to someone who wasn''t here. ''''Really?'''' ''Yes, sir. It matches the characteristics I''m hearing with a high degree of accuracy. "...Elenella said she was in Carrion a day ago. It will take three days by carriage to get to Lehen. And you''re sure of that? It''s true.... Well, it''s still only an appearance check, so we''ll investigate the name and occupation as soon as possible! Okay, okay. Keep me posted on what you learn. I''m awestruck, sir! As I walked along at random, I found an inn along the road. When I walked in, a girl who was only about seven or eight years old at most ran up to me. ''Welcome!One? I guess he is a helper at his parents'' house. She''s pretty solid for her age. Yeah. But first, does this inn have a bath? ''Of course!We have a big bathhouse!Even my brother can swim! They respond cheerfully. To be honest, I wasn''t expecting much since it was probably a small family-run inn, but I heard it had a large bathhouse. I don''t know if they understood my inner feelings. ''There are hot springs in this town!That''s why bathrooms are a given in every inn! I see. I''m convinced. ''Oh, but that doesn''t mean I want you to go to another inn!The building is small, but the hot springs are just as big! I said to the girl who hurriedly added that to me. ''Then let me stay the night,'' ''Thank you!How do you want to eat?We have a reputation for cooking! I''ll take it. I''ll take a bath first. ''Yes!One person is invited! After being shown to my room, I quickly headed to the bathhouse. Oh, welcome!Is it just you? Didn''t a young man by the name of "Arel" come to the inn a few minutes ago? ''What?Oh, yes. You mean your brother from earlier? The girl checks the guest list. The name ''Arel'' is written on it. "Have you been asked about your occupation? You know, I don''t think we should... Oh, yeah? No, it''s nothing. By the way, do you have any rooms available? Oh, yes! Then let me spend the night. I don''t need a meal. I understand!We have one more for you! "Dear Mr. Maple. I''m Sakura from the city of Leyen. We''ve just received confirmation that the name is "Arel". As to his occupation, we are not sure. We will continue to investigate. Copy that. Oh, come back to life... When I soaked in the hot spring, I couldn''t help but hear an old man''s smelly voice. Well, I''ll be 20 years old in a little while, so it can''t be helped. As the girl of the inn said, it was quite a wide bathtub. It''s also an open-air bath. The heat is just right and it feels good. But there are no other guests except me. It''s a little late, have you finished getting in? Thanks to that, it was a chartered state. By the way, it seems to be a mixed bathing. It''s not a good idea to have a good idea of what you''re looking for. As I was playing with Mattie submerged in the hot water, I felt someone approaching. Soon a young woman comes into the bathroom. ''May I join you?'' Yeah, that''s fine. I hear it''s a mixed bathing establishment. You won''t be able to see much because the hot water smoke is so strong anyway. ''''Then I''ll take your word for it...'''' She sat down on the opposite side of the large hot tub, just opposite me. ''It''s nice hot water,'' Hm?Yeah, I know. He asks good-naturedly, and I comply. "How often have you been in town? No, this is my first time. I''ve never even heard of a hot spring before. ''I see. I usually live in a city called Carrion, but I like the hot springs here and visit them from time to time. Carrion? I think I''ve heard that name before. ''Yes. Do you know it? I don''t know if I''ve heard of it before. "...a city with a very high level of professional discrimination. Oh, there it is. You just stopped by yesterday. Have you ever been here? ''There is. It was only yesterday that I got into a bit of trouble, so I had to get it out early. ...yesterday. She repeated my words somewhat meaningfully. ''But how did you get this far in just one day?It will take you three days to get to the carriage, don''t you think? I''ve been flying. ...Yes? 89-Episode 8: Her Majestys Command is Absolute He''s flying...? Yeah. ''''Well........in that case, could it be that your occupation is a ''sorcerer'' or something?'''''' She makes an amused face and then asks fearfully, "No, I''m not. No, I''m unemployed. No, no, no, no, no, the Unemployed can''t fly, can they? Can you fly?Good luck with that. I think I''m starting to get a little warmer than that. I think it''s time for me to get out of here. . After the young man left the bathroom. What do you mean...? While soaking in the bathtub, she was confused by herself. ''''So, but for now, he said he was unemployed, so it must be so.......?And I don''t know why you''re lying to me... In fact, it''s probably more of a lie to say that I flew through the air to get here. No, I''m sure it is. Perhaps he had some special means and said something appropriate to hide it. ''''And anyway, I have to report to Kaede-sama! She contacted him immediately. ''Hmm, okay. Good work.'' Oh, thank you very much! "I''ll be right there. ''What?The maple himself? "Of course. I don''t want her to get it from me. Thank you for your service. The next morning, I left the inn with a young signboard girl seeing me off. Then, just outside the inn, I saw a girl standing there as if she was waiting for me. She looks like she''s about 15 or 16 years old. She was small in stature, typical of Eastern people, with black hair. She is staring at me with her two eyes, which are devoid of expression and emotion. Hmm. I''m not an ordinary man. But he''s just perfect. "I am a maple. One of the Eight Heavenly Generals. You''re Arel? Yeah? Nodding, she said matter-of-factly. ''Her Majesty''s orders. Follow me.'' I was told as if it was a done deal, but I had no business with this Empress. "No, First of all, I''ve never met him, and I don''t know what kind of guy he is, where he is. ''''No, you can''t do that. The Emperor''s orders are absolute. So who''s this Empress that you''re talking about? ''My lord. Founder of the Empire. My sovereign, the founder of the Empire, the one who will eventually rule the whole world. Goddess. I''m not sure, but I just know that he''s a troublesome opponent anyway. Come to think of it, I''ve heard of the Empire somewhere...? And then I remembered the story of the shopkeeper. There is a country that was established just a few years ago and is now a great power with many countries under its control. I heard that they not only treat all unfortunate jobs equally, but also give them generous protection. It''s just a dream country for my daughter. I see. So that''s the Empire. "What does the head of such a country need from me? I don''t know. But it''s of the highest importance. Her Majesty has been looking for the unemployed Arel. Okay. Will you follow me? But I decline. I''m just going home to my parents. Yeah. The girl gave a small nod. Then I''ll take you by force. In the next moment, the figure disappeared with those words. Hmmm, it''s a ''shrinking'' skill. She walks around behind me and throws her sword at my neck in an attempt to cut off my consciousness. ''''Huh?'''' But I wasn''t already there. I had come around further behind her. ''''If you''re in the mood, we won''t show any mercy.We''ve got to get rid of the fire that''s coming down on us. What? My kick blew her away. She flew about ten meters and hit the ground and rolled more lazily. ''''Huh!Lord Maple! I thought I heard a little scream from somewhere. ''Why don''t you stop hiding and come out?'' ...hmm? I called out to them, and I could feel the guys who had been hiding out gasp. ''They''ve known all along,'' They soon emerge from behind the roof and walls of the house. There are about ten of them in all. All of them are dressed in black attire and their faces are hidden by a cloth-like object. ''''........How did you know?We are all ninjas. I''m sure you''ve been using your Concealment skills to disguise your presence... One of them asks me. "No matter how much you eliminate all signs of life, you can''t eliminate the fact that someone''s there. That means your "stealth" skills are not perfect either. It''s not just one person, but when there are ten of them in a group, the smallest discrepancies are even easier to detect. Oh, no... Also, you''ve been watching me since yesterday, haven''t you? What? ''You used to sell apples at the entrance to the city. Then you even followed me to the inn, and even took a bath as a guest. How did you know?It should have been a perfect disguise........! ''You''ll know it when you see the way he speaks, his voice and his movement habits, won''t you? When I told her, she took a step or two back, as if she was astonished. ''''Heh, I thought I was only good at disguises.......maybe I was the only one who thought that.......? Apparently, he was shocked. ''''........Sakura. Right now, I don''t care about that, I''m focused on capturing it. ''Ka, maple-sama. You''re safe, aren''t you! The girl I kicked off earlier comes back to us as if nothing happened. Her blessings have hardly decreased. Well, it seemed to have taken a passive response as well, so there would be no damage with that much. "This is not just an ''unemployed'' opponent. We''ll take it with all of us. Yes, sir! Immediately after, they leapt at once. 90-Episode 9: This is my territory A group of ninjas attacked us. Incidentally, "ninja" is a profession unique to the people of the East, and is good at espionage and assassination. Probably all of these women are Eastern people. It seems that the Imperial State seems to have extended its influence to the east as well. Well, that''s beside the point. ''''Huh?'''' Suddenly, the girls stopped moving. ''''Hey, what is this?'''' A hand on the ground...? Grabbing the ankles of the surprised girls were the earthen arms I had created with my yellow magic. I was suddenly taken off my feet and some of them fell face first to the ground. ''''You don''t think you can even use magic?'''' ''That can''t be........!I''m sure he has friends somewhere! I''m paying attention to my surroundings as I get myself up, but there''s no one there. Phew! Oops. The one who destroyed the earthen arms first was the small girl who seemed to be holding them together. Was it called maple. I''m not going to be the only one who can do this, but I''m going to be the only one who can do it. I''m sure you''ll be able to find out more about this as well. What? It blew up again. His body is small and he flies well. Moreover, he collided with another ninja who had just escaped from an earthen arm, and they rolled on the ground together. ''How dare you! The other ninjas jumped at me one after another in exasperation. But perhaps because of the blood on my head, they were not coordinated as if they were. I incapacitated them in turn. Hurry!He''s going to take all the credit for this! Yes! There was a woman running through the city, scolding her subordinates. She had beast ears on her head and a long tail extending from her hips. She was large for a woman, yet her movements were as agile as a cat. When she raised her voice, sharp fangs peeked out of her mouth. And that''s as it should be. She was not a mere human. A type of subhuman with the characteristics of a beast - a beastman. She was of the tiger race, which is said to have the greatest fighting ability of all of them. Her name was Tina. She was one of the Eight Imperial Generals. ''''That little bastard!This is my territory! She ran at full speed, roaring in frustration. This city was already under the control of the imperial state, and Tina had been entrusted with its administration. It was only a short while ago that she had received word that there was someone the Queen was looking for. If she could bring herself back with this, Her Majesty would praise her! She was as happy as a domesticated dog, but at the same time, she received some unavoidable information. It is said that the ninjas led by the maple tree, also one of the eight generals, had made contact with their target ahead of the others. And not only did they send their men into the territory without permission, they didn''t send any communication to Tina. "You''ve got to be kidding me!I will not let you take it from me! However, the opponent was a [Highest Rank] ninja princess who was skilled in covert action. If they fought directly, Tina wouldn''t lose, but once they were able to escape, it was difficult to chase them. I''ve ordered my subordinates to keep her in place, but........ And so, the destination is finally approaching. ''''Tina-sama!'''' And that''s where he meets up with one of his subordinates. It looks like he''s in quite a hurry. "Tch, I didn''t know we''d already gotten away-- Tina clicked her tongue with a nasty guess. What--? I noticed it. "What the hell is this...? Here and there along the road, there are people lying in black garb. Of course, Tina knows about them. One of the eight imperial generals is a ninja group led by the Maple of the Shinobi Princess. There is only one young man standing. The characteristics of this group are completely consistent with what I''ve heard about the Arel. "Could it be that you did this...? For now, I''ve neutralized the ninja group. Even so, it was as if no one had come after all this rampage. Probably these guys were trying to prevent people from coming around in some way or another. Well, we are thankful that no onlookers have gathered. Just then, a large presence approached us at high speed. And the one who appeared was a beastman woman. Probably the tiger race. She was breathing on her shoulder as if she was in a great hurry. "What is this...? She seemed stunned to see the ninjas fainting and moaning everywhere. Apparently, it wasn''t like they were passing by by by accident. ''''You don''t mean to tell me that Teme did this...? Yeah? "....what an idiotic thing to do... Are you one of these guys?Don''t worry. I didn''t even take your life. And that''s when she noticed the girl lying at the end of the road and rushed over to her in a hurry. ''Oi, what happened? "...hmm. As you can see. I tried to slip away and catch him first, and he got me. The leader of this ninja group, a girl named Kaede. ''Why are you even Teme there and all of them are wiped out? It was a normal loss. Isn''t this an unemployed person? I don''t know. I interrupted their conversation. "I''m unemployed. And that''s what he says. Tsk, you call yourself that. ''No, I really do. ........Mm. As I thought that multiple more signs were approaching, they appeared one by one to surround me. All of them are beastmen. But I''m not going to be the only one. Thanks to you, I didn''t let you snatch the credit from me. The tiger beastman from earlier sniffs and releases the maple to look at me. ''''I am Tina, one of the eight imperial generals. Unlike these guys who are good at running and hiding, you guys are genuine warriors, you know? Apparently, this time we have to take on this group of beastmen. 91-Episode 10 Was It Transformed? A tiger beastman named Tina leaps at him. Considering her physique, she is quite fast. She doesn''t have any weapons of any kind, so she''s probably a close-combat type. ''''Oraa!'''' He unleashes a fist. I ducked it while ducking and ducked into the opponent''s bosom, and used the momentum to throw it away. Huh?--gubeh? Unable to even get a passive response, she was slammed hard to the ground. She didn''t expect not only to be able to avoid her fist, but also to be thrown. ''''Tina-sama! The General''s been thrown! The beastmen surrounding them shouted in surprise. ''''Hey, you bastard!'''' Tina got up quickly and swung her arms at me, hitting me. But it doesn''t hit me. I give her a foot sweep, and her large body retracts. ''''Nah, nah........'''' He seems to have realized the difference in power between me and him, and is stunned as he rolls to the ground. ''''I can''t believe the General can''t even get his hands and feet on the ground...'''' What the hell is that guy...? I don''t think you''re lying about being "unemployed"!General Tina is the [Highest Rank] of the Beast King! That''s not important. Join the General. What if we all get to it? ''Oh, oh, oh, oh, oh!'' Then suddenly, Tina let out a terrific roar. And then its body swelled up. The fangs of its mouth became thicker and sharper, and its claws grew. In addition, its entire body was covered in hair. The next thing I knew, there was a muscular tiger. However, it walked on two legs and stood nearly three meters tall. ''''It has transformed?'''' I''ve heard that some beastmen have a skill called "bestialization," which increases their beast-like characteristics. It seems that while their intelligence is reduced, their fighting ability is greatly increased. However, if we fight this kind of thing in the city, it''s likely to cause a lot of damage. There''s an inn right behind me where I''ve been staying, and this area is densely populated with houses. ''''Hmm.... When I thought about it, I didn''t even have to bother to deal with it. I kicked the ground as hard as I could at the time as I slammed the wind to my feet and jumped up at once. ''''Huh?Gulp! Tina hurriedly reached out to catch me, but I was so close to cutting the sky. ''Sorry to be the tiger, but I''m going to let you walk away. I flew even higher into the sky. "Don''t you dare escape!Come down here, you bastards! He heard such a cry from the ground, but ignored it and flew straight out of the city. ''We''re almost there,'' There was a lot going on along the way, but we''d only have to fly half a day more to our home village to get there. ''Hm?What''s that? We notice countless dots coming towards us from the sky ahead. Is it a flock of birds? But even so, it seems quite large. ''''.........hmm. It seems to be a dragon. It is also a real dragon, unlike the wyvern, which is considered an inferior species of dragon. Its body was more than two times larger, and it had strong forelegs that the wyvern did not have. On its back was a human with a long spear in his hand. ''''I am the Dragon Rider Princess Dora, one of the Eight Imperial Generals!Are you the Arrell of the Unemployed? One of them, a woman who straddles the back of a particularly magnificent dragon, calls out to me. I knew it was the Imperial State again. This time it seems to be a group of "dragon knights". ''''Yes, but...'''' "My master commands me to arrest you, my lord!Brace yourselves! You caught me out of nowhere. I guess they don''t care about you anymore. "What the hell did you do to the Empress? I don''t know. I''ve never met him. The dragon knights surround me. A total of twelve bodies, or rather twelve sets. I received a command from Dora or something, and they all attacked me at once. I created a mass of air at my feet and kicked it as hard as I could. Thud! It accelerated all at once, making an explosive sound. The dragon stretched out its neck and tried to bite me, but I slipped through before it closed its mouth and went underneath the dragon knight riding on its back. ''''Nah!'''' He tried to rush to stick his spear out, but it was too late. The sole of my foot was kicking him in the face. ''''BUGH! The dragon was blown off the top of the dragon and fell to the ground with a scream. When the dragon realized that its owner had fallen, it rushed after him. It seems to be a well-trained dragon. ''''What the hell was that?!'''' Watch out!This guy does some strange moves! The dragon knights are in a state of turmoil, but they immediately scold each other and rebuild. But at that time, I had already broken through the siege net. As it is, I leave them alone and fly. ''''They''re trying to escape! Chase! He rushes after me, but What''s the speed? The dragons can''t keep up! Well, when it comes to the ability to fly, it''s not as good as a wyvern that specializes in flying ability. Let''s just scatter it around. I don''t think so! Tsk! Swooping down from above was a woman called Dora or something like that, leading a group of dragon knights, and her dragon. When I just barely avoided them, they immediately turned and came at me again. Their speed and movements are far different from the other guys. I kicked the air and sped up even faster, but they easily clung to it. ''Nirba, give me a breath!'' "Oh, wow! Immediately afterwards, her dragon, apparently called Nirba, opened its mouth wide, and released a powerful breath in my direction. 92-Episode 11: I cant escape now The breath of the thunderbolt released in a straight line like an arrow. It''s coming straight at us. ''''Purrrrr.'''' The wall in front of the attacking lightning attack is my pet, Pullle, which I summoned from the demon world. If you leave it near you, it always eats a lot of things, so I sent it back to the demon world for a while. If it''s the demon world, there''s no problem for it to grow. But in this short period of time, it seems to have absorbed a lot of things from the demon world, and its diameter is over four meters. Just a few days ago, it was just big enough to fit in your palm. Be that as it may, Prull took Breathless for me. ''''Where in the world did the King Slime come from?But as expected, there won''t be a single puddle after Nirba''s breath! Dora seemed to think it was just king slime. But Pullle is a Gratney Slime. It''s a demon from the demon world that absorbs any attack. Purrrrrrr! Pullle lived up to my expectations and took the thunderbolt bracelets fully into his body. It was quite a huge amount of energy, or maybe it was a pretty enormous energy, but it became even more gigantic. ''''Nirba''s Breath has been nullified........?No, you absorbed it! Pullle can''t fly, so she falls directly to the ground, but I''ve set her to return to the demon world on her own after a few minutes, so I''ll leave her alone. "As usual, you are relentless in your use of this product. Aerial combat is a bit of a disadvantage, but it doesn''t look like it will be easy to disperse, so we''ll fight. Perhaps those breaths won''t be able to fire in rapid succession so quickly. I kicked the air mass and pounced on it. But the dragon quickly rises and evades me, and then stretches its neck as if to go around and attack me from behind with its sharp fangs. I punched the air mass with my left hand and forcefully ducked it, at the same time, I slammed a kick to the side. ''''Guaaaaaahhhh? Nirba! A dragon that either had a concussion or leaned heavily and fell several meters. By the time I managed to regain my position, I had landed on its back. Dora quickly stands up and confronts me with her sword in her hand. ''''Hah!'''' She leapt at him. Even though she was on a precarious dragon, she moved with an agility that didn''t feel like it. And a sharp slash. Considering that swords are not my specialty, my skills are not bad. But, unfortunately, this one is defeating the mother of the Sword God, who is the world''s strongest swordsman, and it''s not an exaggeration to say that she is the world''s strongest swordsman. I don''t need to use my sword. With my hand sword, I received the opponent''s sword and, on the contrary, destroyed it. ''''........na.... Dora is stunned for a moment, staring at the sword barrel that was broken in half. I quickly walked behind her and When you wake up, tell your highness that I don''t want any more of her people on me. I don''t want her to get any more of my guys on me for being a pain in the ass. I tapped its neck lightly. ''''Oh....'''' You pass out and slump down on the dragon''s back. Well. I hope this is the last time I''m going to have to do this. The city of my hometown is now in sight. Hmmm ... maybe you didn''t tell us properly. Or maybe you did and didn''t listen to it. I immediately noticed something strange. A strange group of people were clearly stationed around the city. A group, or perhaps an army, I guess you could say. ''But how did they get ahead of us?I went out of my way to take the long way around so that they wouldn''t realize the path I was taking. It took me a lot of extra time, but it was a complete waste of time. It''s as if he knew I was coming back to this city. ''''I see.'''' I had an idea. And then the group suddenly realized that I had appeared there, and suddenly the group started to move. Some of them are flying in the sky. It seems to be a bird beastman. ''''We meet again!This is your destination!You can''t escape this time, can you? The one riding on the back of a very large beastman who seemed to be of the eagle-man race was that tiger-man race woman. I turned my back to her. ''''You''re going to run away again?Hey, guys! Shouting comes from behind me, but I ignore it. At any rate, I realized that it''s useless to take on these guys. We have to beat the former(ish) evildoer. Well, as long as I leave the affairs of the town to my father and mother, I''ll be fine. . What are these...? ''To be unable to stand up to this many.......monsters.......'' It''s too strong... A few minutes after Arel had turned back just before he was about to return to his parents'' home, the imperial soldiers who had besieged the city had decided to bring it under their control. The imperial soldiers who had besieged the city wanted to invade and take control of the city, just to make up for missing their target once again. But then two men and a woman appeared. ''''........Hey, we''re supposed to be the [Highest Position], right?'''' Hmm. But he''s a bad influence. In the face of their only two husbands and wives, the troops led by two of the eight Imperial generals, Tina the Beast King and Kaede the Shinobi Princess, were easily annihilated. Looking down on such a scene of dead bodies, the people who had created it exchanged a few words. ''''Dad, we left the house in your hands for a little while. "?Where the hell do you think you''re going, Mom? ''Uh-huh, I just felt I had to punish her for this one. Yeah, well, um, yeah, I guess so. The smaller man nodded, sweat dripping from his eyes as he noticed that she wasn''t smiling softly and her eyes weren''t smiling. 93-Episode 12: Did the Empress Have You? ''Not yet!You still can''t bring Arel back with you! At the back of the luxurious room. There was a figure perched on a throne studded with gold and silver jewels, screaming loudly. Partly because of the size of the throne, but also because of her small stature, not even reaching the height of fourteen centimeters, she looked like a white-skinned girl playing. However, she is the founder and the pinnacle of this continent''s most powerful new nation, the Imperial State. She was the queen herself. I''m sorry, sir. It seems that she refuses to come with us. Then you will bring him here by force! ''Of course I already have...!And yet, in spite of the fact that three of the eight imperial generals are doing everything they can, for some reason or another, they have all failed... ''No excuses!If the three generals can''t make it, just send them all over! But that doesn''t leave much room for the castle. ''You don''t have to worry about that!You can''t make it up to me! Yes..... Her subjects were trembling with fear in the face of a woman who looked as if she was about to poke the world with her hair. And that''s when it happened. "Oh, my God! One soldier rushes into the throne room in a hurry. ''A young man calling himself Arel is in the castle...! Hearing her name, the Empress jumped up and down on her throne. ''''You''re finally here!'''' The anger he had felt earlier receded as if it were a lie, and his eyes shone like a child''s. ''''But, but somehow, alone and forcibly breaking into the castle--'''' D''oh! Before the soldier could finish, the door had been opened with a terrific roar. And on the other side of that door was the very person the Empress had been waiting for. ''''Alleluia!I''ve missed you! The female emperor runs up to her at a glance. But in the next moment, the sole of her foot was slammed into her face. ''''Gubey!'''' ""Your Majesty!" The subjects screamed. The young man exhaled in dismay as he stared with cold eyes at the female emperor who was rolling around on the carpet in circles. ''I knew it was you, sister. My sister, who is dressed in luxurious clothes that are disproportionate to her tiny body, rolls over as she receives my leg kick. ''''Buh-heh,'''' Finally, he banged his head against the throne and cried out like a crushed frog. ''''Your Majesty!'''' While those who seemed to be under her command rushed over to her, the sister got up with a whimper and "What are you doing, Arel?It''s been so long since we''ve seen each other, and now you''re suddenly kicking your sister''s ass! She complains with tears in her eyes. ''It doesn''t matter, you''re the one who sent them a bunch of confusing people, right? I kicked your sister in the face and you did that? I''d appreciate it if you wouldn''t scream at me for getting kicked in the face. After all, I''m the source of the people who were chasing me around. But my sister, who left my parents'' house a few years ago, I didn''t know she was doing this. ''''Hmmm!Isn''t it great!Your sister is the king of this country now! My sister is not a smug chest-pounder. She''s still flat as ever. It''s not as if she hadn''t grown up, and it seems that she didn''t grow up either. ''''Heh, your majesty, please wait........sis, that means that.......'''' Then a subordinate interrupts and asks fearfully, "Is that you, Your Majesty''s brother? "Is that man, His Majesty''s brother, by any chance...? She just stared blankly for a moment. Hm?Didn''t I tell you that? The people present shouted in unison. ''''We''re not listening!'''' They sloppily dripped sweat from their foreheads and shuddered, ''''Oh no.......I didn''t know it was His Majesty''s younger brother, and he was trying to force me to kidnap me.......'''' ''''Please tell me first........ ''''It doesn''t matter, Arel!It took a lot of work to build a country from scratch and make it this big, sister!It''s taken nearly a decade! Rather, expanding their power to this extent from the founding of the country is something that would be impossible to do in ten years. It''s probably because your sister''s occupation is the [Highest Rank] of the [Empress] that she was able to pull off this trick. Come to think of it, it wouldn''t have been surprising if she had realized earlier that the Emperor was the sister. But the fact that she is respected and called the "Emperor of Japan" is so far removed from her sister''s image that it was difficult to make a connection between the two. ''I worked hard for you!And you didn''t even tell me where you were, you motherf*cker!That''s why I''ve been looking around for you people! Her sister says with a snort. ''But now we can finally make good on our promise! "Promise? ''I told you!My sister said she would make sure to create a world where Arel could live without any problems! Come to think of it, I''ve been licking my chops about that. ''This country will never discriminate against anyone in any profession!On the contrary, they treat you equally in every way possible!There is no difference between rich and poor!No difference in property!It''s a wonderful country where everyone, capable or not, can live equally! They say that even if you don''t work, you are guaranteed everything you need for food, clothing, and shelter. On the other hand, it seems that no matter how much you work and achieve great results, your income is the same as everyone else''s. ''....If you do that, will anyone do anything? ''Don''t worry about it!If you use your sister''s Heavenly Fate skill, the Emperor, she''ll do all the work for me, even if there''s no physical reward. I see, those Eight Imperial Generals were desperate to catch me too. I heard their wages are the same as regular soldiers. Arelal!This is your utopia!So from now on, I''m going to live here with my sister for the rest of my life! My sister confidently invites me to join her. I said flatly. ''No.'' 94-Episode 13 Do you think its too late? No. When I gave her a clear shove, she opened her mouth and revealed her dumb face. "W-why is that?You will no longer be ridiculed for being unemployed, right? I don''t care if you make fun of me, I don''t care about that at all. ''You won''t have to work as hard!I could live with myself playing every day! That life sounds so boring. ''''Soooo, there''s no need to make such a futile effort to learn a sword when you don''t have any skills! ''Wasted effort?Hmm, then does this look like a wasted effort to your sister? I drew my sword and lightly swung it to slash the void. The flying blade that was generated tore through the wall of the room, creating a huge cut. ''''Huh?What?Wait, what the hell was that? The skill of the "Sword God" flying blade. It''s a skill that sends the impact created by a slash flying. ''''The skills of the Sword God!Arel, you''re not supposed to be unemployed! To be precise, it''s a flying blade that replicates the flying blade. The trick is to swing the sword as fast as possible. If you''re trained like I am, you don''t need to be skilled like this to do the same thing. No you can''t! You got it right.And by the way, if you''re unemployed, you''ll be able to do magic too.Like this. The spear of fire that I fired pierced the ceiling. ''''Oh, no.......not just swords, but magic as well...? The sister is stunned as she looks up. ''That''s why I don''t need this country. So please don''t send soldiers to me at the end of the day. I turned my back on my sister. It was a terrible detour, but let''s go back to my parents'' house this time. My feet stopped on their own. It seems he used his Heavenly Fate skill. "You can''t let me leave!Because Arel is going to marry your sister! She finds it impossible to persuade me, or maybe she''s just like a spoiled child who appeals to me. She says she made this country for me, but I guess she''s just trying to fulfill her own desires after all. But I don''t care about that. I just want to live my life the way I want to live it. I have no intention to live the way I want to live. ''Phew!We can''t afford to talk like that now! Her sister sucked in a breath and said in a loud voice. ''''I''m going to marry my sister! The words unleashed by the Tenmyo skill force me to do just that. I found myself moving closer to my sister. ''Yes!Arrell!From now on, your sister will provide for you! My sister also runs up to me. ''''For now, I''m going to swear an oath--Buju! I kicked my sister in the face as she tried to jump at me, sticking her lips out. I kissed the sole of her shoe and her sister blew up again. ''What?Wait, why? Those skills aren''t going to work on me. It''s not that it isn''t working, exactly, but it''s avoiding it by switching personalities. ''What the hell is going on with you, the sword and magic thing! That''s what you call a futile effort. I turn on my heel again. "Well, the wait is--? Her sister''s voice trailed off. ''There are other ways to deactivate that skill. Like right now, for example, by removing the air around you so your voice doesn''t carry. ''What?~~! The biggest drawback of that skill would be that it would be ineffective if you didn''t let your voice reach your opponent. In other words, it would be easy to block it if you made your voice unheard. ''''~~~~!~~~~! He still seems to be saying something, but he leaves it alone and I turn to leave. ''Ka, I can''t let you leave! But then there were those who stood in the way. One of the eight Imperial generals, the Warrior Princess Liana! "A general is one of the Eight Warlords, Igbergia the Deadly King. It''s Fina, the Great Saints!Yo, nice to meet you!Oh, I''m one of the eight generals! It''s Kina-chan from the Pirate Princess! Apparently, all four of them were the Eight Generals. ''''If you want to get out of here, you''ll have to defeat us first! Okay. Well, be my guest. What? What the hell are you doing?I can''t believe the eight generals got away with it while there were four of them! While bouncing on the throne, the Empress - Astaire, Arel''s sister, Astaire, was indignant like a child in a tantrum. ''''I''m sorry, Your Majesty.... We''ve been so disappointing........ Warrior Princess Riana uttered an apology while disappointedly dropping a paragraph. ''''.........Toiuka, that man, do you think you are unemployed? ''''That''s right~ Even if we were to gather together as a group, we''d be no match for them, I can''t help but laugh, hahahaha! What are you laughing at? Astaire''s angry voice exploded. ''''When this happens, I''ll chase you to the ends of the earth and bring you Arel again, even if it means chasing you to the ends of the earth! But, Your Majesty, just because you''re bringing him here doesn''t mean his divine decree is going to work. ''''Geez ... oh, that was some kind of mistake!Anyway, we''ll be after you soon enough!I won''t allow you to come back until I bring you back! ""Yes, sir..." And that''s when. Laughter fell from above the girls'' heads. ''''Mm-hmm........I think you''re a little too cuddly, big sister, don''t you? Astaire''s face turned blue as he looked up at the ceiling. ''Ka, Mom! 95-Episode 14: Brothers fool Blah, blah, blah, blah, blah. Oh, mother, I''m sorry! ''Ummm, what should I do?Do you promise to reflect on it properly and never mess with Arel again? Blah, blah, blah, blah, blah. ''That''s because I don''t like it!Because from the moment he was born, Arel was destined to marry me! ''Looks like we need to make it a little stronger, don''t we? Bam!Bam!Bam! ''Hi!I mean, everyone is watching!I''m not a kid anymore! ''Hmmm, so let''s hurry up and mature mentally then, shall we? Bam!Bam!Bam! The sound of "bachin" that echoed from earlier was the sound of the Sword God Phara slapping the Emperor Astaire''s buttocks. ''''Your Majesty........'''' ''Wow....'' She bares her ass in front of her subordinates and is punished by her mother. This is the ultimate in shame play. "It''s time to stop beating her! Bam!Bam!Bam! What, wait, why isn''t the Heavenly Decree working? ''Of course it is. A mother''s love is not bound by skill. ''I don''t know what that means! Bam!Bam!Bam! Incidentally, her subordinates, including the four of the eight generals, could only stand by and watch as their master was being spanked. This is because they had already been completely defeated and brokenhearted by the "Sword God" Farah. Moreover, it was his second loss today. On this day, that lesson was deeply engraved in their hearts. Hi, Dad. Oh, Arel. Welcome back. When I finally returned to my parents'' house, my dad greeted me. The Imperial Army that had surrounded the city was gone, so they had probably retreated. ''Where''s Mom?'' Well, you know, your mother had to run an errand... Dad says, looking away for some reason. ''Well, he''ll be back sooner or later, so don''t worry about it. It''s my mom. You don''t have to worry about it. What''s going on with Laina? Yeah, Laina''s going out for a while to finish up her training or something. Finish your training? I think he''s hiding in a dungeon. Oh, dungeons. It''s a great place to learn to fight. "He said he''d challenge you again when he gets back. You''ve been working hard every day with your mother, and I''m sure you''re getting stronger. Your mother has given her stamp of approval. Hmm, that sounds pretty interesting. All right, I''ll take it. .... "?What''s up, Dad? No, it''s... well, it''s nothing. What did he want to say? Weird dad. So I get to the point where I''m about to do the most disturbing thing about coming home. "Well, Dad, Huh...! It''s like, "I''ve been waiting for you! For some reason, my dad''s puckered expression brightened. ''How''s Mila doing?'' ... For some reason, Dad''s expression darkened all at once this time. Could it be that something happened to Mira...? Come to think of it, I came back and there was no sign of him coming out. I thought he was angry at me for leaving without telling him, but if that was the reason he was sick or something-- "...Mila would be upstairs in her room. Of course she''s usually fine, Somehow, Dad''s sulky response made me feel better about myself. Good. I was just about to go upstairs when I heard him muttering to himself from behind me. ''I beat you with mom, but you won''t do it with dad...'' I''m not going to be sulking about it. To begin with, unlike the sword, if my dad and I get into a serious magical battle, the people around us will be severely damaged. Thump. "Mira, it''s me. It''s my brother. I''m back. I knocked in front of Mira''s room, but there was no answer from inside. However, there was a hint of someone in the room. ''Mira, you''re in there, aren''t you?...coming in? It didn''t seem to be locked, so I opened the door and walked in. My sister was sitting on the bed with her back to me. ''Mira?'' .... How are you doing? .... I''m sorry I left without saying a word. My brother is an idiot. I thought I had finally responded and that was it. Apparently, he''s quite angry. ''I''m sorry, I need to get back in a good mood. My brother is an idiot. Now, at least look at me and show your brother your pretty face. My brother is an idiot. There''s no nibbling. There''s no sign of anyone looking at me, and I think she might have grown to dislike me in earnest. It would be counterproductive to try to get her to forgive me. I had no choice but to leave the room. What''s going on? As I relaxed in our bath, I was pondering. My sweet sister hated me. I''ve been sticky since I was a little girl. Now I''m still in the bath alone. After all, Mila doesn''t even want to take a bath with me anymore. As I was thinking this, the door to the bathroom opened and Mila came in. ''Mira?'' My brother is an idiot. With her mouth puffed out, Mira puffs up and says that, but she settles down next to me in the tub. However, she keeps her back to me. ''Mira, will you forgive your brother?'' My brother is an idiot. "Mira. My brother is an idiot. "Mira. My brother is an idiot. "Mira. My brother is an idiot. In the end, Mira didn''t say a word to me. That night, as I was going to bed, Mira came into my room. ''Mira?'' My brother is an idiot. And then he crawls into my bed. But he still has his back to me. "Mira. My brother is an idiot. "Mira. My brother is an idiot. "Mira. My brother is an idiot. I guess he really hated me after all........ ''''.........I think he''s simply sulking, no matter what you think, Ked? (BOTH)'' 96-Episode 15: Its just a coincidence Mom came home the next day. ''Where have you been?'' Uh-huh, I''ve been away for a while. ? He just laughed and muddled the tea, but in the end he didn''t tell me what he had done. ''''Anyway, Arel-chan, welcome back. How was your time in the magical city? I''ve done pretty much everything I wanted to do anyway. You''re good. Mom smiling at me. By the way, you still look the same as you did ten years ago. She''s still the same young man she was ten years ago. If you want to talk about it, my father is still the same as he was ten years ago, with the same cock and baby face. I''ve seen a lot of growth in Mila. I''m sure you''ll be able to find out more about this in the future. I''m sure you''re already taller than your sister. I''m sure you''ll be able to find out more about it. It''s a good thing she doesn''t look like her father and sister. But she still only says "my brother''s idiot" when I take a bath with her, and "your idiot" when I sleep with her. He may be angry that I left the house without telling him again, but he''s 9 years old. He will turn ten years old soon enough to receive the blessing, and maybe it''s time for him to leave his brother. It''s sad for him, but it''s probably inevitable. Then we didn''t have to stay long. I told my mom and dad that I would be leaving home again tomorrow. "I''m going to the demon city next. "Yes? I''m going to be a demon trainer this time. The demon city is a long way from the rural city where my parents'' home is located. It''s more than the City of Swords or the City of Magic. I''m not going to be able to get the same amount of money as the other guys. That''s why I still decided to use flight magic. It took me about a week to get there. It''s a big city. It''s not inferior to the Sword City or the Magic City in terms of size. It''s not just a matter of time before you get to the point where you can get your hands on a new pair of shoes, it''s also the world''s largest economic city. If it weren''t for this, there is no way you could spend a fortune on keeping monsters. The reason why demon trainers come from all over the world is because there are wealthy people who can hire them. In this city, there is a show called "Monster Battle" where demons and monsters fight each other. Many tourists from all over the world have come to see these battles, which are far more powerful than battles between humans. This has led to a virtuous cycle that generates huge amounts of money, attracts better trainers and demons, and further boosts the city''s economy. Therefore, in this city, demons are not something to be feared, but rather something that enriches our lives. That''s why you''ll see a trainer-like figure walking around the city with demons in tow. People accept it as a matter of course. Of course, since they are trained demons, there is no need to worry about being attacked, but the sight of young children chasing after a troll of nearly three meters in height, is still quite unsettling. Incidentally, generally speaking, a profession that can train demons is [Basic job] A trainer: commonly known as an animal tamer. Can train animals in general. Some mild-mannered demons are also possible. [Senior position] A monster trainer: Commonly known as a monster tamer. A trainer who can train all kinds of monsters. Beast and Demon Trainer: Commonly known as a beast tamer. A trainer of beast-like demons. Beast Demon Trainer: Commonly known as a slime tamer. A trainer of slime demons. A dead demon trainer: Also known as an undead tamer. A trainer of undead demons. Dragon Demon Trainer: Also known as a dragon tamer. A profession that can train dragon demons. In short, most of the Advanced Positions are specialized types. I''ve heard that there are many other types, but I''ll leave it at that. It may seem like the [Demon Trainer] is the upper-ranked position of the other [High Level] positions. However, while it is true that they can train various types of demons, they have the disadvantage of being inferior in terms of training ability in those types compared to the specialized types. It is said that in order to work as a demon trainer, one must be at least a [basic] trainer. ...But of course, I''m an unemployed person. I don''t have the skills required to train demons to obey me. However, that doesn''t mean that I can''t make the demons follow me. I''m sure you''ll be able to find out more about this in the future. ''''For now, let''s join some guild. There were guilds in the Demon City, just like in the City of Swords. They were called "Tamer''s Guilds," and most of them were owned by the city''s richest people. By belonging to these tamer''s guilds, they would be able to participate in monster battles. In the City of Swords, I got kicked out of the gate. But this time, I have two demons in my possession, so it probably won''t be too hard. ......... ''Hahahahaha!The weakest slime and this little demon?No. No, no, no, no!This is the kind of thing you''d lose if you fought those dogs around here! At the first guild I visited, I got a good laugh from a woman on staff. 97-Episode 16: I have no idea This isn''t just any slime, though. It''s a gluttony slime that only lives in the demon world. It''s small enough to ride my palm now, but it''s immune to both physical and magical attacks and can absorb everything and continue to grow indefinitely. But the female staff member doesn''t seem to be interested in listening to me at all. And you have no job!It''s true that there are some natural beings who get along with demons without having the skills to train them, but because of that, they sometimes mistakenly think they can become a trainer too, just like you. It''s just a coincidence. You can''t do it even if you were asked to follow another demon anymore, right? She decided to do so, and then said even more as a tome. ''''To begin with, you have to own at least five demons to participate in a monster battle, right?So, if you manage to bring three more of them in, I''ll give you an examination to adopt them. Well, I don''t think that''s possible, I see, so you need five demons. As I left the guild, I ruminated over the information I had obtained. Apparently, other guilds have similar conditions. I thought I''d have to register with the guild first, but it looks like I''d better get my demons in order first. A female staff member said that demons are sold in this city. There is a huge marketplace called the Monster Market, where you can buy all sorts of demons. For now, I went to the market. Hmmm.........market or rather, it''s almost a city of demons. I couldn''t help but marvel at it. The thick walls of the city are used to make countless cages lined up like a residential area. The inside of the cages seem to have been constructed to provide a suitable environment for the demon; they are covered with dense trees, pools, or even sand. Apparently, even ordinary people who are not demon trainers can enter, and there were families visiting with their children. Many people have gathered in the cage where the rare demon is located. ''''This is the first time I''ve seen this demon.'''' Among other things, the one behind the cage where many people were stationed was a wolf with divine white fur. And it was huge. It must be at least five meters long. The sign on the cage said "Fenrir". It''s a monster of legendary status. The price to buy it was also written there. "Expensive. That''s a lot of money, and even my entire fortune can''t reach it. ''''Well you don''t look too strong for that. I looked at the other demons, but they all seemed to be noticeably weaker than if I had encountered them in the wild. It felt like they had their fangs pulled out. I learned this later, but it seems that most of the demons sold here are born and raised in this city. Therefore, just like livestock, they have lost most of their wildness. Because of this, they are easy to handle through training, but at the same time, their fighting ability is inferior to that of stray demons. I looked all over the vast market, but at the end of the day, I couldn''t find a monster that struck a chord. Even so, the price is still reasonable. If this is the case, it''s better to catch it in the wild. I decide to do so and leave the market and return to the guild I just left. The same female staff member responds to me in a troublesome manner. ''''What, are you back again?'''' ''Yeah. I didn''t find any demons that looked too good in the marketplace. I thought I''d ask you to tell me where a good place to catch a stray demon would be. A Guild employee would at least have such information. Don''t you often get called brazen? Hmm?I have no idea what to expect. Yeah. She let out a dumbfounded sigh, then ''''Just a word of warning, catching a stray demon is hard even for a professional demon trainer, right?Of course, but unlike market demons that are already used to humans, they will attack you without question. That''s why we usually hire adventurers or guards with reasonable power, but.......do you understand that part? Don''t worry about that. I don''t think there are any adventurers who would respond to your request for an "unemployed"? I''m not going to hire you in the first place, though. She sucked her chin quizzically and You see the bulletin board over there?There''s information posted about what kind of demons are likely to be found where, so you can use that as a guide. So, they say, you''ll have to find the rest on your own. Hmm, okay. Thank God. I thanked him and headed over to the bulletin board. There was a map taped to the bulletin board. It seems to be a map that covers a fairly large area centered on this city, but it is painted in different colors depending on the location. It seems that the colors are different depending on the level of danger. The vicinity of the city is blue with a low degree of danger, and the further away from the city, the more dangerous it is. The further away you are from a city, the more dangerous it is, the more green it becomes, and mountains and forests are painted yellow or orange, which are even more dangerous. And the names of the main demons that appeared in the area were also marked. ''''What is this place?'''' I found a strange spot. It seemed to be a plain area, but the colors were changing in wonderfully concentric circles around a certain point. As we got closer to the center of the circles, the danger level increased, and the color changed from yellow to orange, then to red, then to darker and darker, and finally to almost black. It seems to be a place called the Great Plains of Batuda. ''''So that means if you go here, you''ll be able to meet strong demons. I was convinced of that and decided to go to this plain area. 98-Episode 17: It looks like a really nice guy We flew through the sky with flight magic for about three hours. The Great Plains of Batuda came into view. Even if you look around from the sky, it''s a vast, unobstructed area. Although it was neatly color-coded on the map, in reality it was just a plain plain. The only thing we could see was a reddish-brown mass far beyond the plains. It looked small from here, but considering the distance, it was quite large. Is it a mountain, or is it a rock? Apparently, that''s just where the area was blacked out on the map. I''m sure it could be seen from anywhere on this plain. It would be a perfect landmark. Hmm? I find what looks like a village on the ground. There is a moat and wall around it, and there are horses, cows, and sheep that look like livestock. I''m sure it''s inhabited. I went down to the ground and went through the gate, which had no particular gatekeeper, and went inside. The houses are all like tents, and there are probably about 50 houses in total. However, each house is quite large. They seem to be made of very sturdy fabric, and they don''t seem to be able to take a beating in the wind and rain. However, as expected, if a large demon appeared, there would be no room for improvement. Wasn''t this area a danger zone? But it''s still quiet. I don''t see anyone at all. And that''s when I found the first person. It''s a woman of forty. Welcome to the Great Plains of Batuda. Are you looking for a rare and unique demon? Yeah, but... ... this place? Haha, wouldn''t you be surprised to see a settlement in such a dangerous place?But the truth is, the demons of the plains don''t come to this area, so we''re safe. I don''t know what the principle is, but it is said that the demons living in this great plain, while the deeper you go, the more powerful the demons become, they never go out of their specific places. That''s why they can be neatly color-coded according to the level of danger, just like that map. This is a place where adventurers, hunters, and demon trainers keep coming back for more. They are the target of our business. The reason it was so quiet was because most of them were taking on the plains at this time of day. ''Well, I suppose it''s about time they came back. It was past noon when we left the Demon City, so the sun had already begun to set in the west. I heard that there are some people who camp out on the plains, but at night it becomes dark and the danger level increases, so many of them return to this village to stay overnight. Most of the tents in the village are inns. We have a restaurant at our house.If I may say so myself, it''s a popular restaurant in this village. It gets crowded very quickly and it''s hard to get a seat. It seems to be free now. It is a little early for dinner, but we decided to go out to eat. Her shop was right around the corner. Entering through a rather large entrance. It was larger than I had imagined from the outside. The ceiling was high, perhaps more than three meters high. It''s like a giant''s residence. The tables and chairs that are lined up for it are the size of a normal human being. It''s designed so that even demons can enter it. Of course, any race that is too big or unsanitary is not allowed. I see. It''s no wonder all the houses are so big. They''re made from the pelts and bones of the demons that live in these plains, but they''re strong enough to be this big. The restaurant is apparently run by a family. There was a middle-aged man who said he was a woman''s husband, and a daughter about my age. She was right, it was empty now. Or rather, there wasn''t a single customer. I sat down in a suitable seat. This also seems to be a specialty of the dish with the meat of the demons that can be hunted in this plain, so we ordered it appropriately. While we waited for our food to come out, I asked the girl who brought the water for us. She was tall and beautiful, vaguely resembling Laina. By the way, can I ask you something? What is it? ''What''s that thing across the plain that looks like a rock? She made a face and said, "Oh, that. It''s in the center of the plain, and it''s called Demon Rock. Demon rock... It''s rumored to be inhabited by an incredibly powerful, legendary demon. There''s a lot of talk about a giant demon that can prey on even Gigant dragons, or a demon with fangs and claws that are sharper than Fenrir''s, but I believe in the theory that a fallen angel is sealed inside. Do you know?I heard that the angel is an incredibly handsome man... He says with an enthralled face. Apparently, his personality is very different from Laina''s. ''Has anyone else gone that far?'' As far as I know, no one. I''ve seen a number of people try to get up to speed, but most of them came back wrecked without even making it halfway. I mean, not just me, but everyone in the village says they''ve never seen anyone who has made it to that rock, and I''m guessing no one has ever done it before.So maybe all of that stuff you mentioned earlier is just a rumor, or maybe it''s just a fantasy. I see. Just getting to that demon rock is not an easy task. "Are you going for that magic rock too? Yes. I nodded. But that''s not the point of going to that rock, though. Our goal is to turn the demons there into followers. No, you can''t. 99-Episode 18: Order Properly and Wait Impossible? ''''Of course it is. Just getting to the Demon Rock is difficult enough, and turning a wild, legendary demon into a squire is obviously impossible. Hmm.... And you''re a demon trainer? Yes. I don''t belong to the guild yet, but I''ve got two demons in tow, so I can''t be wrong. ''''What''s wrong with the demons?'''' There''s one here. ...Domo. I pointed to Mattie, who was drifting nearby. That''s how I finally noticed her presence. Demons that are weakened have little presence, so it''s hard for people to notice them like spirits and fairies. ''''Eh?Is this a demon? Yes. Can you fight? ''You''re not much of a fighter in this state, are you? She wrinkled her brow often, and then eventually popped her hand. ''''So we''re going to meet up with a party of adventurers who are going to help us, right?'''' I won''t. How the hell do you think you''re going to get to the Demon Rock? I''m going to go as normal? ''If you can do that, you won''t have any trouble!I told you, didn''t I?They said they all came back without going halfway!There''s no way a trainer with no rogue demons and no support staff can get to the Demon Rock!And to have a legendary demon as your squire is a dream come true!On the contrary, as soon as you cross the border with the safe zone, the demons will get you! She said that the demons that dwell in this plain are powerful even if they are far from the central demon rock. ''''That''s why a demon trainer who doesn''t have the strength to fight would either ask a party of adventurers to help him or make a sufficiently strong demon a follower before taking on the challenge. I see. ''I see... normally, if you''re a trainer by nature, you should know that much...'' She exhales in disgust. And then ''Ayrshire!Long time no see!I''ve missed you! With a cheerful voice, a young man came running into the store. He is probably in his mid-twenties. He has a slender, medium height and wears an ostentatious robe with gorgeous embroidery. ''''Well I''m here again. The girl in the store mutters with a blatantly disgusted look on her face. Apparently, her name is Arthia. ''Do you know her?'' "I''m a regular. He''s made advances to me many times and I''ve said no. And yet he is persistent. Even so, it seems that he is a famous demon trainer in the demon city, but his face and personality are not my type. Following the young man, several demons entered the shop. They must be his followers. There are wolf demons, gorilla demons, and even larger demons like ogres and minotaurs. But none of them are the usual common individuals. The ogre has only one horn, while the minotaur has an unusual horn shape. It may be a demon unique to this plain. ''''Wha........who is that guy?'''' The young man who had come close to me suddenly looked unhappy when he noticed me. ''Who, of course it''s the customer, right?'' ''Ha, that''s right. I thought you had a girlfriend! The young man laughed off like that when Arthia responded with half an eye. ''''Well even if I could, it wouldn''t matter to you, not really. The young man didn''t hear Arthia''s murmurings, but he announced with enthusiasm. ''''Actually, this time, I''ve succeeded in following a very rare demon!Come on in, Griz! Guru... In response to the young man''s call, a huge bear with a rather well-developed arm sluggishly walked into the store. Arthia gasped. ''''This, this is........'''' It''s an arm-grizzly!It was a real pain in the ass to train him, because he was so strong and obedient!So much so that it took this me a whole day! The giant bear has arms longer than its legs on the ground, but its head is still just above the ceiling. If it were to stand up, its head would surely touch the ceiling. ''''Gururu........'''' Moreover, she doesn''t like this small space, or she''s clearing her throat uncomfortably. You''re not going to be able to get away with it?You''re not going to run amok in the store, are you? "Ha-ha, don''t worry about it!After all, I''m the one who disciplined him! The young man laughed lightly and tapped his chest as Aasia questioned him anxiously. But at that moment, the giant bear lightly swung his right arm. Zgashan! Tables and chairs that were nearby were blown away and a grand sound was heard. ''''Ha, ha ha........'''' The young man''s smile twitched a little. ''''Hurry up and let me out........! No, he''s fine. I''m just a little excited, that''s all. Gururu-ruh. Zgashaaan! Another table has been sacrificed. Still, the giant bear showed no signs of settling down. ''Griz!Whoa!Calm down!Come on, let''s get out of here. It''s true, this place is a bit small for you. The young man thought that this was not a good idea, and he urged the giant bear to take him out of the store. But the giant bear didn''t respond to that, and instead entered the back of the store. ''''Hee!'''' Arthia rushes away. The young man manages to stop her, but the giant bear still has no say in the matter. The giant bear is apparently heading towards the kitchen. A delicious smell is wafting in the air, and maybe it''s caught by it. ''''Guru-ruh.'''' But on the way to the kitchen, I was sitting and waiting for my food to come out. The giant bear was in my way and tried to brush away the entire table with an arm bigger than a log. ''Oh, look out!Run! Gasp. ""Huh?" I said to him, "Don''t hold the arm of a giant bear in your hand. I said to him, "If you want to eat, you''ll have to order and wait. 100-Episode 19: Im annoying you Guru-ruh? The giant bear let out such a sound, as if he was surprised that his arm was received. And its consciousness seems to have turned from the kitchen to me. ''''Gururuaaaah! Maybe it was too hard to stomach the fact that he couldn''t get rid of someone much smaller than himself. The giant bear let out an exasperated yelp and put more force into his arms. Even though it was covered in fur, the swollen muscles were clearly visible. ''''If it''s a contest of strength, I can''t lose either!'''' I counteracted and worked on my arms. My muscles expand, and my arms grow two sizes thicker. ''''Guru........'''' Hmm, it''s pretty close. Power and strength clashed, and although their arms trembled in small increments with each other, their arm positions remained perfectly still without pushing the other from either side. ''''Oh, you''re having an arm strength match with an arm grizzly! And it''s evenly matched...? The trainer, a young man, and Aasia are looking at each other in disbelief. ''Are you serious now?'' What? I''m not quite ready for this stuff yet. I stood up. As expected, it''s hard to exert myself while sitting down. ''Fifty percent of your full strength for now,'' ''''~~~~? The giant bear''s upper body tilted. I tried to adjust my position in a hurry, but in the meantime, I was pushed so hard that I couldn''t bear it with my legs alone, I hurriedly put my opposite hand on the floor to support my body. That would make them antagonistic again. ''Then let''s get it up to sixty percent. Huh? Slip and slide, and the giant body slides on the ground. Apparently, this kind of force is enough for you. I continued to push the giant bear and let it out of the store. "Stay where you are. Ugh.... Realizing that it was no match for him, the giant bear cleared his throat pitifully and dropped a paragraph. ''''You pushed an arm grizzly out with one arm!Nah, what the hell are you doing? You''re a trainer. You should have a better handle on your demons. I advise the young man as he runs out of the store. He looks like he wants to argue with me for a moment, but as expected, he understands his mistake. Hey, that''s enough for today... He took the other demons with him and left in a huff. When I returned to the restaurant, I sat down again at the seat I had just taken. ''''Hmm, is the food ready yet?'''' When I looked towards the kitchen, I saw the couple who should have been cooking, standing there looking at me, stunned. At that moment, the smell of burning could be heard wafting through the air. They came to their senses with a huff. "Oh, dad, it''s burning, it''s burning! Wow! Then it took about ten more minutes for the food to come out. ''Thanks for the meal,'' Oh, I don''t need the money. When I finally finished eating and was about to pay for it, he said to me like that. ''I''ve caused you trouble.'' Really? I just paid off the fire that had fallen on me. ''And it really helped. The store would have been in a lot of trouble if it hadn''t been for that...'' The demons right after being made into a submissive demon still often don''t do what they say, and they need to be handled carefully, and they usually don''t let them into the shop. He exclaimed in frustration. ''But then again, weren''t you the trainer...? He''s a trainer. But I''m also a swordsman and a sorcerer. ...Yes? ''Hey, Ayrshire!Order, please! ''Oh, yes!I''m going now! The restaurant had become quite crowded before long. Arthia interrupted the conversation when a customer called her over. ''I''ll let you hear the details next time you come in!So make sure you come back for more! After announcing this in a hurry, she hurried to take her order. Leaving the shop. The sky was already beginning to turn reddish-brown, and the city was coming to life, as if the guys who were out on the plains had returned. ''I guess we''ll have to start trying the plains tomorrow. In the meantime, I''ll stay at an inn somewhere for today. The next morning, I had stepped into the Great Plains. There was really nothing to see, except for weeds and shrubs growing in places and a shadow that seemed to be a demon moving about. The only thing left to see in the distance would be the reddish-brown rock that marked the center of the plains. ''Hey, hey, brother. You don''t mean to challenge this plain all by yourself?That''s reckless. Suddenly, I hear such a voice from behind me. When I turn around, I see a group of four people dressed in quite fine equipment. ''''Who are you guys?'''' "We''re the front line of an A-list party. It seems to be a party of adventurers. I''m sure you''ll be able to find a lot of good reasons to go for it. And I''m the leader, Blake. Okay. What? Wait, wait, wait, wait. I had nothing in particular to do, so I tried to quickly move on, but he hurriedly called out to me. I''m sure you''ll find that even the outermost part of this great plain is riddled with dangerous grade B or higher demons. It is suicidal to attempt to go there alone. I''m not going to say anything bad about it, so you''d better think again. We''ve seen a lot of young guys like you die. It''s a good idea to have a good old fashioned advice. Hmm, I''m not sure I want to. Well, okay. Well, if you insist, go ahead. They looked at each other and cowered their shoulders as if to say, "Oh dear. I''ll do that without being told. I moved on. 101-Episode 20: Youll understand even if you dont like it As they were moving through the plains, a huge shadow loomed from the sky. ''''Oaaaaaah!'''' Hmm, a wyvern. It is a reddish-brown scaled wyvern, which is not often seen. It''s a bit bigger than the usual green wyvern, at about three meters in length. It seemed to regard me as its prey, and was descending towards me at high speed. "''Flying Blade'' Gagya! When the blade flew off, the fuselage was neatly cut in half. It split up and down and crashed to the ground. Further on, this time I heard the rumbling of the earth. The ground was vibrating and it was getting closer and closer. ''''Hm?There are demons in the ground too? When it eventually came right up to my feet, I stabbed my sword into the earth. ''''~~~~? I thought I heard a scream of astonishment and anguish coming from all over the ground. Even so, the momentum just didn''t stop, the ground rose up and a part of the demon appeared on the ground. A round, hairy head. Probably a mole-type demon. My sword had pierced through my brain, and I was already doomed. I proceeded onward. Then something like a wall stood in front of me. ''''What''s this?'''' Bright green. It is lined with a diamond-shaped pattern and is about one meter high. It''s not a straight line, it''s too rounded to be called a fence, and it''s not straight, it''s snaking around to the left and right. When I touched it, it was very elastic. I don''t think there are any artifacts in such a place but.... ''''Shaaaaaaah! Its identity was revealed when both sides of the wall were lifted and a sharp, threatening sound was heard. There was a huge snake with a sickle-neck on its back. ''''I see, so this was the body of a giant snake. And it seems that the tail doesn''t exist and both sides are heads. They attacked me from both sides at the same time. ''Explosions x 2'' Dodo-O-O-On! ''''~~~~?'''' Two explosions erupted and their heads were blown off at the same time. All that was left was its long torso. I jumped over it and went further. God, you always seem to be too trusting, leader. Yeah, exactly. I''m trying to tell you what to do, but you refuse to listen to me. You should be ashamed of yourself, you know. Yeah, yeah. And I can''t believe you''re following me all the way down here. Well, don''t say that. It''s just a young man.It''s understandable that you''re overconfident, and it''s better to have a painful experience for the future. But if you''re alone, you''re dead and that''s the end of it. In the adventuring world, the A-list party "Frontline" is well known. The leader of the group, Blake, a Class A adventurer, was a self-respecting good-natured person, despite his stern appearance. The reason I advised that young man earlier was really out of concern for him. He had seen such a bloodthirsty young man lose his life so easily in the past, so he couldn''t leave him alone. The members have complained, but none of them are serious about it. They were half-amused by their leader, but good understanding. Incidentally, as an A-ranked party, the least they could do was to eliminate any sign of their presence. Even if it was this plain with a clear view, there was no way that that young man in front of them would notice them. ''''Well, in any case, once you fight the first demon, you''ll realize that you don''t want to,'''' That''s when one of the members cowered his shoulders, thinking that the stranger young man''s amulet wouldn''t be around for much longer. ''''Oaaaaaah!'''' Gliding from the sky was a reddish brown scaled wyvern. It was called the Red Wyvern, and it was bigger and more rabid than the normal wyvern. Moreover, those reddish-brown scales were extremely hard, and even a top-notch swordsman would not be able to scratch it so easily. ''''It''s unfortunate that it''s a Red Wyvern all of a sudden. If it''s not, your first attack will be fatal. The members of the front line were a little flustered by the appearance of one of the strongest enemies among the demons appearing on the outermost part of the plains. ''''Guggah!'''' But in the next moment, for some reason, the Red Wyvern let out a scream and its torso was cut in half. As it was, it crashed into the ground in a grand manner. ''''.........What?'''' They were stunned with their mouths open, unable to understand what the hell had happened. ''''What just happened...?'''' How did you suddenly get cut in half...? In the midst of all this, only Blake, a Higher Level Heavenly Swordsman, correctly grasped what happened in front of him. ''''Keh, he swung his sword........'''' What? ''That young man ... it was only for a moment, but it looked like he pulled his sword out of its scabbard and flashed it at me ... it felt like ...'' But he didn''t see it clearly either, and even he seemed to be skeptical. "No, no, no, no, no matter how you look at it, I didn''t do anything, did I? I think so. Look, the sword is still in its scabbard. One after the other, they would argue against it. To the other three, it seemed as if the Red Wyvern had been cut in half on its own. ''''Dude, first of all, there''s no way it can reach you if you swing your sword, right?We were so far apart. ''That''s true, but...'' Hey, hey, hey, he''s getting away! The young men had already moved on as if nothing had happened. They hurriedly followed him. 102-Episode 21: Have You Called Your Friends? The A-list party "Frontline" is in pursuit of a young man. Suddenly, their feet begin to shake. What was that, an earthquake? They''re going to get stronger and stronger...! But suddenly, the vibrations stopped abruptly. I wondered what it was all about. Oh, hey, look at that. That''s... a death mole... The one that was dead on the ground with only part of its huge head sticking out was a mole monster that moved through the soil and attacked from underneath its feet. Its total length is over three meters at the smallest, and it can swallow a human being whole. ''''Its head is cracked........'''' "Fool, the head of a death mole is supposed to be protected by hard hair and a thick skull...? That''s why it''s a powerful enemy that can''t easily deal effective damage even if you pounce on it the moment it comes out of the ground. ''''Did he do it...?'''' ''But when did you...?It looked like he stopped for a moment, but there''s no way that''s enough to finish off the death mole...? Oh, no!He''s approaching the Double Head Snake unprotected! One of the members of the group shouted with a hint of blood and they huffed and raised their gaze. While they were distracted by the corpse of the death mole, the young man had moved on for over two hundred meters. And lying in front of him was a long, giant green creature. The double-headed snake was a monster that even they, the A-ranked party, struggled with. It is a huge snake with no tail and a head on either side of its body, and yet it has a powerful venom. When he first encountered it a few years ago, it was a bittersweet memory of running for his life. It seems that the two-headed snake had woken up when it noticed the young man approaching. It held up its sickle-neck and attacked him from both sides. Dodo-O-O-O-On! "....? But the next moment, the snake''s head exploded in a grand explosion. They couldn''t help but meditate as the blast rushed up to them. When they opened their eyelids, the double-headed snake had lost its head and only the snake''s body had fallen. ''''I, was that........Explosions.......?'''' ''Highest level of red magic, you mean...? They stand there, unable to follow their understanding. Before they knew it, the mysterious young man was far beyond the plains. They had already stepped into the middle layer of the plains, where even they had barely been able to challenge it yet. ''Hmm. Looks like you''re not following me anymore. The signs were completely away from me. The adventurers who had approached me, the front desk something, had been following me all along. I didn''t feel any particular signs of killing or danger, so I let it go, but what the hell was the purpose? Oh, well. Let''s move on. We were not even halfway to the giant rock in the center. We''re barely a third of the way there. Just as we had heard, the closer we got to the giant rock, the more powerful demons began to appear. ''''Garuaaah! Shhhh! Meh-eh! Standing in front of me now is a demon chimera with a lion, a goat and a snake head. The lion will try to bite me with its sharp fangs. The goat seems to be able to use white magic to strengthen and heal its allies. And the snake spits out a poisonous mist. Despite their appearance of fearlessness, they seem to be surprisingly intelligent as they work together while fulfilling the roles of the three parties. ''''Meh-eh-eh?'''' I took down the nasty goat first. ''''Ggag?'''' Gah! He then killed the snake and finally put away the lion. Further on, this time a burning firebird appeared. ''''Kuehneh!'''' He releases a breath of flame from the sky. ''Blazebird. --Permafrost. Kuh? I freeze it with blue magic and it falls to the ground. I finish it off by slashing its neck. ''''Uh-ho-ho-ho! You''re a big gorilla. This time, a giant monkey nearly ten meters tall attacked me. Moreover, it had four arms and was swinging them around to strike at me. "''Double-blade slash, modified!'' "Bucho? With one swing, he unleashes four slashes, cutting off four arms at once. The giant monkey''s head, stunned by the loss of its prized arm, was met with a brain slash with the warped sword. The giant body fell down with a ground shaking. ''''So this is finally two-thirds of the way down?'''' The giant rocks were getting closer. The demons they encountered along with it were becoming even stronger. ''''Ha!'''' Wielding two mantis-like scythes and attacking at breakneck speed was a giant bee that was over a meter tall. Buuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu! Shubba-ba-ba-ba-ba-ba! The wingbeats and sickle sounds are extremely loud. Zazangs! ''''~~~~? First, I cut off the sickle. Then he quickly pointed the poisonous needle at me with his tail. Zan! What? I''m going to cut that guy off too. Buuuuuuungh! Then he ran off in a hurry. ''Hm?'' After a while, countless objects come flying in from the sky. ''''........I see, you''ve invited your friends over. All of them were the same kind of bees that I had just let loose. There must have been more than a hundred of them in all. Buuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu! Shubba-ba-ba-ba-ba-ba! Buuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu! Shubba-ba-ba-ba-ba-ba! Buuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu! Shubba-ba-ba-ba-ba-ba! Buuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu! Shubba-ba-ba-ba-ba-ba! ...it''s f*cking annoying. I''m going deaf. "Flying Blade. Zubaba-baba-ba! Before they could get close enough to me, I let my blade fly and cut them down. Since it''s a large swarm, I was able to kill a number of them together with just one strike. Even so, I can''t take them down due to their original numbers and allow them to get closer. They surrounded me from all directions and pounced on me all at once. "That one''s an afterimage. But I wasn''t already there. I sent a blast of fire at the swarm of bees, which had almost turned into a single mass. Explosions. Doggone it, doggone it, doggone it! 103-Episode 22 Gekioko Finally, we''re in the center... ''''It''s been a long time........ I didn''t expect it to take even us six months........ Don''t get complacent yet, you two. This is the legendary demon that lives here. We need to find out if it exists. Zelt is right. .... and in some cases, we need to be vigilant so that we can get out of there quickly. The heart of the Great Plains of Batuda. A huge rock sits there, and there are four men and women. They were top-notch adventurers formed from all over the world with the sole purpose of capturing the Batuda Great Plains here. All of them were S-ranked. Their occupations were the Knight King, the Magic King, the Thief King, the Thief King, and the Great Saints, all of which were the highest level of service. However, even for such people, as the officials had said earlier, it had taken half a year to reach this point. However, considering the fact that it is said that until now no one has ever reached the center of the city, it can''t be helped. ''''But even so, this area looks like it''s devoid of demons...?'''' Up to this point, the closer you get to the center of the city, the more vicious the demons become. But here, on the contrary, they hadn''t seen any demons at all. ''''Isn''t it because this is that legendary demon''s territory?'''' If that was the case, it would be a very powerful enemy. For example, it was said that demons that lived for a long time, like the ancient dragons, had intelligence. In many cases, if it was a legendary grade demon, they could talk to each other, but........ Just in case, they are in a covert state. If the Thief King used the upper level skill of Secrecy, Zetsuzetsu, which can be acquired by the Thief King, not only he, but his friends could also benefit from it. This skill was also extremely useful in traversing the plain, which was overrun with vicious demons. However, I don''t know if it''s effective against legendary grade demons as well. ''''Even so, it''s a big rock.'''' It''s 300 meters long and 150 meters short. It must be over 100 meters high. They decided to go around the rock for now. The shape was nearly oval and the rock surface was ochre-colored. When they touched it, it felt strange. ''Is it a bit warm?'' Yeah. It''s got some elasticity to it. ...Is this really a rock? And that''s when it happened. Suddenly, a crack appeared on the rock surface far above. I''m sure you''ll be able to find out more about this. "....what? Furthermore, the huge rock caused the body to rise up. With that alone, the earth trembled and a sandstorm erupted. And then a monster appeared in front of them, more than a hundred meters in height. ''''Be, be........behemoth! Well, they''re not just a legendary, but a mythical creature? Yes. All along, what they, or rather everyone, thought was a rock was a behemoth, a behemoth of mythical proportions. Does it look like a hippopotamus? It had a stocky body, with a long torso and four legs that were quite short for its size. Because of this, even if he stood up, his shoulders did not change much. At that moment, the behemoth opened its mouth wide. The nose part leaps up to the sky at once. The inside of its peach-colored mouth is now in full view, and its mouth is so large that its jaw might have come off. There are rows of huge fangs there, so sharp and thick that even a dragon could bite them off. Gooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! ""Uhhhh!" The storm suddenly arose. They were blown away in the direction of the behemoth. Buuuuuuuuuuut! ""Nuh-uhh!" The behemoths then slowly close their mouths. This time a storm occurred in the opposite direction and they were blown away again. To tell the truth, that was just a lackluster move, but that was enough to leave the S-ranked adventurers at the mercy of the S-ranked adventurers unable to do anything about it. They rolled on the ground covered in dirt and looked up at the monster that appeared in front of them with a despairing expression. ''''It''s a monster........'''' I gotta get out of here. How am I supposed to get away from this guy? It''s this huge. A single step would advance several dozen meters. It was unlikely that he would be able to escape being chased by such an opponent. ''''No, no, the opponent is a mythical demon!Maybe you''ll understand if you talk........! So you can talk to him? You just have to try! Who does that? I don''t want to! ''I don''t want to!Yes, I''m sure the women would be caught off guard! Hey! Soon, the one who stepped forward to represent was the adventurer of the Knight King. What a brave man. ''''Kuh........if only I had goofed off over there......! But he just lost in a junket. ''Wow, we never meant you any harm!No, as you can see, it''s a tiny little person!That would be impossible!Please, please, don''t attack us! Wobbling with fear, he appeals to the giant monster. Will it reply? Then. "...sleeping. How the voice came out of nowhere. And it was a human language. A glimmer of hope lit up in the hearts of the S-ranked adventurers, thinking that this might be able to help. ''''Hey, I''m sorry to wake you up from your slumber!But I didn''t know that!We need to get out of here now!And I''ll make it known that no human will ever stop by here again! Behemoth says, whether or not he hears such a [Knight King] claim or not. ''I was sleeping comfortably.'' He continues. "I''m furious. Apparently, he''s angry. "I will not allow it. ""Hi, hi, hi, hi, hi!" Immediately afterwards, the behemoth slammed his paws into the ground. I finally got close to a giant rock. But ..... Hmm, how''s the rock starting to move? 104-Episode 23: I changed my mind Whoa, whoa, whoa! The S-ranked adventurers fled in a flash. But in the next moment, the behemoth slammed his right paw into the ground. ""What?!" A light foot stamp. But if it was unleashed from the super weight of millions of tons. Goggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggg! The earth shook violently. It was so bad that even the S-ranked adventurers couldn''t stand. They rolled on the ground pathetically and were not even allowed to escape. ''''Hm. ''''The end.'''' The behemoth raised its paws again. A huge shadow covers the adventurers'' heads. ''''Hi, hi........'''' I''m going to die here... The soles of their feet seem to be able to lightly trample down even a dragon. As they watched it approach, they prepared to die. That was the time. ? With a tremendous roar, the behemoth''s right front leg, which was about to be swung straight down to the ground, suddenly changed its trajectory. The one that was stepped down was just a few meters away from the adventurers. ''''Ahhhh!'''' The impact had blown them up like scraps of paper, but they had escaped death. ''Who are you?'' The behemoth turned its gaze on the new intruder. ''''Hmm. I''m not sure if it''s a mythical behemoth. I''m sure it''s worth training. Suddenly, a huge rock began to move. When I got close enough, a group of four men were attacked. ''It wasn''t a rock?'' I thought it was a huge rock, but it seems to be a demon. Judging from its huge body and hippopotamus-like appearance, it was probably a behemoth, a mythical grade demon. When that behemoth slammed its paws into the ground, that alone caused a massive earthquake. I couldn''t run on the ground with this. I immediately jumped up into the air with my green magic. However, the adventurers who were trying to escape were properly affected by the vibrations and pulled back. As if trying to further toss them, Behemoth now raised his paws above their heads. If he was trampled by that kind of super-weight, the last thing he would do was lose all of his blessings in an instant and die. "''Flying Blade'' x 30. I swung my sword with all my might as I flew through the air. "A series of ''flying blade'' shots hit the behemoth''s huge right front leg. It somehow deflected its trajectory and was swung down right next to the adventurers. ''So that''s about it for 30 rounds? That''s as good as it gets. I thought that one or two shots would only be enough to snatch the surface of my leg at most, so I fired in rapid succession, but it was still enough to move one of my front legs a few meters. ''''Who are you?'''' As I flew closer, I heard a mysterious voice. ''Hmm, you can talk to me?'' As expected of a mythical demon. What the hell happened...? We''re alive...? Then a bewildered voice comes from the ground. It''s the adventurers from earlier. ''We''d better get out of here. I advise them. "Oh, you are? Hey, it''s not safe!This is a behemoth! Then, for some reason, he warned me back. ''Hmm, he''s talking to me right now,'' Behemoth muttered, as if he didn''t like the fact that humans were communicating with each other. "Hmph. He let out a snort. Of course, it was different in dimension from human snorting. ''''Uh-oh!'''' A gust of wind blew the adventurers away again. ''I''ve changed my mind. Go away quickly.'' It''s... Hey, hey, he''s letting us go! What about the boy? Leave it alone! The adventurers scurry away. Behemoth quickly loses interest and turns his huge eyes on me. ''''Leg, it hurts.'''' ''Hmm, I''m sorry about that. Otherwise, my people would have died. "My body is so hard. It''s been a long time since I''ve had a scar. There were countless cracks running through the area where my "flying blade" thirty consecutive shots had been fired. The deepest point where these cracks had overlapped each other must have been gouged out at least a meter deep. However, considering the behemoth''s enormous size, it wasn''t a serious wound. ''''Who are you?High demon race?An old dragon in human form? Who''s going to do what again? It''s a human being. Lies. It''s beyond human dimensions. That''s what I''m talking about. My mom and dad are pure people. I don''t care. That''s why I''m here, of all places. To become a demon trainer, I have to turn a few more demons into my followers. .... What do you think?Will you be my squire? I asked him, and the behemoth was silent for a moment. "No. Why? ''That''s my line. Why would you want to be a human squire?There are plenty of demons around. You can catch the ones you like.'' ''''I heard it''s true that any demon is fine........ But I''d rather have a strong demon anyway. "No. Hmm, I don''t think it''s going to be that easy. I''ve got a long way to go. I don''t have the skills to train them. But like all skills, with training, you can learn to do without it. From now on, you''ll have to train your behemoths in front of you. The master is still mad as ever to try to do this with a mythical monster. Well, the worst thing you can do is to weaken them and then force them to become submissive demons with slavery magic, as was the case with Matty and Pluru. 105-Episode 24: It was so painful right now How does a demon trainer train demons? It depends on whether they are wild or captive, but I heard that they do the following. First of all, he shows that he doesn''t have any hostile feelings towards the demon and lets it off guard. At that time, it will strike a pose or make a special sound that the monster likes. Apparently, the smell is also important. So they sprinkle the demon''s favorite perfume in advance. By the way, how do they find out about this area, it seems that if you have the training skill, you will be able to intuitively understand it. And most of them probably use bait. In other words, they feed. When a demon gives you a tasty meal, it will be less wary of you, even if it''s a demon, and it will become more friendly, thinking that it can give you more. Once they were able to get close to them in this way, they would become even closer by caressing them. It is said that depending on the race of the demon, and depending on the individual, what part of the body it is happy to be touched changes greatly. It is said that if you have the training skill, you can detect this area with a high probability. Now, let''s see. Based on the above, I''d like to try to train this monster in front of me. ''''Vigilance........probably not. I have no idea what kind of pose or voice this demon would prefer. But since he was an intelligent demon, we were able to talk to him. And the fact that we were able to talk to it means that it has already let down its guard. Hm, it seems that you''ve already broken through the first barrier. ''''It doesn''t seem very likely, but...? I decided to follow suit and feed them. But I have no idea what they like to eat. Well, since we''re having a conversation, why don''t you ask him directly? By the way, is there anything you want to eat? No. ''Don''t say so, say something. I''ll bring it to you. It''s not necessary. There are plenty of demons out there. I catch them myself sometimes and eat them. It can''t be helped. Well, let''s move on then. "Anywhere you want me to stroke it? No. ''Don''t say so, say something. I''ll pet you. "No need. No? ...Your master is clearly not cut out to be a demon trainer. But that''s not what I''m going to do. ''Well, well, well, don''t say that. You know what I mean? "Annoying. ''I see. Perhaps you''re angry at me for attacking your leg earlier? "Don''t worry. It doesn''t hurt that much. I''ll be fine. I will cure you with white magic. "I don''t want it. Go away. Boo-hoo-hoo-hoo! Huh! Suddenly, the behemoth let out a furious snort and I was almost knocked to the ground. Somehow I managed to land on my feet, but Die. Then the behemoth swung its paws down. Zdoooooooooooooh! Dead? No, he''s not dead. I jumped up from a little distance in the ground(...). I had dug a hole in the ground with my earth magic to escape before being trampled by a giant foot. ''''........Stubborn even for a winged insect. Then I''ll take it seriously.'''' A killing spirit swelled up from the behemoth''s huge body. With that alone, the surrounding atmosphere trembled and the earth rumbled. ''''Hmmm.......Looks like I''ve pissed you off in earnest. I don''t think we have a choice. It looks like we''re going to have to fight if this happens. Immediately after, the behemoth kicked the earth and rushed forward. With that alone, the ground was gouged wide open and the earth and sand scattered like a tsunami. And even though it was of this size, it was fast. Thanks to that, I couldn''t avoid it, and it ate me up decently. My vision changed in an instant, and before I knew it, I had been blown five or six hundred meters away. As expected of a mythical monster. The attack power that comes out of its super-heavy weight is beyond standard. This is an opponent that should never be attacked. ZuDon ZuDon ZuDon ZuDon ZuDon-- The behemoths chased after him as the ground rumbled. ''Explosions x 5.'' A huge explosion erupts from Behemoth''s right front leg. ''''Huh?'''' The behemoth, as expected, stumbled and tripped, and crashed face first into the ground. A huge earthquake. And a tsunami of sand. I jumped up into the sky to escape it, but I glided toward the behemoth, which was trying to get up, and with my momentum, I went into its huge forehead. With all my momentum, I thrust my sword as hard as I could into its massive forehead. Aaaaaaaaaaaaah! It must have worked. The behemoth let out a loud scream. The shockwave caused the dust cloud to scatter in four directions. ''''That was very, very painful. The behemoth, which is bleeding freshly from its forehead, stands up on its hind legs alone and angrily swings its front legs and tries to knock me off in the air. The mere act of swinging creates a tornado-like gale, so even if I avoid it, I''m likely to be blown away. The earth that my hind legs are stomping on keeps generating earthquakes, and this guy is just a living natural disaster. I continued to fly as fast as I could and avoid the swinging paws. I really felt like a winged insect. ""Flying Blade." Of course, they didn''t just run away. I fought back from us as well. As big as it is, the behemoth has lost track of me many times. The behemoth is steadily being carved with wounds, but its durability must be beyond standard, and it shows no signs of falling. On the other hand, I''m avoiding a direct hit from the behemoth, but my blessings are slowly diminishing. It''s because of the storm that comes from just swinging my legs. Hmm, what should we do? If this is the case, our blessings and strength will run out before we do. "I''m so annoyed. Then suddenly, the behemoth opened his mouth wide. I was on the lookout for what he was going to do. Soooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! .... sucked in...? The behemoth is taking a breath of air. That''s all it takes to draw me in. ''Oh no, he''s going to eat me if I don''t. ''Hmm, I''ll take it.'' 106-Episode 25: Wheres the Training Death? You''re having a good fight with the behemoths...? Who the hell is that young man? These S-ranked adventurers, who had fled for their lives from Behemoth, were stunned by the dimensionally different battle that was unfolding far away. ''''He''s a swordsman?'''' But he''s also using magic!And I''m flying through the air with wind magic! So what''s this about a wizard? ''''I don''t know how a dexterous wizard can use a sword like that! Even magic can''t do that! The Knight King, the Magic King, the Thief King, the Thief King, and the Great Saints, all of whom are at the highest level, but I have no idea what that young man''s occupation is. I tried to think of all the occupations I could find, but none of them fit the bill. ''''I mean, in the first place, no matter what kind of occupation you have, you can''t imitate that kind of inhumanity! The slightest movement of this mythical mountain of monsters could cause earthquakes and storms. It would not be an exaggeration to say that it was a natural disaster itself. A young man of at most twenty years of age is fighting against such a monster all by himself. But then. As soon as the behemoths opened their mouths to the limit, the young man was sucked into it. ''''Ha!'''' Even their bodies, which are probably more than ten kilometers away, are almost taken away from me. It''s an unbelievable intake of energy. ''Ah!'' Are you sure you''re not going to get swallowed up? The young man, as expected, couldn''t stand it. He disappeared into the behemoth''s mouth. Behemoth closes his mouth. ''''Was he eaten...? Unable to do anything but stand there, they could only stand there. Behemoth sat there, satisfied that he had dealt with the young man and felt good about it. But all of a sudden, a strange change occurred. ''''~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~! The behemoth began to suffer. He fell to the earth on his side with a roar of Zudo-Onk, and he writhed in agony, swinging his limbs around. A sandstorm broke out. ''''He''s suffering like crazy, huh? What''s going on...? Buh-oh-oh-oh-oh! Buh-oh-oh-oh-oh! Buh-oh-oh-oh-oh! ""Ohhhhhhhh!" This time the behemoths began to breathe heavily, and it became a shockwave that littered the plains. Here and there, large demons were blown away, and they too flew through the air. Buh-oh-oh-oh-oh! Buh-oh-oh-oh-oh! Buh-oh-oh-oh-oh! The behemoths are rolling around with a thud, suffering and exhaling again and again. The Great Plains are no longer a hellish place due to a moving natural disaster. Eventually-- ...and it''s gone quiet...? Four men and women crawled out of a gaping hole in the plains fearfully. This is a hole that the "Magic King" made a spur-of-the-moment decision to use explosive magic to open up a hole for refuge. Furthermore, by using the warding magic used by the Great Saints, they somehow survived this catastrophe. ''''Behemoth is falling down...'''' Is he dead? No.... The huge body of the behemoth was lying on its side. Its body was moving up and down slightly, so it must still be alive. ''''Oh, hey!Look over there.........! Wha...? What they saw then was that young man forcibly prying open the closed mouth of the behemoth and coming out of it without a care in the world. When I was eaten by the behemoth, I was indeed in a hurry. But if you think about it, attacking and defeating such a huge demon from within the body is a familiar development in heroic tales. In fact, the behemoth was also far more fragile on the inside than the outside, which was protected by hard, rock-like skin. I slashed at the wall of flesh with my sword and fired a series of magic. I flailed around inside the behemoth''s body as much as I could. The behemoths seemed to have started to ramp up in the middle, and their bodies began to spin around in circles. Thanks to this, I crashed into the flesh wall and was exposed to powerful digestive juices. In the middle of the process, I lost my blessings and started to take damage normally, but I used my healing magic to overcome that. It''s a good thing I''ve mastered white magic. The behemoth seemed to try to spit me out, but I went into the back of its throat and avoided it. It was now a game of who would make the sound first, but it seemed that Behemoth had reached his limit first. As my body calmed down, I pried my mouth open and walked out. The behemoth was slumped over, looking limp. ''Hmm. Is he alive? ...dead. It seems to be alive. This seems to make slavery magic work. When I used it, the behemoth''s huge body glowed for a moment, and branding-like letters were engraved on its body. ''''Looks like you succeeded.'''' I''m sorry. Training is a success. "What kind of training is this? I think I heard some kind of tsk tsk tsk from Matty, but it must have been my imagination. For now, I''ll use my healing magic to heal Behemoth''s wounds. Since it''s large, its magic power has been depleted in the process, but the rest will be healed quickly with the life force it has. And that''s when I realized a serious problem. ''''It''s good that you made him a follower, but he''s this big. Wouldn''t it be impossible for them to even enter the city? It was over three hundred meters long. Hm. No problem. Immediately after, the behemoth''s body began to shrink rapidly. ''''Hm, you can do this?'''' 107-Episode 26 This is perfect Behemoth''s massive body became smaller and smaller, and eventually - It''s all there. It''s become so big that it''s not much different from me. It wasn''t just the size that had changed. Her appearance had also changed drastically. Peeking out of his shaggy brown hair was a surprisingly well-defined face. Smooth, wheat-colored skin that was far removed from the rocky skin. A skeleton that looked like it could properly walk on two legs. What was there was, for all intents and purposes, a human woman. But she''s big. Even though she''s not much different from me, that''s because she was originally a size beyond the dimensions of a living organism, and by the standards of a human woman, she''s quite large. Right now he''s sitting on the ground, but if he stood up, he''d probably be over two meters tall. Even so, her stocky body has become slender and feminine. Her head has also become smaller, and she''s probably ten heads taller, or even more. She looks to be in her mid-twenties. This guy was a female. I didn''t think she could do such a thing. Humanize. Moreover, unlike the past, it is properly voiced with its mouth. Perhaps it''s due to magic, but as far as I know, it doesn''t apply to any of the six types. It feels similar to white magic since it involves the body, but..... They say it''s a mythical grade demon, and maybe it''s some kind of ancient magic. It seems that there is still magic in the world that I don''t know about. I''ll ask you to tell me about it later. I''ll be able to go anywhere with this. Behemoth claims so confidently, but it''s not often that a woman is this large, even though she''s smaller than the original. It would definitely stand out. But, well, that''s not the point. The problem is. We need to get him dressed. The behemoth was naked. We can''t enter the city as it is. ''?I don''t have to wear it. The way you look, you need to wear it. They might think I''m a demon who''s carrying around slaves without clothes, you know. People are messy. But, unfortunately, I don''t have any women''s clothing. As I recall, I found some suitable cloth.......... The backpack was almost completely destroyed. It was made of the scales of a dragon species, but apparently it couldn''t withstand the battle just now. On the contrary, if you look closely, my clothes are also in tatters. ''''Oh, hey, where the hell did Behemoth go...? Is this woman...? The adventurers who approached at just the right time were the ones I had saved earlier. Just in time. Let''s borrow from them. "Hey, are you sure she''s a behemoth...? "I can''t believe you turned a mythical demon into a servant... Are you kidding about "unemployed"? So I''m telling you none of this is true. I''ve been asked about it a few times, and I''m getting a little tired of being asked about it, but they gave me a piece of cloth that will hide the important parts of it for now, so I think I''ll be fine. All we have to do is buy the right stuff in that village. It''s already nearly dark and we''ll probably have to stay in the settlement today. ''''Can''t you fly?'''' I can''t. So that means I''ll have to fly with him, or walk home. We can ride. Hmm, we could do that. She''s huge. Riding on her back would probably be faster than flying. That''s why I had the cloth wrapped around her body, but I had her take it off once. If it got bigger as it was, it would be torn. And her body becomes huge all at once. ''''Heeee........'''' You''re really a behemoth... The adventurers slumped into place as if they were sitting on their haunches. I ask them, "Do you want a ride? "Do you want a ride? ""No!" Shaking their heads as hard as they could, buzzing and shaking their heads, they answered immediately. I climbed on top of the behemoth''s head. ''That''s a pretty good view. It''s much higher than we usually fly. ''Departure.'' Nice to meet you. ...Oh, I don''t mind the demons, but don''t step on the people. Copy that. The behemoth walks out slowly. Ding!Duh!Duh!Duh!Duh!Duh! Every time I stepped on the ground, the earth vibrated loudly. I''m just walking normally, but I''m still going fast and fast. "Hmm, this is a handy vehicle to have. All I have to do is lie on my head. . At that time in the village. ''Yo, it''s finally quiet...'' Earthquakes and storms and mysterious screams... what the hell was that all about... Oh, God must be angry... The aftermath of the battle that had taken place in the heart of the distant plains had apparently reached here. The inhabitants were fearful of a natural catastrophe they had never experienced before. And that''s when. Zun!Duh!Duh!Duh!Duh!Duh! Well, there was another earthquake! Oh, hey, look at that!Hey, there''s a huge rock coming toward us! Hey, isn''t that a demon rock?Why is the rock moving? No, wait, that''s not a rock!Well, well, it''s a demon! Hi! Whoa, whoa, whoa, whoa, whoa! We reached the settlement in just half a second. The behemoth stops in its tracks. I get off my head, and I''m in human form again. I wrap the cloth around me and go to the settlement. ''Hm?I don''t see anyone, do I? It''s about time for the adventurers to come back, but not a single person is here. And for some reason, there were things scattered all over the place that looked like a typhoon had passed through. Some of the tents had collapsed. What''s going on here? I don''t know. "...no, there''s no other reason for this other than you guys... 108-Episode 27: From Liquid Death ''Huhhhhh...'' Behemoth rubbed his eyes and gave an insanely large lack of movement. ''I''m sleepy,'' You''ve been asleep all night? I''m tired of fighting. We decided to stay at a suitable inn in the village. Unauthorized. There was no clerk there, so there was no choice. Well, as long as we put down the cost of our stay, we''ll be fine. ''Too big to sleep on the bed? It''s okay. I''ll just curl up and sleep. Behemoth lay down on the bed and curled up like a cat. ''It feels good,'' Apparently, the human bed was to his liking. It would be more comfortable to sleep in than on the ground. Soooooooooooooooooooooooooooooooo.... Soon I could hear them breathing in their sleep. In the morning, people were coming back to the village here and there. ''''Ho, the demon rock has really disappeared...'''' So, seriously, that rock was a demon...? But where the f*ck did he go? The village seems to be safe... If it''s a behemoth, it''s missing a beat behind me. She''s a woman over two meters tall, so she''s quite conspicuous. ''Oh, you''re safe! And that''s where I encountered Aasia, the daughter of the restaurant where I had recently dined. ''''I was worried about you, you said you were going to the Demon Rock...'''' What''s wrong with the village?And there are tents down all over the place. You don''t know what...?There was a horrible earthquake and windstorm, right? Hmm?Earthquakes and storms? ........Could it be because of me and the behemoth? Apparently, even though we were that far apart, we caused so much damage to the village. ''''And after that, that demon rock was so close to the village that it was hard!Apparently, they thought it was a rock, but it''s a monster!Everyone is desperate to get away... .... "?What''s going on?Suddenly shut up? It''s nothing. That''s totally our fault too. It looks like we''d better not ride the behemoth around anywhere near a town or village. ''''.........?'''' That''s when she finally seemed to notice the behemoth and she rolled her eyes. ''Duh, who?This big guy...?Is she with you?You weren''t there the other day, were you? ''Well, well I guess I''m kind of an acquaintance. You''ll be able to deceive me as you see fit. It would be better to keep quiet about me turning Behemoth into a follower. ''''But how can there be someone so big...?'''' She tilted her head back, and we left the village. ''''Well. As for your next target Befi, do you know where the strongest demons live or something? I asked, and the behemoth slowly tilted his head. ''Befi?'' I''m talking about you. Behemoths are so subtle and hard to call. Hmmm. I don''t know if I liked it or not, but the behemoth - Behemoth - Befi nodded with a blank expression. ''So, what do you think?'' A powerful demon? Yeah. I know. Are you sure? Hmm. It''s my equal. Apparently, he was a mythical demon, just like her. ''Where are they?'' The Sea. So we came to the sea. It''s about two days from the Great Plains, using a combination of flying magic and Befi riding. Of course, we only rode Befi in places where there were no towns or villages. I see, so this is the sea. I was a little overwhelmed by the vast ocean in front of me. In fact, this is the first time I''ve ever seen the ocean. But I never thought it would be as good as this. ""Flying Blade" I try to fly a slash into the ocean. Zubaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa! The surface of the sea split in half. But only a few hundred meters at most. And soon the broken sea will become one. "Not only is it huge, but it also has tremendous self-repairing power.......strong. "It''s a liquid death... I''m sleepy. But where in this great ocean are the mythical demons? I asked Befi. I don''t know. You don''t know? There is no way to find it. It''s impossible to find a single demon in this vast ocean without knowing where to look for it. Let''s just get some information. We moved on to a city not far from there. It''s a very prosperous maritime city, and it''s called Beletse. The harbor is lined with countless ships, and the market is filled with fresh seafood. The sailors here must know the seas inside and out, as they trade with all over the world. They must also know about the mythical monsters that live in the sea. ''''A mythical demon?Are you talking about Leviathan, by any chance? The first stern man who called out to him quickly uttered the name of the demon. His skin was a splendid red-copper color in the sun, and he had a twisted bowl roll scattered on his head. He has the appearance of a fisherman. I''ve never seen it, but my grandfather once told me he saw the tail fin. I''ve never seen it, but my grandfather once told me he saw the tail fin of a snake that was hundreds of meters long. He said it was so big that it almost capsized the ship when it passed by. Where''s the sea? What part of it? You''re not going to see that, are you, bro? Yes. I''m not just gonna watch him. I''m gonna train him. "No, no, no, no, no. No, you won''t. You''ll be dead in a heartbeat if you get attacked. Besides, who would give you a ship for that? You don''t have to worry about that. Brother, do you have your own ship? Well, that''s about it. You''re not as rich as you look... You can get Befi to swim with you. It''s like a boat. "I hate swimming. Oh, really? Then we''ll have to fly in the sky. Or if I use blue magic to manipulate the water, I might be able to go faster with a randomly made raft. 109-Episode 28: Im Taking a Conspicuous Guy The old fisherman says, "The place you see is a week''s boat ride from here. ''The place the old man sees is a week''s boat ride away from here in the open sea. A week on the boat? Then you could fly over and you''d be there in a day or two. ''But that was decades ago,'' he said. The story goes that the Leviathan is constantly moving through the ocean in search of food. You can''t always find them in the same place. Hmmm, I see.... So you need more information on the sightings. As far as I know, I haven''t heard anything about it lately. If there is a ship that has been encountered, it must be all over town, it''s impossible not to hear about it. I see. Well, don''t say anything bad, okay? I don''t want to stop, but it was nice of you to tell me. It''s okay. I thank him and leave the place. ''What are you going to do, Des?It''s a lot of work by all accounts, Ked.'''' I''m going to ask someone else. The old man said that, but we might get an eyewitness account. Exotic boats come here too. They could have information that the fishermen in this city don''t know about. ''Or information about a shipwreck. It could be a case where the ship was wrecked due to encountering the Leviathan and the ship never returned. I asked around for a while, but I couldn''t get any useful information. But I couldn''t get any useful information at all, and it seemed that the rumors about me spread very quickly, and people started saying, "Oh, so you guys are talking about us," even though we had never met before. We''ve got some prominent guys with us. Hmm? Of course it was Befi. And then there was a man approaching us. He was dressed in expensive-looking clothes and was well-dressed, and he didn''t look like a fisherman. ''Is that you?What do you mean, you''re looking for a sighting of Leviathan? ''Yes, but do you know anything about it by any chance?'' ''Yes. As a matter of fact, some of the sailors on my ship saw what looked like it just a few days ago. Are you sure? When I asked him, he told me that the man was an executive of a chamber of commerce based in this city. That chamber of commerce has branches all over the place and owns many ships. ''''Where is it?'''' The sea off the southwest coast. Hmm, off the southwest coast. If it was a few days ago, they might still be around. But still, it''s pretty good timing. "Actually, the ship that leaves tomorrow is just passing by the place of its appearance again, would you like to take a ride, if you don''t mind? I decided to take the man''s suggestion. I could fly through the air, but there''s no place to rest on the ocean. I''d be grateful if you could take me to the boat. The next morning, when I arrived at the harbor, the man waiting for me was not the man from yesterday, but a middle-aged man with a stern appearance. He had a large scar on his cheek and didn''t look very uptight. ''Oh, it''s you. Mr. Regev has told me all about you. I''m Dick, the commander of the ship. It''s a pleasure to meet you. It looks like he''s the captain. Yeah, good luck with that. The ship was a large galleon. It seemed to have already finished loading its cargo, mainly trade goods, and left the port as soon as I got on board. The sails are spread wide and the ship is moving over the waves, catching the wind. Apparently the direction of the wind is great today. It''s a nice day, good for a boat trip. While I was looking out at the sea on the deck, Captain Dick, who seems to have finished his duties, came up to me. How long is it going to take to get to that area of water where the Leviathan is coming out? Well, it''s just a matter of two or three days. I asked, and he replied, somewhat biting back a laugh. For some reason, the other sailors who had gathered around were also smirking and laughing. ''So what are you going to do now that you''ve found Leviathan?'' I''m thinking of making him a follower. As I replied, I could hear spewing sounds everywhere. ''Bwahahahaha, did you hear that?They''re going to turn a mythical demon into a servant. Kukkaku, you''re a completely crazy person. Then I was ushered into the cabin. We entered the ship and walked down the stairs. ''Cramped,'' Befi had to bend down as far as she could, since I was high enough to reach the ceiling if I reached for her. She followed behind me, looking cramped. Eventually we were brought in. Hmm?Is this the cabin? It was a dimly lit room. It was separated by iron bars, with more than ten people squeezed in on the other side. Many of them were young women and children. Yeah, that''s right. This is the room where your "merchandise" will spend the duration of the cruise. The captain shakes his shoulder and says with a laugh. ''Keke Keke, it looks like you''ve been tricked. Then a boy shouted from behind the bars. ''Where do you think you''re taking us?Get me out of here!If you don''t get home soon, your mom and dad will be worried about you! "Ka-ha-ha-ha!Do you really think they''re going to let you go?I''m sorry, but you''re going to be sold into slavery in another country now. Wha...? The boy gasped in astonishment at the captain''s words. It is not unusual for slaves to be bought and sold. But judging from the current exchange, it doesn''t seem to be a legitimate commodity. They may have been kidnapped. I''m sure that this kind of trafficking would be difficult to detect if it was across the ocean. So that''s why you have me on this boat. "Hahaha, that''s right!It''s too late to regret it now, though! Well, you''ll regret it. 110-Episode 29: Start again You look healthy, and at the very least you''ll be able to find a buyer for a mine slave. If you''re lucky, you''ll be bought by a rich old lady who likes men. The captain looks at Befi with a sneaky smile on his face. I''m sure she''s not a bad-looking woman, but she''s too big to be bought in the normal market. But fortunately, we have a few curious aristocrats on our client list. He collects oddball girls. I''m sure he would pay a high price for them. However, he''s a pervert with a "D" in his name, so be prepared for that, ha-ha-ha-ha! A vulgar laugh rang out. The women and children behind the bars shuddered with a pale face, as if they thought they were going to suffer a similar fate. The woman and child behind the bars shook their heads, as if they thought they would meet a similar fate. It''s just like a duck carrying a grape wine on its back. It turned into a scream before I got to the end because I kicked him in the gut and blew him away. ''Gubey!'' I was slammed into the wall and almost lost all my blessings. I fainted, or maybe it was the whites of my eyes. Of course, I took it easy on him, so that was the extent of it. ''Captain! What the f*ck do you think you''re doing? The sailors who were in tow echoed the rage. ''I suppose you''d rather have been kicked to the curb, wouldn''t you? I should be thankful that I didn''t really do it. My torso would have probably popped off. ''''d*mn brat!'''' "You can go to jail if you want to stay alive! The sailors drew the swords they carried at their waists. ''Hmm, just some amateur swordplay. I walk up to them at random. "What, is this guy insane? Just do it! It''s useless. Boom--Passion. I plucked the sword that was swung down with my thumb and forefinger and caught it. ''''~~? You took my sword with your fingers? If you''re dealing with a slash like this, it''s a trick that''s a piece of cake. "d*mn you! Bump--paciously. The other sword is also grabbed by a finger. This time it''s my middle and ring finger. This time it''s the middle and ring finger. What the hell kind of power does this guy have? To their dismay, he visits them with a belly pan with the opposite hand. ''''Buggy!'''' They too were knocked unconscious when they hit the wall. ''Yes, in one blow! What the hell is this thing? The rest of the sailors backed away, their faces twitching. And then Be cool, man!I don''t care what happens to this woman! One of the sailors had gotten behind Befi and was holding the tip of a sword to her throat. He probably meant to be a hostage. But the sailors are about a head shorter than him, so the picture is a bit ridiculous. ''''Hmm?'''' Don''t move unless you want to die. Annoying. ''''~~~~? Befi grabbed the sailor''s head and lifted it lightly as it was. The sailor looked at the monstrous force, which was unbelievable for a thin arm, and looked at him in astonishment. ''Ha, let go of me!You b*tc*! He floundered desperately, but there was probably no way to accomplish this in front of Befi''s arm strength. In the end, he swung down the sword in his hand. A scream rises from behind the bars. They must have thought that Befi was cut. ''''........What?'''' But the sailor''s sword had only struck Befi''s body. There was not even a scratch on his skin. It''s a behemoth of a mythical grade demon. Even though he is humanized, there''s no way an amateur''s sword would be effective. ''''Hm.'''' Nugoh? Befi threw the sailor as if nothing had happened. Once they hit the ceiling, they hit the wall and then fell to the ground. Not only is my blessing totaled, but my arms and legs are bent in a different direction. Unlike me, Befi can''t add or subtract. "I''m sleepy. I''ll clean these guys up, so you can get some rest. I will. Befi''s long body slipperily approached the bars. Then she grabbed the bars and tore them apart with force. Baggy-baggying! ""~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~. Everyone in the room opened their eyes wide, as if they didn''t think they could destroy the bars with just arm strength. Even I could do that, though. ''Good night.'' With the stunned people as an afterthought, Befi walked into the cage and laid down, folding her long body on the rags that were on the ground. She thought it would be more comfortable than sleeping on the ground. ''Well, let''s do it.'' I left Befi alone and stormed off on the ship. ''I see, so you lied about seeing Leviathan, too? ''Yes, sir. I''m sorry. When I checked, the captain admitted auspiciously and easily and apologized. The deck of the ship. The entire crew has been assembled except for the personnel needed to maneuver the ship. They are tied up with ropes to make sure they can''t move. I guess we have to start over. It looks like we''ll have to go back to the harbor for once. I needed to get them back anyway, and I was going to go back, though. ''Oh, um ... thank you for saving me, brother. You have saved me from being enslaved. Onii-chan, you''re so strong! You''re a big girl! The children who were trapped in the cage thanked me from the mouth. If I hadn''t been on this ship, I would have been sold to a foreign land. And that''s when. The ship suddenly and without warning lurched. The waves had been calm for a while now. ''What?'' "Whoa! One of the sailors who had left him unrestrained to maneuver the ship screamed. When he looked, he saw a thick rope of what looked like a thick rope tangled around his body. Immediately after, he was dragged into the sea. ''''Hmm. A sea monster has appeared?'''' 111-Episode 30: I just cut the tsunami ""Ohhhhhh!" One of the sailors disappeared into the sea, and there was a sudden uproar on the deck. At the same time, the ship rocked even louder. That beat caused several people to turn over. ''''What the hell was that?'''' Hi! A giant tentacle-like object emerged from the sea. Not just one. They were writhing like the body of a snake, entangling themselves around the ship and shaking it. If this is the case, the ship could capsize. ''This thing is a Kraken! And it''s a big one! The sailors say that it is a demon similar to a squid. The small ones are over ten meters long, and there are some that seem to be able to drag the ship straight into the sea. ''''Oi!Get this thing off me!Hurry up and cut off his legs, or the ship will sink!All of them, of course! The captain yells at me to untie the rope. ''There''s no need for that. I''ll be enough on my own. I approach the leg that was about to squeeze and break the mast. Spud. ''Huh?You cut off a leg that thick in an instant! I didn''t see a sword plot! I also slashed off my other leg. ''''Huh!Yup, the shaking has stopped...? He''s running away... d*mn, she just single-handedly got rid of the Kraken... It seems to have escaped into the sea. "Hmm, as expected of an underwater battle........ I wouldn''t be able to catch up with him even if I chased after him. I had no choice but to give up, and that''s when it happened. A huge shadow emerges from the depths of the ocean. It grew larger and larger as I watched, and eventually Dopaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa! He appeared with a column of water that wondered if it would reach the heavens. It''s not a kraken. It''s a much larger creature than that. After all, it even has a kraken in its mouth that is over ten meters long. Even this galleon looks like a small ship. And even so, the full extent of the ship has not yet been revealed. This is because most of its body is under water. It was an enormous snake. When it swallowed a Kraken, its emerald blue scales glistened fantastically as it glowered at this ship from far above. ''''Wha, what is this monster...? I''ve never seen a monster this big before... The sailors, who were relieved to see the Kraken gone, were even more pale and astonished than before. ''''Well, well, well, this guy can''t be... ri, ri, ri, Leviathan...?'''' Someone muttered in a shaky voice, and that''s when "Hey!I know you''re in there, behemoth!Come out! A mysterious voice sounded out of nowhere. ''This nasty feeling of magic!I could see that right away, even at the bottom of the ocean!I''m going to get it right this time!'' And then, Befi comes out of the cabin, absent-mindedly. Huh.......... Hmm, long time no see. He raised his right hand lightly. ''Do you know him?'' Hm. That''s Leviathan. It''s been a thousand years, I believe? I fought before. This is the Leviathan, after all. I didn''t expect him to come from the other side. Now we don''t have to look for him. I don''t know what to do!I didn''t expect you to come to the beach!This is my home!You don''t stand a chance! I''m not going to fight in the first place. Pity. "What?What the hell are you talking about?If that''s the case, what did you come to the beach for?'' A guide? I''m not giving you any kind of a tour at all. ''I''m the one who wants you, Leviathan. ''What about you?You want me, a human being? I called out, and Leviathan glared at me scowling. I nodded. ''''Yeah. I want to make you my squire.'''' Leviathan sniffed. The wind that blew in almost broke the mast. I never thought anyone would be this stupid. I''d sink that whole ship in an instant! Immediately afterwards, the surface of the sea rose up like a wall. It was a huge tsunami that reached tens of meters high. Blue magic. Apparently, not only do they use the ocean as their habitat, but they can also manipulate the water with magic. It may be difficult for such a huge body to swim freely in the ocean without the help of magic. "Be the seaweed! A huge tsunami was coming toward us. The last thing we need is to be swallowed by that thing, and our ship will be pulverized. (""AAAAAHHHH!"") The deck is aflame with no escape route. The only one who is unperturbed is Befi, who is still sleepy and absent-minded. ''It''s not good to get the whole ship sunk. I went to the tip of the ship. There, I raised my sword as hard as I could and swung it down as hard as I could at the approaching giant tsunami. Zupaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa! The tsunami split left and right. The tsunami was drifting backward, just avoiding the ship. The sailors, who were prepared to die, look at me with stunned faces. ''''Ts, ts, ts........'''' Tsunami... Did you cut...? Leviathan was also stunned. ''''What did you just do?'''' I just sliced through a tsunami. "How could a human being do such a thing? I just showed you. I''m going to leap off the bow and into the sea. Of course, I don''t intend to dive into the sea. I used green magic and flew through the air. I wouldn''t be able to fight on the ship. Aside from those sailors, it''s a pity to involve the people who were abducted. Well, let''s get to work on the training. 112-Episode 31 After all, is this pattern again? And jump? "That thing is flying!Magic? ''Wait a minute!Aren''t you a swordsman? The sailors are astonished when they see me flying with green magic. ''''What kind of a profession is it that you can use both sword and magic! You''re not a Mage, are you? ''Right!Then sure..... I''m afraid you''re wrong. I am "unemployed". Shiaaaaaaaaah! Leviathan cleared his throat sharply and attacked him with a long body leap. He opened his mouth wide, as if he was going to swallow it whole. I thought about entering its body and attacking it like I did with the behemoth, but it would be tricky if it dragged me straight to the ocean floor. I kicked at the air and accelerated, and once I did, I tried to escape. I need to get as far away from the ship as possible. "Don''t run away! The tsunami struck again. "Tsk! I slashed again with my sword. It split in two and passed through the left and right sides. ''So how can you do that? That''s what you get for training. Hmm. It''s probably enough to get this far away. I turn my body in the air and this time I rapidly approach towards the Leviathan. "I got it! My sword sliced through Leviathan''s head. ''Wait, why are you slashing my scales normally?It''s supposed to be as hard as adamantite!'' That''s what you get for training. The person in question says that, however, it doesn''t seem to have as much defense and durability as a behemoth. However, it would still be difficult to weaken it. I guess we''ll just have to attack it from within, won''t we? The Leviathan leaps at me with its fangs repeatedly, but I duck under every one of them and take advantage of the opening to deliver a slash. I''m getting wounds here and there, but it''s still this big. It doesn''t seem to be slowing down at this level. ''Chokkochi!How about this!'' Huh! Something flew out of the sea at a terrific speed. It was a giant whip - no, a Leviathan''s tail. Paaaaaaaaaan! The sound of it slicing through the air roared out. I was saved because I was able to avoid it quickly, but I was blown away by the shockwave alone. If I had taken a direct hit, my blessings would have been taken away at once. From there, Leviathan attacked with a two-pronged attack of head and tail. I''m not sure how many times I''ve been told that I can use green magic to fly freely in the sky, but as expected, I can''t move as fast as I can on the ground. I can''t help but retreat into the sky. It''s a good idea to be able to have a look at it. The Leviathan quickly followed, but stopped when it was over a hundred meters above sea level. Apparently, this height is the limit. ''''Come down!Not fair! Well, what are we going to do now? Leviathan curses at me, but I ignore him and I think. ''Hm?Going back to the sea? Leviathan was open-mouthed and ranting for a while, but what did he think, he dove into the sea. You don''t think he escaped, do you? Then suddenly the surface of the sea exploded. A huge column of water rose up and easily went over even my height. The one who jumped out of the water column was Leviathan. ''''Hahahaha!You''re so careless that you can''t reach it at that height! Immediately after, I was swallowed whole by Leviathan. ''So this is the pattern again after all.'' I mutter to myself as I crash into the flesh wall over and over inside the pitch-black body. But this is an opportunity. The Leviathan is now flying out of the water. I might be able to finish him off from the inside while he''s still in the air. I sent slashes flying in all directions. ''''Idaaaaahhhh! There was an immediate reaction. Apparently it''s working. But still, like the behemoths, swallowing an enemy alive is so unwise. If you think about it, you would at least know that you might be attacked from within. Even if they are mythical grade demons, they are still demons. Maybe neither of them are very smart. ''''Huh?'''' Suddenly, he is swallowed by the water. I slash at it with my sword as quickly as I can, but it quickly swallows me up again. No, there''s too much of it. The next thing I know I''ve been spat out of Leviathan''s body. ''I see. You created water inside your body?'''' It''s not vomit, but water generated by blue magic. Behemoth tried to spit me out by refluxing stomach acid, but as expected, it was difficult because of the limited amount....... ''''How dare you! Leviathan is furious, but doesn''t seem to be too damaged. ''Hm, this is bad.'' And the force of the spit out of my mouth knocked me to the surface of the ocean. I immediately tried to escape to the sky, but It''s useless! He was swallowed by the wave that Leviathan had caused. And then he was dragged directly into the sea. ''Hahahaha!Welcome to my home!You''re not free to move around here either! More tremendous currents sent us down to the bottom of the sea. The water pressure was increasing rapidly and the surrounding area was getting darker and darker. ''Humans can''t breathe under water, can they?What do you think?Are you in pain?Doesn''t it hurt?Hahahaha!'''' Leviathan asks happily as he wraps his ninja bureau around me. Unfortunately, I can''t answer because I''m in the water. Eventually, I wonder if ten minutes have passed since I was swallowed underwater. When Leviathan saw that I had stopped moving, he said ''Is it time to die?It''s dead, isn''t it?Hahaha, humans are so fragile to die so easily. Apparently, they thought I was dead. 113-Episode 32: Breathing shouldnt last so long I used my green magic to create air and breathe. I''ve been working out, so this much water pressure isn''t a problem, and I could probably stay under for hours. Not knowing I was faking my death, Leviathan opened his mouth and tried to swallow me. But it seems that the rampage inside his body just now has become unbearable, and he has quickly reconsidered. ''''You''re not even worth eating. He slams his tail down on me with that excuse. I crash into the ocean floor. The Leviathan lost interest and tried to leave just like that. He''s not looking at me anymore. Okay, now. I used my blue magic to control the seawater and moved at breakneck speed. Then, at the border of the Leviathan''s tail and body (though it''s hard to tell them apart), I find something. A hole. It''s a vent. I slide my body into it. Although it is a long and slender snake body, it is still more than 50 meters wide. The size of the hole is about two meters wide, so a human being can enter it with room to spare. ''''........It stinks.'''' I was prepared for it, but the stench was still so bad that my nose was almost bent. Well, it can''t be helped. After all, it''s a place where excrement comes out. Well, let''s fight back. I slashed at the wall of the excretory hole this time, just as I did when it was swallowed from my mouth. ''''~~~~~~~~~~~~~~~! He attacked more and more relentlessly. ''''Iggyaaaaaah!I''m going to do it! Hmm, you''re in more pain than you were hit by the mouth. ''N-na-na, what is it?I can''t find his body!Did you mean to tell me that this time you''re going to put it in my ass? He seems to have noticed. Then he creates water with blue magic again and tries to drain me. However, this place is much narrower than the mouth part earlier. Naturally, there is a limit to the amount of water that can be poured out, and it''s hard to push me away when I''m holding my body against the meat wall with my hand sword. It''s just as I had planned. ''It''s okay, it''s okay, it''s okay!Why don''t you leave?'' A one-man showdown with a mythical creature...? What kind of monster is that thing? Sailors stare dumbfoundedly at the young man on the ship as he fights the giant demon. Even though they are quite far away, the ship is still rocking a lot in the aftermath of the earlier incident. It was difficult to catch him somewhere as he was still tied hand and foot, and he had been rolling around on the deck many times earlier. Meanwhile, clinging desperately to the ropes and railings, the group of people that Arel had rescued, mostly boys, were the ones whose eyes were shining brightly. ''Oh brother, wow!'' Go ahead~! They pumped their fists in the air in excitement and let out a shout of support. From their point of view, it must be exactly like witnessing a heroic tale of storytelling. And then there is a mixture of yellow cheers. This is a group of women of a strange age. ''''Aleru-sama ah!'''' Hang in there! Incidentally, it is the behemoth that lies on the deck with its long torso folded over, oblivious to its surroundings. ''Supi.'' And that''s when. A scream came from the deck. ''Brother!'' ''Master Arrell! Hey, he''s been eaten! Arel had been swallowed up by Leviathan. ''''Ya, I knew a human wasn''t an opponent! Oh, shit!We''re next.... The sailors were terrified that it would be their turn to fall prey. But shortly thereafter. ''No, wait!What''s going on, Leviathan is starting to suffer? ''He puked out of his mouth!Look, he''s fine! Along with a large amount of water, Arel pops out of Leviathan''s mouth. ''''Yo, good.......big brother.......'''' For a moment they were relieved. I''m being dragged into the ocean...? We''re f*cked this time! Eventually the quiet sea returns. ''Oh, they''re not coming up...'' Did my brother die...? My brother didn''t die that easily! The children prayed for their safety, but there was no sign of them rising to the surface of the sea any time soon. More than enough time had already passed since they sank into the sea with Leviathan. ''''Haha, there''s no way I''m going to be able to hold my breath this long. He''s probably dead already.'''' Oh no... By the looks of things, it looks like the Leviathan has gone away!Thank God! The captain squealed with glee, leaving the grieving women and children to their own devices. His clothes were in tatters from the many times he had pulled them back on deck. ''And by the way, we''re out of the way!Hahaha, that''s too bad, guys!If it''s not for him, we''re all going into slavery as planned! " " " Hey, why don''t you just untie me? The sailors worked with each other to untie the ropes that bound their hands and feet. ''Hmm?Are you done? I mean, what the hell is this b*tc* doing here? Befi seems to have woken up. As she rubs her eyes and stretches them absent, the sailors start to panic. ''Don''t get upset!Just because she''s a little strong, doesn''t mean she''s a woman!We''re not afraid if we all get together! The captain shouted at them in anger. On the other hand, Befi didn''t care about them and walked to the edge of the deck. There was a frightened woman and child there. Sis... your brother''s dead... Hmm?Dead? "With the demons ... in the sea ... I''m alive. Befi pointed to the surface of the sea. Then a huge shadow came up from the bottom of the sea. ''''Ha!You didn''t mean Leviathan? What the f*ck is going on here? It was indeed Leviathan that appeared on the surface of the sea. However, its little island-sized body just floated around and showed no signs of moving. I''m sure you''ll be able to find a way to make it work. "Okay, so it''s a success. 114-Episode 33: Ive been impaired Big brother! Wow! As I stepped down onto the deck of the ship, the kids came running up to me in unison. But when they got somewhat closer, they suddenly stopped all together. ''d*mn it...'' Uh, yeah, it stinks... He picked his nose and frowned. Hmm, I thought I was washing it with seawater just in case. "Ri, you defeated Leviathan by yourself...? What a guy... The sailors were shivering. They were tied up with ropes, but they seemed to have untied them while I was fighting, and they were moving normally. ''We''ll have to re-bind it,'' "''Hi!Jeez, I''ll do it myself! The sailors were the first to tie up their own hands and feet with ropes. .........I wonder if I smell that bad now. I''ll have to wash up again. And then a strange boy (?) came up from the sea. ''''Ughhhh........I''m defiled.......'''' He''s moaning with tears in his eyes as he presses his buttocks together. It must still hurt. ''Hmm. So this is your humanized form. ''Yes. Sometimes I get to wander around human towns in this form, but they give me lots of candy! He is a Leviathan. He seems to be able to humanize just like Behemoth. He has emerald blue hair, the same as his scales. He''s small, about 130cm tall, and in terms of appearance, he''s probably one of the youngest of the boys and girls he saved. In reality, though, he should have lived for hundreds or thousands of years. But the fact that Befi, who was originally stocky and stout by nature, becomes smarter when she becomes human, makes me wonder how she got this shape. The fact that the huge body became so small is a mystery in the first place. You know, you smell like one, don''t you? You''re the source of all this. Oh, and I didn''t expect them to make me a squire. Behemoth, did they get you too? Hmm. Hmm, I lose. So it''s not a coincidence that you beat me... The Leviathan seemed reluctant. ''I can''t help it!I''ve been bored lately, and I''ll be your squire for a while!You''re human anyway, and you won''t live a hundred years. It''s pretty self-important, isn''t it? Hey, come on!I''ve outlived you by far!I mean, don''t do that already, okay? Leviathan backed away, protecting his ass. Apparently it was really hard to bear. ''Don''t worry. I''m not going to go into that place that many times. I mean, it''s true, right? It''s true, so don''t be alarmed. And then you let your guard down? I didn''t mean to. Then we went back to the harbor. When we got to the harbor, we turned the boat''s crew over to the union that ran the fishing harbor. They didn''t seem to be resisting, and they confessed honestly. The testimony of the abductees, though, made it impossible for them to make any excuses. However, they were, after all, underlings. I''m sure they were led by a trading company led by the man who first approached me. This is probably not the first time this has happened, and there are likely to be many additional crimes as well. I''m sure there are many people who have already been sold into slavery in other countries illegally. But there''s no need for me to get involved in that area as well. I left the rest to the union and headed to my next destination. By the way, I washed myself properly with soap and water, so I shouldn''t smell so bad now. Of course, I washed my clothes thoroughly, too. ''Come on, behemoth!Let''s lay waste to the earth! "Hm. Thud, thud, thud!Hahahahaha!People look like garbage! Befi looks as sleepy as ever, and Leviathan is enjoying something while she carries him on her shoulders and looks down at people on the street. I thought they would be less friendly, but apparently not so much. ''''Well, now that it''s come to this, it''s no use for us to fight about it! "Hm. By the way, we''ll call her Libby. ''This is Matty the demon and this is Pullle the slime. Well, get along with them. I''ll introduce my followers to you at random. ''''Isn''t it a bit too lightly handled, Death...? "Pudgy? I asked Befi and Libby. ''Do you know any other mythical demons?'' I am. I know that! Two (animals?) answered together. ''Where are you this time?'' The sky. The demon is apparently somewhere in the sky. Of course, it''s not something you can find by randomly searching for it. In any case, this time it''s more vast than the ocean. It would be nice if it came from the other side like Libby, but it was just because it happened to be migrating to the bottom of the sea in that area. It''s just a matter of sheer luck. But that doesn''t mean it''s flying all the time. Libby says there is that demon''s nest. So we decided to go to that place. A few days on the Befi ride. We arrived at the foot of the mountain. Hmm. This is quite a magnificent mountain. But it is different in scale from those mountains. According to some people on the way to the city, they are as high as seven or eight thousand meters above sea level, and on a clear day you can see them from a hundred kilometers away. On a clear day, you can see it from a hundred kilometers away. Moreover, it seemed to be an active volcano. Indeed, smoke can be seen rising near the top of the volcano. It is said to have erupted heavily hundreds of years ago, and its ashes covered the sky. It was cold as winter due to lack of sunlight, and a large number of people died of starvation due to the inability to grow crops. ''The crater here is his nest!....maybe. It''s going to be a tough climb. 115-Episode 34: Thats Gachi and Beessho We walked up the steep hill to the crater. There was almost no vegetation and the terrain was craggy and rocky. It was probably formed by a lava flow. This is why it was difficult to walk up. I thought to myself, "Wow, do we really have to go up this?It''s so annoying. Hmm. I''m tired. Libby and Befi follow me, complaining. ''Behemoth, beat me! No, Why not?I hate walking on land! I hate being awake. I''d rather stay awake. You''re both lazy for being mythical demons. Don''t complain. Just follow me. ...Mm, you''re a demon. The one that appeared was a bipedal lizard demon, a lizardman. The red scales, perhaps adapted to living in this volcano, seem to be tougher and more resistant to heat than normal species. ''''Gah!'''' I took their heads off with a flash, though. Apparently, this place has become their one big breeding ground. After that, we were attacked by a large number of lizardmen, but as we fought back, they became afraid of us. But as I was fighting them off, they became frightened and began to run away as soon as I got close enough. I''m not sure I''m going to be able to find the right one. "A red dragon? "Ooh-oh-oh! The one gliding in with a roar is a red dragon. Probably its total length is more than twenty meters. Befi, who was on the outermost side, did not fall prey to its sharp, thick fangs. ''''Hmm?'''' Huh? The Red Dragon is puzzled when its fangs can''t get through to the little human. Well, it''s not a human. Befi still looked sleepy but moved her eyebrows a little uncomfortably, and she pushed the Red Dragon away with her hand as if she were a fly. Zdooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! It wasn''t an easy thing to "push away" in reality, though. ''Guaaaaaahhhh! The Red Dragon blew away at a furious speed. It rolled over and over on the rocky terrain and finally stopped around a hundred meters or more down the slope. ''''Geeeeeeeee!'''' Just nearby, in the shade of a rock, there were some lizardmen who had been following us secretly, perhaps to keep an eye on us. They seemed to be hiding, but they were obvious. ''Giggling, giggling, giggling!Geez! A single shot of the Red Dragon!(No way!) I don''t know what he''s talking about, but he seems to be insanely surprised because the Red Dragon was defeated in one punch. ''''Gigi-gi-gi-gi!Giggling, giggling, giggling! I hope you don''t mind playing a dangerous role like this.Let''s get out of here while we''re still alive! ''Giggling, giggling! (Seriously, I agree, Panay!) He left in a hurry, either intending to report it to his friends or simply getting scared. He encountered the Red Dragon several times after that, but he proceeded to defeat it without any problems. ''''Well it''s getting pretty hot. Have we already reached the middle of the mountain? Normally, it should get colder at higher elevations, but the temperature is rising rapidly. It''s because of the hot water that occasionally erupts here and there. It''s called a geyser. If I were to get hit properly, I would get severely burned, but that steam alone is hot enough. I decided to use my blue magic to generate cold air and prevent the heat. Hm, this is comfortable. The environment becomes even harsher. Up until now, the slopes have always been just a normal walkable slope, but there are several places that could almost be called cliffs. You can go around it, but it''s a hassle, so you go straight ahead. ''''It''s a piece of cake with green magic. I flew through the air. I went over the precipice in one fell swoop. ''Wait a minute!I can''t use green magic! I can''t fly. Little Libby came running after me, kicking dexterously over the unevenness of the cliff. Befi, on the other hand, dug her toes and fingers into the rocks as she climbed. It had been about half a day since we''d left the base of the mountain. About half a day after we left the base, we finally reached the top of the crater. "Wow, it''s hot! "Hm. A high heat steam that was already rising. Behind it, a bright red, burning hot magma could be seen, occasionally erupting as if it had exploded. Even though the cold air of the blue magic was clothed in his body, the heat of it made him unable to stop sweating from earlier. ''''Is there really someone using that place as a nest?'''' I don''t know!It''s not like I''ve seen it in person either! That demon might be in that ma-ma-ma-ma-ma-ma-ma. ''''........Let''s just try attacking it at random for now. I sent a slash at Magma''s eye. Zubaaan! The magma split vertically. It was much more viscous than seawater, so it slowly returned to normal. ''An outlier.'' Well, it''s as big as a lake, and it''s not going to be that easy. However, after repeating it over and over again, there was no indication that anything would appear at all. Maybe the bottom is too deep for the slash to reach. ''Oi, if you''re there, come out!We came all the way out here for you! "Hm. Befi and the others are calling out to him, but that doesn''t stop him from showing up. And that''s when. Suddenly the sunlight overhead faded, and I looked up to the heavens. ''There they are,'' What I witnessed was a huge bird that flew in the sky with ease. Its entire body, glistening red, was engulfed in flames, and every time it flapped its wings, scaly sparks of fire rained down on it. ''''It''s a phoenix.'''' 116-Episode 35: Im the one who has something to do It is a frighteningly huge bird. It must be two hundred meters long from one end of its wings to the other. It''s so big that it''s hard to believe it''s flying in the sky. The sun is completely hidden from view, but the glittering, blazing behemoth emits a dazzling light. Every time it flapped its wings, an intense hot wind descended, but combined with the heat of the magma, it was now a scorching hell around it. Phoenix. It was a representative of a mythical grade demon. ''''A........ningen, huh? I didn''t expect someone to be able to set foot in a place like this.'''' Phoenix looks down at us as he soars leisurely through the air. ''And you guys are........Behemoth and Leviathan?'' ''Yoo-hoo!It''s been a while! "Hm. Livy waved her hand casually and Befi nodded with her usual blank expression. ''''How rare it is to come to me. It''s also the two bodies together. .........I remember that you two were not as close as dogs and monkeys. Well. But we''re in a truce right now! I don''t hate you. I don''t hate you. It''s just that he came at me. Well, I guess that makes me look like a pain in the ass! That''s right. ''I''ve changed my mind!It''s right here and now! Without regard to the two bodies arguing with each other in this manner, Phoenix asks, "So what do you want to do with me? I''m sure you''ll be able to tell me what to do. I''m the one who needs to be here. "What? So I interrupted, and Phoenix cleared his throat in surprise. ''What the hell does Ningen want?'' Long story short, I''m here to make you a squire. "Am I your servant? Phoenix''s red eyes narrowed. ''''Don''t tell me you''ve turned those two bodies into squires?'''' You''re very perceptive and helpful. You''re right. "....What kind of trick did a Ningen use to turn a mythical demon into a servant? I just had to get you in an honest-to-goodness training session. I''m a demon trainer now, you know. No. No, I was coerced into submission. I can''t believe I''m going to get my ass... uh, I just remembered it and it''s making me itchy... I thought I heard a light accusation from behind me. ''''I see, it seems that they are not ordinary ningen. But if you put me together with those two bodies over there, you''re going to get hurt, aren''t you?'''' Don''t worry about it. I''ll have you on board in no time. "...don''t get too arrogant, my dear Ningen. The Phoenix flapped its wings wide. Then countless flaming arrows were released from it. Super high heat flame arrows that decreased in blessings just by snatching them. If they were to fall in large quantities like rain, it would be difficult to avoid them. There seems to be no time to strike them away with a sword. "''Divine Legs Tong''. Then instead of avoiding every single raindrop, you can duck it all. I instantly retreated to a place a few dozen meters away from the spot. ''''It''s ... hot.'''' Hey, hey, hey!Don''t put us in the middle of this! Befi and the others, who got a decent rain of flames instead of me, are protesting. Although they''re feverish, they don''t seem to be able to get a single burn from this level of fire. ''''No, no, no, no, I really want to give you a break! Matty was using his palm size to desperately scramble away from the arrows. ''''........When did you move there?'''' When the Phoenix realizes that I ducked, it fires a flaming arrow at me. But as I said, I dodged the attack by using my own divine footwork. I''m sure you''re not the only one with speed. I''m sure you''re not going to be able to make me follow you on the ground. How about this? I kicked the ground and flew with my green magic. I''m not sure if I''ll be able to find a way to make it work. I''m not a fan of the idea. You are foolish to challenge my territory. The Phoenix gained more altitude. I picked up speed and followed them. But the distance wasn''t getting any closer. The Phoenix fired another flaming arrow at me. ''If I had just crawled to the ground, I could have avoided it.... Turn to ashes, ningen.'''' "God''s Foot Street. "What? I used the Divine Legs Pass in the air. I used the air mass created by green magic as a foothold to instantly move and avoid the hail of arrows. That was a combination of green magic and divine footwork. I learned how to use the air mass as a foothold to accelerate in the air when I was in the magic city. But I''ve been practicing it in secret, trying to apply it to my "divine footwork". In the case of the divine foot passage, the impact is too strong, so unless it''s a condensed mass of air, it will easily be destroyed and not become a foothold. It was quite difficult to adjust that area, but it looks like we managed to make it a reality. I closed the distance between me and the Phoenix in one fell swoop with my "divine foot passage" in the air. "Foolishly........you''re surpassing my speed...? To the astonished Phoenix, I finally fleshed out into sword room. Heat..... I unintentionally flipped over and regained my distance. Hmm, apparently that body, it seems that it''s emitting a higher heat than I thought. Even if you use blue magic to block the heat, your body is likely to melt just by getting in between. In this case, you can''t use the strategy of attacking from inside the body like in the past. ''''.......It''s useless, Ningen. You can''t be a good friend to me, and I admire your ability to surprise me. But no matter how hard I try, you''ll never be able to defeat me. Your fragile body cannot even get any closer. We don''t need to get close to them if they''re just going to attack us. I''m going to perform a sky-slash. Huh! A slash that ignored the distance sliced through a part of Phoenix''s body. Flaming wings scattered in four directions like fireworks. I fired a series of "kazora-slash" attacks. ''''Gunnu!'''' Is it working? Behemoth, of course, may have less defense and durability than Leviathan. With each slash, the flames that covered his body gradually decreased. I noticed that my body had shrunk by more than one round. ''''Mm?'''' What did he think at that time, Phoenix jumped into the magma by himself. ''''.........Hmmm, it''s just as expected of a phoenix. When he emerged from the magma again, he was back to his original burning form. 117-Episode 36: I was lonely The flames all over Phoenix''s body had weakened for a time, but when he emerged from the magma, he was back to his original shimmering, burning form again. ''You''ve replenished your strength from the magma. This will come back again and again, no matter how much damage you do to it. When I was pondering what to do. "...a ningen. I''ve seen what you can do. Hmm? "Very well. As you wish I am now your servant. ...for some reason, he said he''s going to be a follower himself. What do you mean? What''s wrong with you? I''m not sure if I disapprove, but I''m simply surprised. Until now, the two bodies have been deprived of their strength and forced to become followers with a slavery spell--. No, he was trained to do it right. The Phoenix landed on the ground. It grew smaller and smaller. Eventually, it took the form of a human man. He looked to be about 40 years old. Where had the fire that was burning so vigorously gone, he was a sober and austere looking gentleman, a change from the way he was shining like the sun. At best, he has red and yellow in some of his gray hair. It''s a mystery as to why they all look so different from their original appearance when they are humanized. "To tell the truth........ Phoenix gave him a divine look and said. ''I ... was ... lonely. ....? ''Hundreds of years, thousands of years ... all alone ... and lonely ...'' What did he say, this mythical grade demon? From the way he looked up at the sky with distant eyes, one could see the depth of his long years of living....... ''''Because of this burning body of mine, no one will approach me........ Even if I am humanized, I can tell by the signs, or the demons and animals will flee immediately.... The only people who can talk to me are the mythological grade demons of the same rank there....... Phoenix glanced at Befi and Libby. Befy still looked sleepy and Libby was pouting. ''But it''s been hundreds of years since we last saw each other...'' Well, I get along with all the sea creatures and I''ve never felt so lonely, so I don''t really know. How I envy you. Phoenix looked at Libby with envy and jealousy. ''How hard it is to spend your days alone do you know what it''s like to be alone all the time? I''m more comfortable being alone. Befi said calmly. ''''You traitors........! Phoenix''s voice quivered as he realized that he was the only one who continued to experience loneliness. ''Then you could have humanized yourself and gone to town like you are now. Of course it''s impossible! I''m afraid to go to the city of Ningen alone, just thinking about it. What would you do if you were approached out of the blue?What if I''m too nervous to speak well?What topic of conversation do you want me to have? So you''re a lonely and shy person. That''s a problematic quality. "I talk to me like a normal person. I don''t think I could have done it one-on-one. It seems that he has some acquaintances now, so he''s doing okay. To begin with, how could someone who has lived alone for thousands of years possibly interact with anyone in the first place? That being said, it can be difficult. Well, I''ve never had a communication problem in the past, so I don''t know. "Master, I''m sure it''s just a matter of time before they''ll let you know that I''m okay. A reluctant middle-aged man looked at him like an abandoned kitten and said, "Please don''t add me to your squire...? ''''Will you please add me to your squire...? I nodded. ''All right. Nice to meet you, Fenny. I gave him a nickname for it while I was at it. I returned to the Demon City. ''''Now that we have five demons, we should be able to join the guild this time. Master. What''s up, Matty? Are you seriously going to participate in this monster battle with these guys?It''s a force that can normally destroy the world, Ked... I will.What''s the matter with you? No. ? He went to the trouble of gathering three mythical grade demons for that purpose. What are they saying now? ''''Therefore, I''ll let you guys do your best. No. Sounds like fun. Yes, my Lord. ''''........if you really tried, the city would collapse in an instant, but.......?Why are you most worried about the devil, Ole........ I take them in tow and make my way to the guild as soon as possible. I just got kicked out of the gate last time. ''''Oh?Are you back again? The female staffer from the other day looked at me and sniffed, huffing and puffing. ''''Oh. I''ve brought five demons with me. Now they should be allowed to belong.'''' "Huh? When I told her my requirements, she lifted the corners of her mouth as if to make fun of me. ''I only see the same demons and slime as last time, though, from what I see? I''m here. I pointed to Befy and the others behind me. Befy gave a big chipping motion, Libby was playing with a nearby statue with interest, and Fenny was hiding behind my back in fear due to the presence of so many ningens. ''''It''s not a person by any stretch of the imagination! No, it''s not. He''s just humanizing. ''Humanized?Hahahahaha!That can only be done by a demon of the legendary level or higher!Yeah, yeah, I don''t have time for this either, so don''t bother me. She waved her hand with a shush, as if she were chasing away a dog. ''''........Hmm. Looks like the sooner you get it looked at, the better. 118-Episode 37: Entering the funny monsters ''Finally, the battle to determine the top of the demon trainers is about to begin again this year!The biggest monster battle in our demon city - the King Tamer Cup is about to begin! "''Whoa, whoa, whoa, whoa!'' A thunderous cheer roared, and the building chattered and shook with the wave of the crowd. The audience filled the venue. According to the management''s announcement, the number was close to fifty thousand people. The arena in the City of Swords was also large, but this place would be several times larger than that. Due to the nature of demons fighting, the field is also large. With this, even if Befi turns back to her original form, she will still be able to fit in just barely. The field would be filled with her body alone, though. This King Tamer Cup, which was said to be the biggest monster battle in the City of Monsters, only trainers who belonged to the S-class guilds were allowed to participate in it. There are seven S-class guilds, and each guild has two or three representatives, for a total of sixteen contestants to compete in the tournament. If they could survive to the end, they would be given the right to play the previous year''s champion, the ''King Tamer''. The first match of the tournament is the one you''ve been waiting for!First off, I''m a member of the S-Class Guild, the Chemonauts!Enter trainer Gickrya and his merry band of demons from "The Beast Demon Trainer"! A man with a fairly large build for a trainer and five accompanying demons enter the field. The demons are all beastly. ''Cerberus, armoured grizzly, and emperor griffon are all as powerful as any of them!But the most notable demon is the legendary Gold Sleipnir!Its speed is definitely the fastest among the monsters competing in this tournament!'''' The golden-furred unicorn, perhaps realizing that it had been introduced, stood up on its hind legs and let out a high-pitched "hyphenated" sound. ''''My opponent belongs to the S-class guild "Invitation to Hades"!''''The Texan trainer of the Death Demon Trainer and his merry--no, fearless demons! In contrast to the trainer from earlier, a figure appeared with limbs as thin as tree branches. Due to the long hair, it was hard to tell the gender of the person. The people in tow were all undead monsters. ''''Led by Rich, the King of the Undead, Dullahan, King Ghouls, this is another powerful lineup!But the one to watch is still the Eastern Undead, the upper species of Kyung Shi, Sioh!Since this is his first appearance at the tournament, his abilities are completely unknown!What kind of battle will they show us?'''' A pale, giant-faced man with a strange hat on his head and a rectangular piece of paper taped to his forehead leapt with almost no preliminary movements and landed with a mental and physical somersault. Apparently, that was Shiou. ''''Then, finally, the bell for the first game! The sound of a gong rang out. Well, just like that, the King Tamer Cup began, but as expected of a tournament to determine the top of the demon trainers, the matches continued to be quite heated. Like the first match, there were trainers who had a close range of demons, while there were trainers who were able to successfully organize demons of completely different species. Some trainers gathered only brainy demons that collided with each other from the front, while others preferred to use demons that used the arrows to toy with their opponents. Since five demons were fighting at the same time, the strategic part seemed to be very important as well. It would allow them to turn a simple force upside down. When an inferior team defeated the opposing team through brilliant strategy and coordination, the audience was very excited. Incidentally, direct attacks on the trainers are not allowed, and they will be instructed from behind a barrier set up at the back of the field. ''''Now, in the blink of an eye, there are only two games left in the first round!And here comes game seven!"I am a member of the Class S guild, the Giants. Several huge shadows emerged from the entrance to the field, making an earth-shaking sound of zunn, zunn, zunn, zunn. A bipedal silhouette just like a human. But their size is incomparable. It''s a giant race. The wall separating the audience and the field is about fifteen meters high, so that the demons can''t get over it. But that''s only as high as their waists at most. The trainer was perched on one shoulder. ''''Trainer Ballessa of the Giant Trainer!We''ve got five of the Atlas species, which is said to be the largest of the giant race, for this tournament!It''s just over 30 meters high!Of course, of all the demons in this tournament, it''s definitely the biggest!'''' The five giants are the most exciting thing in the world today. ''My opponent is from the S-class guild, Monsterland!Trainer Zot of the Viscous Master and... what?Was there a last minute player change?Oh, come on, come on, say it. -- excuse me!Apparently there''s been a player change!Once again, you belong to the S-class guild "Monsterland"... but this one only has a name.And I''ve never seen or heard of it before...?--Oh, anyhow, the mysterious trainer, Aleru! I step out onto the field when I''m called. I''m actually one of the elected representatives from the guild. ''''You''re lucky then,'''' The guild master had asked him to join the guild and immediately participate in this tournament. In reality, the registration deadline had already passed, but he had used his S-class guild''s authority to force his way through. He confronted the five giants on the field. Looking up at them. Thirty meters. Not much. "Hm. 119-Episode 38: It seems that you have collected too much force Hey, why do you have four trainers? Where are the demons? No, look at his feet. "Slime? There''s some kind of fairy-like creature floating in the water. Don''t tell me you''re taking on Atlas with that thing? Oh, come on, they''ll stomp that thing out and kill you instantly! As I stepped out onto the field with my five demons in tow, the crowd buzzed. I could hear voices of confusion, disappointment, or even ridicule from everywhere. ''''Oh, Trainer Arrell and his demons!But is it really as good as it looks?Let the seventh game begin!'' A gong sounds. ''Befi, I''ve got it.'' Yes, sir. Befi steps out into the middle of the field alone and with a sluggish gait. ''For all intents and purposes, she''s human...? ''No, it seems too big for that...'' It''s not even close to the Giants. I mean, why are you alone? As Befi approached, the trainer on the giant''s shoulder said in a tone of dismay. ''Oi, what the hell is going on with this guy?You''re not going to send this little girl to fight my Atlas and the others, are you? He''s a small man, in contrast to the giant. I thought he was a child at first, but from the look of his face, he looks like he''s over 30 years old. For that reason, he''s dressed flamboyantly. It''s a good idea to make sure that you have a good idea of what you''re looking for. Normally, they would retreat to the back wall to avoid getting caught in a battle between monsters, but it seems that they intend to fight it out. ''Befi, that''s about right. "Hm. After nodding at my instructions - she unhumanized herself. The crowd gasped in unison. Befi''s body grew larger and larger as they watched. It quickly surpassed the size of the giants, and yet it still didn''t stop. ''''Nah, nah, nah...?'''' The opposing trainer, who had been looking downward with confidence a moment ago, is now looking upward with his mouth open. Finally, a mythical behemoth appears on the scene. More than 300 meters in length and 150 meters in width. A little over 350 meters wide. A little over a hundred meters high. Even if you put five thirty-meter class giants together, they wouldn''t be able to match it in volume. "Hmm, just barely fits in there. The behemoth had taken up most of the huge field. It stuck out a bit and broke part of the auditorium wall, but it couldn''t be helped. ''''This, this is........no way, behemoth!Shh, shh, shh, a mythical demon, a behemoth!'''' The audience''s reaction was largely divided into two parts. One was those who were frightened and in a panic in the face of the suddenly appearing monster. The other. ''Whoa, whoa, whoa! ''Wow! Huge! They were the ones who were excited with their eyes shining. It seems that rather than fear, the excitement of seeing a mythical grade demon for the first time won out. ''''Oh my god........'''' Some of them even shed tears and started to worship. It seems that in some areas, mythical demons are also an object of faith. Thanks to them, there was no panic in the auditorium, and the people who were about to run away quickly regained their composure. If it were any other city, this wouldn''t be the case. As expected of a monster city. ''''Jeez, jeez, this is not a joke!How am I going to fight this monster? The other trainer shouted in astonishment. ''''Oaaaah........'''' Uaaaah.... Even the giants that had stood majestically a moment ago were completely frightened in the face of a being many times larger than them. This might be the first time in their lives that they have encountered such a creature. ''''Should we take these guys down?'''' Looking down at these thirty-meter giants, Befi asked boredly. ''''Yeah,'''' Copy that. Befi nodded lightly and lifted her right paw. Cleave. ''''Ooohhhhhh!'''' With that alone, the five giants were blown away collectively. ''''Gyaaah!'''' The trainer who was on the giant''s shoulder quickly clung to the giant''s hair and flew with him. Several bodies over thirty meters tall flew through the air and slammed to the ground with a thud. The hall shook loudly and a dust storm-like dust storm arose. Even so, they are still sturdy giants. They look unharmed. ''''Do you still want to do it?'''' Befi slowly turned to face them. With a buzzing buzz, the giants turned their heads from side to side with a bright blue face. The trainer, still attached to his hair, screams as he is shaken off, but he doesn''t seem to notice it. A closer look revealed a large puddle forming underneath their hips. It looks like they''ve completely lost their will to fight. The opposing trainer who fell from the giant''s head is unconscious, and it would be impossible to continue the fight in this situation. ''''Ah, trainer Arrell wins!What a blitzkrieg with just one minute to go!An unknown trainer is on the verge of becoming a winner!I mean, how in the world did you manage to train a mythical demon? ''No, I mean the winner, I mean it''s already decided...'' How do you expect us to take that thing down... There was a mood of defeat among the other contestants who were watching the match. .........Hmm. Even if it''s just one Befi, this is it? I still have four others. Apparently I gathered a little too much strength. 120-Episode 39: I was sleeping in the waiting room We are finally in the fourth and final game of the second round!Here comes Arrell, a completely unknown trainer who became the favorite to win in a heartbeat after a dominant first round victory. The day after the first round when Befi killed the five giants instantly. The second round had begun. As I walked onto the field, the bleachers sprang up. ''Here they come!Behemoth! Which one of you is a behemoth? "An unusually tall woman........what?He''s not here...? But it is quickly rewritten into a voice of confusion. I look back and sure enough, Befi is not there. ''Where did she go?'' Behemoth would have slept in the anteroom... Fenny tells me. Her voice was trembling, probably from the attention she was getting from so many people. ''Do you want me to wake you up?'' No, I don''t mind. Libby asks, but I shake my head. I don''t think Befi will have a chance today anyway. ''But my opponent is also one of the favorites to win this tournament!I''m a member of the S-class guild, Dora Dora Dora.He''s the talented trainer Sera, who has been in the top 4 for two years in a row, the "Dragon Demon Trainer"! Appearing from the entrance on the other side were monsters that were close to the size of yesterday''s giants. ''''Of course she will be led by five dragons!They''re all powerful dragon species, including the legendary grade demon Fafnir!'''' They range from streamlined, slender, and nimble-looking dragons to those that look like turtle shells, to dragons with two pairs of wings on their backs, to dragons with three heads, to dragons with tails as sharp as blades. Even the smallest one is more than fifteen meters from head to tip of the tail, and the larger ones are about forty meters long. The trainer was on the head of the largest one. She was a woman in her mid-twenties. ''''Then I''m off! Libby said in a light-hearted tone, and then Libby walked away. ''I was going to let Libby have the game today. ''''Well I was wary of the behemoths that came out yesterday,'''' The other trainer let out a breath, somewhat relieved. ''''As expected, it''s not as if he has multiple mythical grade demons following him,'''' There it is. Libby returns to her original form. In the blink of an eye, it became huge and in the blink of an eye exceeded the size of the five dragons. Then there is a chance of success for us.........? The other trainer''s voice was weakly snatched from the middle of the Leviathan that appeared in front of him. It was about eight hundred meters long. About twenty meters wide. It''s not as big as Behemoth, but this one is also non-standard-sized. The other party''s slender dragon would be able to swallow it lightly. "Ri, Ri, Leviathan?Oh, oh, trainer Arrell, how he had another mythical class with him, too!'''' The auditorium, which had been somewhat quieted, perhaps discouraged by the absence of the behemoth, was instantly lit up. ''Deeeeeeeeeeeeeeeee!'' ''Seriously? ''Oh no!'' The cries of joy from the demon lovers roared. ''''Don''t tell me it''s not just Behemoth, but Leviathan? "To begin with, it''s a sea monster.How did you train him...? I mean, are you sure you''re going to be okay without water...? Most of the people who came to the site must have been expecting the behemoths to appear, and they don''t seem to be making as much noise as they did yesterday. ''Well then, let''s have some fun with him. ""Burrrrrrr...." The dragons take a back seat to the appearance of the mythical demons. Leviathan looks like a complete snake, but it seems to be a water dragon, or a type of dragon. Perhaps it''s because they are of the same race that they realized the difference in power. The other trainer, who saw the fear in the followers, shouted in a scolding voice. "There''s no need to get upset!Even though it''s a mythical class, the other party is a sea-dwelling demon!If it''s on the ground, it should be impossible to move properly! The dragons snorted and nodded, as if they understood those words properly, ''''I see. ''''Rather, this is a great opportunity to defeat a mythical grade demon!If you win, I''ll give you guys some of my favorite minotaur meat! "''Oh, oh, oh, oh, oh!'' The dragons let out a yell to dispel their fright. They seem to be so fond of minotaur meat that they were easily caught by the food. They are full of fighting spirit, ready to leap at any moment. Libby, on the other hand, looks down on them with an air of composure. Stuck on the ground, right?It''s not like that, but since you''re here, let me show you what I can do.'' Immediately after, the field turned into an ocean. Libby used her blue magic to create a large amount of water. It saw a large field full of water, and even Libby''s huge body could swim in it. ''Now that''s an advantageous environment for me!Come on, take a call from anywhere-- Huh? "''Gobogobogobogobobobob''... The dragons were all drowning together. ''''........Couldn''t you possibly swim?'''' I guess they can''t swim. They''re all land-based dragons. "Hey, help me! The other trainer was drowning with her. Apparently, she can''t swim either. ''''It can''t be helped.'''' Libby turns off the water. On the wet and sloppy field, five bodies and one person were lying like a washed up fish. ''''Well, from now on........'''' What, are you done? The third round has been decided. 121-Episode 40: You can do anything if you have muscle "King Tamer Cup Second Semifinal!Who will advance to the final!First, the eye of the cyclone in this tournament!Enter Trainer Arel and his merry band of S-class guild members from Monsterland! I walk into the field, still in the midst of all the excitement. ''It''s a behemoth!'' There''s Leviathan! I''d like to see them both again! Today, Befi is properly with me. Though her eyelids are closed as she walks. But neither Befi nor Libby were planning to fight. I was going to let Fenny do her best this time. He is trembling, but he''ll probably be fine. You should get used to it. "Ho, do I really have to fight my way out of this...? We''ve done it. We deserve it! "Hm. ''Sh........and there''s no way........'' Fenny walks to the center of the field with a look of determination on her face. ''Hey, there''s another one out there? Was he a mythical creature? Oh no, it''s cool and austere. But he''s kind of scared, isn''t he? You''re already dying. The crowd is concerned. ''My opponent is the runner-up from the last tournament!He narrowly missed out on the right to challenge the King Tamer after losing in the final, but he''ll be looking for revenge this time around with more power!I belong to the S-Class Guild of Boo-Boo!The self-proclaimed "muscle trainer", Garganda, is here!You''re going to show your opponents that you can do anything with your muscles! Appearing from the entrance gate on the other side were a large muscular man and five demons that appeared to be worms. ''''What the hell is this all about?Trainer Gargantua, where are the usual Muscle Monsters?'''' I was watching the last match, and it was indeed a formation of demons like minotaurs, ogres, and centaurs, all trained to be munchkins. ''''Gahahahahahaha!Don''t think I''m the same as I was!After losing the last tournament, I know what I''ve learned.Just because you have muscles doesn''t mean you can do everything, you know! The whole hall buzzed. ''Really?'' My brain muscles are getting smarter. Or rather, you finally realize. ''How dare Trainer Galgandha, you''ve bent your beliefs!Will this turn out to be a good thing or a bad thing!Let the game begin!'''' As soon as the match begins, the worms all dive into the ground at once. "Are you going to hide in the ground and attack from underneath your feet? But there''s no sign of the worm anytime soon. ''What''s the matter!Go ahead and try to attack!Gahahahahahahaha!No, you can''t!Whether it''s Behemoth or Leviathan, it''s impossible to attack a worm in the ground! I see. So that''s your plan. Don''t tell me you''re trying to make a run for it, trainer Garganda? Each match had a time limit of one hour. If the match was not settled even after this time, the winner would be decided by the number of monsters that could continue fighting. However, if the number of monsters were the same ''''The winner will be decided based on the results of the last tournament...! What a cowardly plan! Shame on you! Those muscles are an accessory! Fight fair and square! The whole audience booed at once. ''''Gahahahahahaha!''''Call it what you will!After all, it''s all about winning, if you win! But Gargantua listens to the accusations without a care in the world. ''Trainer Garganda, you''re completely open for business!But surely this was an effective tactic!Can trainer Arrell really make a move?I don''t want an hour where nothing changes, so do something about it! He forgot his neutral position, and I could hear his heartbroken true feelings. ''Fenny, can you make it?'' No, let''s do it. Fenny, who had been freaking out at the bustle around her, finally broke free of her humanization here. Immediately after, her entire body was instantly engulfed in flames. ''''Nah, the mysterious middle-aged man suddenly burst into flames!Are you okay? The flames swelled up at once and turned into a huge mass, and then, just like an egg hatching, it cracked open with a crack. A huge bird with a wing span of 200 meters spread its wings and appeared in the middle of the field. The temperature in the hall rose at once from the super high heat emanating from its entire body. ''''Whew, whew, whew, it''s a phoenix! The appearance of the third mythical grade demon. As expected, I thought it wouldn''t be so surprising if it was the third time. ''Ohhhhhh! ''Wow! How eeeeeeeeee! He was surprised that the tension was exactly the same as before. ''What a surprise, trainer Arrell, you even have a mythical demon, Phoenix, with you!But, but will the bird demons be able to defeat the worm that ran into the ground? Fenny exhaled a breath of flame towards the ground. ''Gahahahahahaha!Phoenix, I''m afraid!But I still think I''ve won.No fire can reach the ground--hot! Suddenly, Gargantua jumped up. ''''Hot, hot!'''' ''What''s the matter with this one?Trainer Gargantua, he''s starting to do that mysterious dance! It''s not a dance!What''s this heat? The ground was as hot as a burnt iron plate due to Fenny''s high heat flames. For some reason, it seemed to be hard for the barefoot Gargantuan to just stand there normally. At that moment, worms jumped out from various parts of the field. ''''What a way to heat up the ground and forcibly drag the worms out of the ground! The ground is much easier for heat to pass through than the air. It must have been hell to be in the ground, and the worms seemed to be unbearably out there. But then, this time they would fall directly prey to Fenny''s breath. Goooooooooooooh! "''Gaaaaaaaahhhh!'' Five baked worms were made and settled. 122-Episode 41: It is impossible to win The final round of the tournament is finally here!Which trainer will win the right to challenge the King Tamer? I walked into the field with five demons in tow. ''''Even though it''s my first time competing in the unknown, I''ve finally made it to this final!Enter trainer Arrell, from the S-class guild, Monsterland. Arrrrrrrrrgh! Arrrrrrrrrgh! Arrrrrrrrrgh! "Horrendous allergies!In just a few games, he seems to have completely won the hearts of the demon lovers!That''s just as well!What a tremendous power he has shown in all of his matches so far, dominating with just one demon!And that was made possible by three mythical grade demons...'''' That''s a lot of excitement. The crowd is said to be the largest it has ever been for a match, and the bleachers are filled to capacity. ''Last year, I lost to the King Tamer, but this year I''m going to get my revenge!I''m a member of the S-Level Guild, Jihad.Trainer Orsen!Can one of the best trainers in the world, who has lived up to his reputation by winning a close fight, stop the progress of the strongest newcomer? It was a good-looking middle-aged man who showed up after receiving such an advance remark. But for some reason he didn''t have a demon in tow. ''''It''s a pleasure to meet you. I''m Orsen, and I''m the one who was referred to you. He greets me with a carefree smile, even though we''re about to play a match. ''I''m Arel,'' When I look at you up close, you are still very young. I can''t believe you''re still in the final at your age. I don''t know how many years it took me to get to this point..." "You''re no longer in that category, are you? You are no longer in that category. "Hmm. ''''I never thought that someone would succeed in training a mythical grade demon. And three of them. I also tried it before, but my guards and the demons I was with were nearly destroyed and I had to crawl back home. That''s why I understand better than anyone else how amazing it is to have a mythical class in tow. Apparently, he likes to talk. He talks about a lot of things one way or the other without even asking. What''s this all about?Trainer Orsen, you don''t have a single demon with you?On the contrary, I''ve started chatting amiably with trainer Arrell!'' Hey, how come there are no demons in here? Let the game begin! The crowd began to buzz. ''''Honestly, with three mythical grade demons against you, there''s no way you can win. Then Orsen laughs hahaha. "You''re not going to abstain, are you? f*ck you!Don''t give up and fight properly! Curses flew in from all over the place. ''''Yes, it''s impossible to win. ........if we were the ones we were the other day. It was then. The entrance is wide enough to allow even large monsters such as dragons and giants to pass through. A sore appeared from the back of the room, large enough to fill it up. "Slime? It was apparently a slime. Its body was irregularly shaped, like a piece of clay, but its surface had a silver sheen that looked like metal. However, its surface had a metallic silver sheen to it, so it didn''t look like an ordinary slime. Moreover, it was huge. It seemed that it was stretching its body back and forth as it passed through the entrance, and it was actually far larger than the fifty-meter giant of the other day. It was probably close to a hundred meters in diameter. ''''As you can see, it''s not just a slime. It''s a rare species called King Metal Slime whose entire body is made of a special metal. It is said to be able to change shape at will despite being metal. And yet it was said to be as hard as adamantite. ''''Ki, King Metal Slime!Speaking of which, he''s the son of the famed Orsen trainer... What the hell is wrong with his size?He was in a match just the other day, and he must have been at most ten meters in size at that time.......?And why is there only one of them...? What Orsen showed there was a stagnant smile, a change from earlier. ''''Hmmm.......only one of them?No, that''s not true. There are many demons in your child that I have carefully raised in your child''s body. Well, you''re not gonna... Orsen suddenly began to scream as if he was out of his mind. ''''Yes!That''s right!It''s impossible to beat the mythical class at this rate!That''s what I thought, and I took a gamble or two!If we let this child absorb the highest peak demons that we had been following, a demon comparable to the mythical grade would be born! The whole hall was aghast. ''How outrageous...'' Have you no love for your demons? You can hear such abuse, but it''s not really a big problem. Normally, demons are targets to be defeated. And they even have demon food. I was rather impressed by his persistence in winning. It seems that the more quality food you feed them, the more they will grow!And then I found out they were so big!This is a completely different species now!To say it''s an evolution would be an understatement!The Emperor Metal Slime over the King Metal Slime!That''s what this slime is all about!Let''s defeat the mythical demons and create a new mythology! 123-Episode 42: A man who has neither blood nor tears ''My God!Trainer Orsen, all the demons I''ve raised so far have been fed to the King Slime!'''' You''re a cold-hearted son of a b*tc*! You are a demon trainer! Orsen is cursed at. But he shouts back with a distorted smile. ''''Hmph, hahahahaha!Don''t worry about it!Because they will live on in this child''s... ''meh'' forever! This emperor metal slime, Metacchi, shows mysterious movements, such as stretching and shrinking its body, and changing its shape irregularly. It seemed to be able to transform quite freely. Come on, go!I''m going to show your power to a mythical demon! At that signal, the huge mass begins to move slowly. As expected, it is large and lacks agility. ''But this is where it gets interesting!Even just a metal slime species, against which no magic or physical attacks can work!That''s the size of it!It was thought to be an impregnable mythical grade demon, but how will it really fight against this new species of slime?'''' It''s true that Befi''s physical attacks don''t seem to be a good match, and it''s useless for Libby to sink them with water. Will Fenny''s fire work? You might be able to vaporize it if you try hard enough, but what is the boiling point of metal slime? Well, let''s go with the plan. I had no intention of bringing out these three bodies from the beginning. ''''I can''t wait to see how much more power I''ll gain if I eat a mythical grade demon...............'''' Puh-leeze! ...What? Orsen let out a deranged voice. He must have thought that a mythical grade demon would appear. But what actually stood in front of the Emperor Metal Slime was a small kindred spirit that was only thirty centimeters in diameter at most. ''''Slime?'''' Of course it''s a pullle. It''s a bit grotesque when it''s big because it''s a mixture of black and purple in color, but right now it''s cute because it''s as big as the aforementioned. ''''There''s some kind of creepy slime out there...'''' What is that color? What are you talking about? It would be adorable, no matter how you look at it. ''What the hell is this all about?Trainer Arrell, I''m just bringing out the slime for a head count!This is the price you''re willing to pay to find out how strong your opponent is.But this size difference!This is going to be over in an instant!'' Apparently, Pullle wasn''t counted as a force to be reckoned with. ''''To bring out such a small slime.......are you trying to taunt us....... Fine!b*tc*, feed that thing to him! Metacci is closing in on Pullle. However, instead of running away, Pulluru charged at him. ''What a brave slime!And if you think about it, the only person who has ever done anything to change the rules is Arrell!You don''t mean to tell me that they''re going to exceed expectations here as well? --Petty. Such a sound was heard as it struck the surface of Metacchi. And then it is swallowed up by the body of Pruru Metacacchi. ''''Ehh........ ......Gohonhon!It''s still what we expected!Trainer Arrell, what the hell do you think you''re doing by leaving those demons to die? The audience booed. ''''Don''t let the demons die in vain! Stop playing around! Bring out the mythical class! I don''t mean to play around, though. With Pullle inside his body, Metachi resumes his progress as if nothing had happened. Here it comes. Are we gonna be next? No, that won''t be necessary. Apparently, Befi and the others also think that Pullle has been killed. But that is the slime of the demon world. There''s no way it would die like this. On the contrary. ''What?What''s going on, Mehta? Suddenly, Memachi stopped moving. ''The enemy is much further away, you know?What''s going on? Metachi didn''t respond to the trainer''s voice and began to shake her huge body with a shudder. It looks a bit painful. Metachi?What the hell happened?--What?This, this is.........? I peeled my eyes away when I noticed that Orsen was there. A part of Metachi''s body. The place that had just swallowed Pullle earlier had turned black. It''s as if the silvery metal had gone rotten. Moreover, that black area was getting bigger and bigger, as if the poison was spreading. At the same time, Metacchi''s suffering was becoming more and more intense. ''''d*mn........Metachi, hurry up and spit it out! When Orsen hurriedly ordered that, Metachi dexterously separated only the black part of it and drove it out of the body. Now it was back to its original beautiful silver color--and then I thought Wha...? Tacchi writhes in agony again. When I look at her, I see that a part of her body has turned black again. And it is expanding. Apparently it was not completely removed. In addition, the black lump that should have been separated began to move on its own, and then it jumped at Metacchi. And then, it enters Metacchi''s body. Before I knew it, the blackness had spread to the entirety of Metacchi''s body. And it''s getting darker and darker... Good job, Pullle. Puh-leeze! A giant slime that shook its body happily at my words of exertion. That''s right, it looks like Pulluru has been absorbed, but in fact, it has taken over Metacchi from the inside. 124-Episode 43: Thats a bit overstated As expected of the Gratney Slime, which is feared even in the demon world. It exceeded the absorption capacity of Pullman Matchachi and absorbed it back into his body. I''m sure you''ll be able to find out what''s going on here.The Emperor Metal Slime''s body has completely changed color!Its appearance is that little slime itself........'''' Me, me, me...? Orsen approached fearfully. Then Pullle reached out a tentacle and grabbed Orsen. ''Is this an attempt to absorb trainer Orsen!''Trainer Orsen orders him to let go immediately, but he doesn''t seem to be listening to me at all! Pullle. That''s not food. Let him go. Purrrrrrr! Pullle threw Orsen off. ''I responded immediately to trainer Arrell''s words!It''s clear which demon this is!How that little slime seemed to have been absorbed, and instead took over Metacchi''s body!But is that really possible?Maybe it''s our unknown slime!'' "Oh, it''s not true........that can''t be true!Mucky!It''s me!Have you forgotten? Orsen''s voice trembled as he appealed to his former partner''s body, which now belonged to Pullle. ''Trainer Orsen, apparently you still can''t accept that fact!But it''s understandable!The slime that I risked my trainer''s life and strengthened by feeding all the demons has become my opponent''s!'''' Heaven forbid! ''Yes!You got what you deserved! Orsen staggered closer to Pullle again, whether he heard the chasing abuse from the crowd or not. But he was mercilessly beaten away by the tentacles. ''Pullle,'' Purrrrrrr! I call out, and Pullle comes back to me, leaving a shocked Orsen behind. ''You''re getting pretty big again,'' A little over a hundred meters long. It would be difficult to bring it back. How did Orsen bring it here? I''m a waste of pulle meat (?) as usual. I decided to take the Illumination. An extinction spell is activated and pulls away from Pullle''s body in a sneaky way. I''ll have to be careful not to erase it all. ''''Okay, we''re back to normal now. Purrrrrrr! There was Pullle''s figure, which had returned to a reasonable size of about thirty centimeters in diameter. ''''Meh, meh, meh! Orsen exclaimed. ''That''s why I''m not plummeting again. ''What the hell did you do?Suddenly, a powerful flash of light flashed, and that giant body became smaller!What have they been showing us all day?A series of inexplicable events that my mind can''t keep up with!'' Was that magic...? Of course not. Trainers don''t have magical powers. But I definitely felt the magic!I know because I''m a sorcerer! What kind of magic is this then? ''That''s the first time I''ve ever seen or heard of anything like that! ''Anyway, that''s a win for trainer Arrell!Finally, he''s earned the right to challenge the King Tamer!What a first-time accomplishment!We may have witnessed a terrible turning point in history! "The King Tamer Cup was a bigger success than usual!It''s finally the last battle!Finally, it''s time to decide on the most emphatic teacher!'' Two days after the tournament final, a day''s interval from the tournament final, I had come to the giant arena again with five squires. I had come to the giant arena with my five squires again. ''''First of all, this trainer''s entrance!Now the demon city is all about him!An amazing newcomer to the scene!What a great way to win it all by a landslide!I''m from Monsterland, the S-class guild. He enters the field to a crackling cheer. ''Now, and here he is at last!The most powerful king tamer in history!What an amazing forty years of reigning in that position!The absolute champion!You are the king of the king tamer!I''m from the S-class guild, the Abyss. One and five bodies emerge from the other side. I''m not sure if I''m going to be able to get a good-looking old man. It''s not as if he has a bad leg, but he walks towards you with a cane. It''s a good thing that you''re able to have a good time. The information about King Tamer''s demons could be heard in any number of ways if one was in this city. He had been using demons consistently ever since he first won this tournament. Their appearance varied. A demon that looks like a human woman. A demon that looked like a lion. A demon that looked like an insect. A demon that looked like a lizard. A demon that looks like a chimera, a mixture of several creatures. The only thing they have in common is that they have jet-black wings and tails. Although the demons are a single race, their appearance is not uniform and they are very diverse. They were of varying sizes. ''''Yes!The demons led by King Tamer are considered to be very difficult to train.It''s also all advanced demons that are never less than mythical grade demons!'''' "Ho-ho-ho. That''s a bit of an exaggeration. An ordinary high-level demon is no match for a mythical demon. Grandpa was somewhat amused, denying it once and for all, and then However. This is where my skill comes into play. In other words, it''s called Tone and Strength. It''s the most powerful skill only I, the Trainer King, can use. 125-Episode 44: The Devil Is the Devil It''s not just a matter of training a demon. It''s a skill that strengthens the follower. Hence, of course, my demons are stronger than wild ones. "Hmm. The same goes for these demons. These aren''t just high-level demons. They are now as powerful as any demon with a title. The old man said, and smiled confidently and with a cheeky smile. Then suddenly his eyes sharpened. I don''t care if they are mythical demons or not. He''ll be able to get his nose out of his ass. At that declaration, the audience sprang up. ''What a declaration of victory for King Tamer!For the first time ever, King Tamer''s odds were humblingly predicted to be much lower than the challenger''s, but still, the King Tamer was going to show what a champion he was. The grandfather lightly lifted his staff, and on cue, the five demons stepped forward. ''''Hmmm, let''s show the boy what we''re capable of. "Mythical grade, no shortage of opponents. "Walla Walla, Shouli, Suru. Whew, whew, whew. .... I''ve heard that some of them can talk. "I suppose they can''t wait to fight. Let''s get this thing started. Yeah, I''m ready for it. "...is it strange?Then why do you have the demons waiting at your back? Look closely. He''s there. And that''s when the old man finally noticed his presence. ''''Why did I do this........'''' Spitting abominably, Matty was relative to the five kindred spirits. ''Order, order,'' Yes, yes, sir, I understand, master. The old man raised an eyebrow. ''''You don''t think you''re going to let that low-grade demon fight these guys, do you?'''' An eye for an eye, a tooth for a tooth, a devil for a devil, you know? "Oh, well, we have a lot to answer for. And there''s only one by the looks of it.Could it be that I''m presbyopic? Don''t worry. I can see it. The five demons look at Matty and sneer at him. ''Oh, my, my lovely kindred,'' "Vulnerable as a feather in a cap. Hataite, holy cow. Whew, whew, whew. .... Some of them don''t know what they''re thinking, though. By the way, master. You don''t want us to fight like this, do you? Don''t worry. We''ll get you your old self back. As expected, I wouldn''t be able to fight in that form. I released the restrictions on my power that had bound Matty. Immediately after, Matty regains his original power and form. He looks like a human man in his early twenties. He has a slender body and pure white skin. His black hair stood up sharply upside down as if rebelling against the heavens, and his eyes had a reddish tint. ''''This, this is...!The squire who was thought to be just a low-grade demon has revealed his true form...!I knew he was a servant of trainer Arrell!Looks don''t seem to deceive you, ah!'' Of course, it''s not just her appearance that has changed. An enormous amount of magical power poured out of Matty''s entire body. As if pressured by it, the five demons stepped back. ''''Wha........you mean this guy is also a senior demon.......?'''' And there''s nothing to worry about. I don''t care who they are, I will put them down. Hey, there, Yuri, I''m happy to help. Whew, whew, whew. .... That''s the equivalent of a knighthood. Well, a baron, or at most a viscount... but... but... Matty glared at the five demons with his red eyes, glaring at them. ''''From the point of view of this true lordly demon mastima-sama, you are no better than a low class demon! ""~~~~?" Matty shouted angrily, and the five demons shuddered. The previous fullness of himself is nowhere to be found, and he begins to tremble and tremble. ''Oi oi, you''re too big of a figure, you guys?'' The demons hurriedly fell to their knees on the spot. ''''Gyahahahaha!I think you get the picture!That''s the difference between us! ''''What, my God, the King Tamer''s followers have been subjugated!Incredible sight!Who in the world would have expected this to happen!Against only one of their own kind, those King Tamer''s, those most powerful demons, have admitted their defeat without a fight?'''' The audience was in an uproar. ''This is the Marquess class, seriously...? No, no, no, no, no, no, no, no, no... there''s no way that''s going to be in here... Do demons really have titles in the first place? I heard that''s what it says in an adventurer''s journal of exploration... The old man''s wrinkled lips quivered and he reprimanded his followers. What are you doing?Do you want to rub my face in the face of the king tamer? "......... However, the demons didn''t even reply and remained kneeling in front of Mattie. ''''Well.........in this situation, we have no choice but to use the thing. I didn''t think they would suddenly use the inner workings of the hand. Grandpa''s face was twisted in a hateful manner and he shouted. "Trainer Wangwei!Now fight that demon! Suddenly, the demons stood up as if they were motivated by something. At the same time, they all leapt at Mattie at once. ''''Ho-ho-ho!The skill set of the King of Devourers to force his followers to do what he wants them to do!And in addition, he''ll temporarily enhance your abilities significantly, two birds with one stone!The repercussions of that, though, will be great! I see... it''s the "heavenly destiny" type of skill your sister was using. But-- ''Ha!You''re wasting your time!At best, this absolute difference won''t be bridged even if the low grade becomes intermediate! ""~~~~~~?" --in an instant, he was returned. 126-Episode 45: The birth of a new champion The demons attacked Matty under Grandpa''s compulsory orders, but they were returned in an instant. .........Hmm, they were weaker than I thought. It''s a [Highest Rank] [Training King] demon, and I thought I could do a bit more. He was breathlessly saying that he could defeat even a mythical grade demon, but where did the confidence come from? ''''Shh, instantaneous killing........What a surprise, the King Tamer demons were defeated in just a few seconds......!And only one of them...!Who would have expected that the King Tamer, who had reigned supreme for so long, would be brought down so easily.......'''' The venue, which had been cheering loudly a moment ago, was now filled with a watery silence. But gradually the applause began to rise everywhere and then the cheers came back. ''We have a new champion!'' "King Tamer Alleluia! It''s gonna be another long administration. The old man''s face was downcast and he was shaking. He was so shocked, his bloodshot eyes looked like they were about to pop out of their sockets, and the blood vessels all over his face were sticking out. You can''t raise your blood pressure too high, it''s dangerous for your age. Matty came back to me. "Hmm? No, something''s wrong. "Kukku, did you think I was going to sit here and wait for you to be your squire forever? "Hmm? Hm, no, you f*cking bastard. Matty glares at me with wariness. And that''s when I notice something strange. ''Is the slavery magic being lifted? ''Gah hahaha!You finally realized that!There is no way I could break your servitude spell if I had my own power!You underestimated me! The slavery spell that had bound Mattie''s freedom had been released before she knew it. Now Matty is like a dog off the lead. I''m not going to be able to say that I''m not going to be able to do anything about it, but I''m going to say that I''m not going to be able to do anything about it. It''s not a good idea to take on a bunch of people at the same time, but it''s hard for me to take on both of them at the same time. You''re adding an extra layer of uncertainty to the mix. Matty spits as he looks at Befi and the others. ''But remember, one day I''ll make up for this debt, I promise! And with that, he spread his wings and flew off into the sky. ''Matty, House,'' Immediately after, Matty falls from the sky at a high speed. ''''Gaaaaaaaaaah! I was knocked to the ground as it was. What do you mean...? I taught Matty, who was grunting in the sand, a lesson. ''There''s no reason why you should be able to sneak a double dose of slavery magic on me. You underestimated me. So keep up the good work. Matty was in a five-body throwing stance in an instant. ''I''m sorry, Master Samaa! A few days after the King Tamer Cup was over, I was summoned by someone to a shop in the City of Monsters. I had been summoned by someone to a certain restaurant in the City of Monsters. ''''It''s a tavern in a pretty hole-in-the-wall place, isn''t it?'''' The interior of the restaurant, which was located down a dimly lit staircase, however, was magnificent, with an air of luxury. ''Oh, you''re welcome.'' The one who stood up at the back of the store and called out to me in a reassuring manner was the old man who lost to me the other day. There were no other customers. I''ve reserved the place for myself today. "We''ve reserved the place for you today," he said. "Hmm, is that why you called me here? Ho-ho, that''s right. I walk up to my grandfather. ''Do you have a drink?'' I don''t drink much, but I can''t drink much either. Ask for what you want. The wine is good here. As he said this, the old man raised his hand with an air of calling for a clerk. But there was no one in the store who looked like that. It''s not a customer or even a clerk. --There are plenty of other signs, though. But first, there''s something I''d like you to try. Immediately after the old man lifted the corner of his mouth in a grin, those who had been lurking in various parts of the store emerged one by one. Then they surrounded me. Obviously, the atmosphere is not that of a shopkeeper or customer. ''''.........Hmm, shall I ask you to explain what the hell this is all about?'''' When I asked, the evil nature of the old man came out from behind his good-natured mask. ''''Ho-ho-ho!He may be a genius trainer, but he doesn''t have a clue about anything. And he hasn''t even brought a single demon with him.Don''t you understand that unlike a powerful demon, a trainer who is himself only a vulnerable ordinary human being, that is his greatest weakness? What an idiot you are!Ho ho ho! The people surrounding me start to sneer in response to my grandfather. Do you know why I''ve been sitting on the throne of the king tamer for all these decades? The old man suddenly asked me such a question. But before I could answer, he continued, "The secret is very simple. Before I could answer, he continued, "The secret is very simple. You have to eliminate talented trainers. My position would be in jeopardy if a person of my rank were to appear in the top tier. So I must nip it in the bud. That''s why this city only had this old man for [the most senior position]. That''s the worst kind of old man. ''''Honestly, it wasn''t so difficult after I took control of this city. --Until you showed up. The old man twisted his face in an abhorrent manner and shouted. Then he turns his grudge-laden eyes on me, while his mouth forms a smile. Normally I should have killed him before the tournament, but it''s no use. You should be relieved. I''ll make sure the body gets home. 127-Episode 46 Heh-heh-heh, I''ll be d*mned. Sorry, but we''d be a lot more grateful to have my grandfather at the helm of this city. The people surrounding me sneer happily. They laugh at me. I''ve forgotten to ask you something important. How did you get that mythical monster, the black slime, and that demon to become your followers?Even I, the King of Trainers, can''t control these people. There must be some way to get them to do it that is not well known to the world. Hmm, you''re such a f*cking old man to ask that in this situation. "Ho-ho-ho. "Ho-ho-ho," he said, "because of the situation. If you don''t want to talk about it, that''s fine, but I wouldn''t recommend it. You don''t want to hurt yourself, do you? It''s not something to hide. I said. "You fought it, defeated it, and then used your servant magic. "It was my way of training him. Grandpa''s wrinkled mouth pops open. ''What?'' Then, with his corner corner of the eye. "...Ho-ho-ho. You''d better not be joking around, wouldn''t you?After what happened the other day, even the mild-mannered me is feeling a bit overwhelmed. I may not die so easily. It''s true. ''There''s no way!There''s no way they could beat him, and there''s no way the trainer could use slavery magic!Well, well, well. You''ll be sorry for your stubbornness, but you''ll soon regret it. Hey, do it. The old man squeezes his chin, and one of his minions approaches him randomly. Then he swung his arm and punched him. ''Crunch. ''Huh?'' I caught the fist. With one finger. ''''T-they...?'''' He tries to force his fist into me, but my fingers don''t freak out. ''Hmm, I guess even a fly has a little more power,'' He grabbed his wrist and threw it away. It blew up to the wall of the store, involving several people. ''Hey, what the hell is this guy?'' What the hell kind of power is that? The old man gave his men a pep talk. ''What are you doing!Let''s just hurt him and immobilize him as fast as possible! Their voices attacked us all at once. But clearly they were amateurs who were not used to fighting. They weren''t my enemies. ''''Gu........stupid.......'''' I''m not listening... You''re really a trainer...? Within a few dozen seconds, it was just me and my grandfather standing there. "d*mn, they''re useless!After all, we''re not human!Hey, Lio! Yes, sir. Appearing from the back of the store was one of the five demons that Matty had defeated the other day. It looked like a bipedal lion, more than two meters tall, and its entire body was covered in muscles like armor. ''''Ho-ho-ho!It''s a good thing we brought him with us just in case. You may have a little skill for a trainer, but you''re no better than a baby against a demon. The Lion Demon Lio pounced on him. A stiff arm with sharp claws approached. Zubak. The arm flew around in the air and fell to the floor. Blood gushed out and dyed the area red. "Gaaaaaahhhh! Lio screams. "Ki, you, what did you do? It was a hand-to-hand slash. You can''t do that! ''Didn''t you see it?Then we''ll do it again. As he approaches Lio, who is rolling on the floor and suffering, he raises his left arm in the form of a blade. He releases his hand blade more slowly than before. Zshuaugh. ''''Aaaaaaahhhh! This time, his left arm was severed. Hmm, it seems that even though they are all demons, not all of them have the same tendency to shrink when they are damaged, like Matty. After all, it''s a race with many mysteries. ''''Nah, nah........'''' The old man''s mouth is open so wide it looks like his jaw is about to come off. Who in the world are you?How can you do that! And then the magic power swelled up from Liao''s body. It''s not just a matter of time before you get to the point where you can get your hands on a new one. Immediately afterwards, a powerful thunderbolt flew in. It''s a type of green magic. It''s a type of green magic. I activate one of the light magic, magic reflecting magic. Zubaaan! Gaaaaaahhhh! The demon crumbled to the ground, burned by the magic he had cast. ''''B-ba-boo........Didn''t the trainer defeat the senior demon...? Well, now it''s up to you. I walk up to the old man. ''Well, well, you wait!Or, I can give you a lot of money!Name your price!And so I ask you to return the King Tamer to me.And I promise to keep paying you--no, you--half of what I have earned for the rest of your life! The old man shouts, sniffling and spraying saliva from his mouth. ''Shh, you didn''t know!I didn''t expect you to be the legendary [Super High Grade] Trainer God! ...The God of Training? I thought it was over my head!He has transcended the concept of a trainer by being able to subdue and subdue any demon with his own overwhelming fighting power!But when I saw you in front of me with those mythical creatures and demons, I saw it clearly!That it was all true! .........Hmm. It looks like this old man has made a grand mistake. "Ha, if you can''t have half of it, two thirds will do!It''s not a bad story, is it? I told the old man, who was desperately pleading with me, in no uncertain terms. I don''t need any money. But I''ll give you the King Tamer''s title back. Oh, really? Just swear to me that you''re not going to kick anyone else''s ass for the rest of the year. That''s not... I grabbed my grandfather by his chest. ''Y-na?'' Ha-ha-ha. When I let go of his hand, the old man stumbled heedlessly and fell on his ass on the floor. ''And one more thing,'' The old man''s face twitches with fear, and his shoulders tremble with fear. ''''I''m not the God of Training, I''m just an unemployed person. I''m just an unemployed person. 128-Episode 47: I Want to See the Face of My Grandson The countryside of Fainot. Evans was silently plowing the fields to the west of it, wiping away the sweat that occasionally dripped from his body. He had been the leader of the vigilante group that guarded this town for many years, and despite his age of over fifty, he was built like a fine bear. Although he still occasionally helps in defeating demons and other things, he basically lived a leisurely life while growing crops in the fields. ''''Huh. So this is it. He checked the condition of the soil and nodded with satisfaction. The soil he tilled, which was confident in his arm strength as only a [Senior Position] Rigid Swordsman, had become firmly soft. Still, lately, he was beginning to feel more than a little bit of decline. In particular, his body''s recovery has slowed down, and he can''t push himself as hard as he did when he was younger. ''I''m getting old,'' He had a daughter, he muttered sorrowfully. She was a relatively late child, but when he realized it, she was already twenty years old. It is not surprising that she should be married. ''''I''d like to see my grandson soon, but...'''' When I heard that she had started training as a bride at Leon''s house in the same town, I thought my daughter was finally ready for it... but unfortunately, there is still no report of her marriage. Is she still thinking only about the sword? ''''Since she was born a beautiful woman like her mother, I wanted her to grow up more like a girl... but is it because she''s become more like me on the inside? It''s not always easy to do what one''s parents wish. And then a faint vibration came from his feet, and Evans looked up to see what was going on. ''An earthquake?That''s a rarity around here. ........hmm? He spotted an unfamiliar object across the plains to the west. ''What is that...?'' Rocks, I guess. But there was no such thing as a rock in that place. And it''s getting bigger by the minute? Could it be approaching us? No, the rock can''t be moving. I thought it must be my imagination, so I rubbed my eyes and then looked again. ........It was clearly getting bigger. ''And this vibration...'' It''s as if there''s some kind of giant creature walking around.... I don''t want to believe that such a huge creature exists. I don''t want to believe that such a huge creature exists. And it''s heading straight this way - towards the town. But the reality was ruthless. Eventually, his eyes catch its true identity clearly. ''''Well, well, well, it''s a demon! Throwing off the hoe, he ran into town at full speed. --At that time, Leon-san''s house. ''''Arel-chan, you haven''t come back very often. Even though Laina-chan has just come back. The one who lets out a sigh while smiling is Leon''s wife, Farah. Evans'' beloved daughter, Laina, mutters in dismay. Next to her, Leon''s daughter, Mira, blurts out I''m sure he left because he didn''t want to see the sow. What did you say? The sow said she wished she''d died in the dungeon. ''Not only did they throw worse swear words at you than you''re faking it, they threw worse swear words at you! Laina and Mila glaring at each other. ''Gosh, gosh,'' In the tense air, the one who cleared his throat was the family''s mainstay, Leon. Although he was the main pillar but unfortunately in the weakest position............He opened his mouth fearfully, as if to symbolize this. ''''Well, well, it''s about Arel. I''m sure he''ll come back properly in time, yes. And that''s when it happened. ''Ta, ta, oh my God! I heard such a loud voice from outside the house. I thought I heard thudding footsteps approaching, and then a large man came running into the house. ''Dad!'' Miss Evans? They are all surprised, and Evans, who has a very pale face, shouts out to them. ''Oh my God!I mean, yeah, yeah, outside... Dad?Calm down, what''s going on? Outside ... outside ... I don''t know if he''s in a big hurry or if he''s just not getting the point across at all. Let''s just go outside. Farah urged everyone to do so. Then their eyes, as they stepped outside, caught sight of a huge rocky mountain that suddenly appeared to the west of the town. ''Mountain?'' Was there ever a mountain out there? No, no, not the mountains!Oh, oh, that was a demon! Evans shouted from behind and everyone gasped. Indeed, upon closer inspection, it seemed to be slowly approaching us. The ground was vibrating in time with it. ''''No way........'''' Leon, who was looking at the demon while standing tall with his small body, widened his eyes as if he noticed something. ''''A mythical grade demon, a behemoth...?'''' You''re beginning to see the town. As I stand atop Befi''s head, I look out over the streets of my hometown. ''Alright, we''re good to go around here. If we get any closer, there''s going to be a huge panic. When Befi walked, that alone would cause an earthquake. The house could collapse. And then. ''Hmm?'' There was a figure coming towards us from the town. ''Father and mother?And Laina. You''re in quite a hurry, but what''s going on? I waved my hand. ''Hey,'' Then they noticed me. The three of them stopped and looked up at me with blank faces. We''re home. Arel? Arrell? 129-Episode 1 Is the pig also called makeup? Oh, Arel...? Arrell? I look up at me standing above Befi''s head and my mom and dad are rolling their eyes. Laina is with them. I''m sure you''re not the only one who has returned from training. This demon is..... I made him a follower. ''''Juu........you made him a follower!'''' Hmm?Is it really such a surprise? That''s because he''s a demon trainer. You have a demon or two as your followers. Or maybe he thought it was impossible for me to be a demon trainer. ''''Well, that''s not what I''m talking about!I''m telling you that one is too big! Laina exclaimed. ''If your mother''s eyes are correct, she looks like a mythical behemoth...? True, that behemoth. "N Befi nodded and a strong wind blew in her nose as she nodded. ''But Befi''s the only one this big, you know?Since we''re here, let me introduce you. In his humanized state, people might not think he''s a demon, so I''ll have him return to his original form. Libby becomes huge. ''''Hey, Mom?Is it a mistake?He looks like a mythical Leviathan... No, Dad. I don''t think you''re mistaken. I can see it, but it could also be just a big snake. ''I don''t think there are any snakes this big besides Leviathan...'' I said, "That''s the real Leviathan. "The real Leviathan. Caught him at sea. "What a small town this is! Libby bobbed her head and a light tornado broke out. Fenny then returned to her original form. ''''....................or mother!Am I looking at the wrong person?Now it looks like a mythical phoenix! No, Dad!I don''t think you''re mistaken!I can see it too!...but it could just be a big bird...! ''I don''t think there are any other birds this big besides the Phoenix!And first, it''s burning! The three of them repeated the same line as before in a yakuza-like manner. ''It''s definitely Phoenix,'' .... "''Hot....'' As Fenny flapped her wings, a fierce hot wind burned the ground. ''''........Arel.......how far are you going to go.......'''' It''s already so far beyond your mother''s imagination that I don''t know. For some reason, he looks tired. Hmm?Maybe I should introduce you to Pullle and Matty later. So that''s how I got back to my parents'' house. You''re still settling in as usual. ''''Well my dad is not settled at all. As he says this, Dad looks over at them as they set up all over the living room. Befi is sleeping like a cat on the couch with her long body folded up, and Libby is eating a delicious snack that Mom made. Fenny looks like she''s drinking her tea gracefully, but if you look closely, she''s nervous and her face is even more strained than her dad''s. ''But I think it''s good that your mother is lively. It''s true that it would be troublesome if she were to rampage in her original form, but she just looks a bit odd when she''s doing this. Mom, on the other hand, seemed to accept it easily. It''s a strange thing to be humanized.... It''s a kind of magic, I suppose. I think it''s a type of magic, but hmmm, it seems to be outside the basic six types, so my father doesn''t understand it either. Apparently, even my dad didn''t understand it. I asked Befi and the others, but they seemed to be using it sensibly and didn''t even understand the magic formula. I thought if I could analyze it, I could try to reverse it and turn into a giant or transform into a demon. ''Speaking of which, where did Mira go?'' I''m sure Mila would be in her room. Since I''m making so much noise, you know I''m back. But he didn''t even show up. He must have hated me after all. And then, there it is. ''''Brother, you''re back.'''' ...Mira? I turned around and was amazed. It''s only been six months, but she''s become even more mature again. He''s long past his sister in height, but he''s going to overtake his dad sooner or later. He was wearing stylish clothes, as if he was planning to go out somewhere, and if you looked closely, he was also wearing makeup. For some reason, Laina raised her voice. ''Oi, why are you wearing makeup! ''Of course you''re a girl. I don''t want you to be lumped in with some male domineering sow who can''t even put on proper make-up at the age of twenty. You''re a f*cking sow!Wow, I''ve worn makeup before!.........yea, once or twice....... Is that what they call makeup for pigs? ''There is no such saying!You wouldn''t wear makeup when you''re at home in the first place! Mira does. You were normally naked in there. They''re fighting again......... ''More importantly, Mira, weren''t you angry? What are you talking about? Hmm?I thought for sure Mira hated me. ''It can''t be. It''s impossible for Mira to dislike her brother. Okay. All right then. As I''m patting my chest in relief, Mila approaches me. I can smell the good perfume in the air. ''Brother, you must be sweating from your long journey. You should take a bath. Hm?Yeah. I''d certainly like to get in. That''s why I''m boiling water for you. You''re so smart. That''s why he didn''t show his face very often. She''s a cute little sister who loves her brother, after all. ''''Can Mira come in with me too?'''' Yeah, sure. Wait, wait, wait, wait! Laina interrupted loudly. ''You''re almost ten!Next month we''re going to have a blessing ceremony!For goodness sake, why don''t you and your brother and sister stop taking baths together! I hope the extra pig doesn''t interfere. So stop treating me like a pig! Mu, come to think of it, it was already that time of year. ''Mira will receive the blessing?'' ''That''s right. Mira is going to be a grown-up now. A grown man would be much more likely to take a bath by himself! Well that''s not the same thing as this. I''m with you! It''s different. We started arguing again. But that little Mira is already ten years old..... Time flies. I wonder what kind of job she''ll be given? 130-Episode 2 Isnt there two words for a man? Arel, you''re going to have to match me! The day after I came back to my parents'' house. Laina suddenly said something like that to me. ''''........What, from the bushes to the sticks?'''' ''Why do you look so strange!What do you think I was apprenticed to Lord Farah for! "Bridal training? Not that!Sure, he was doing some housework!That''s just a housewife''s helper, Lady Fara!The main thing is the sword! That''s what I thought. "It was all about taking you down!I''ve had to train hard for that! ''Laina has a very resigned nature. I don''t want you to be the only one to say this. Well, there''s no reason to say no. I''ve decided to accept Laina''s challenge. As expected, I can''t fight in the city like in the past. It''s better to be out of town, and as far away from it as possible. And the last time I fought my mother, I was too close to town, and the town fell into chaos in the aftermath of the battle. I remember that time, Laina''s father had rushed over with a change in his blood. Come to think of it, he almost sat down yesterday when he saw the behemoths approaching. However, I don''t think it''s going to be such a fierce battle. I don''t know how strong he has become. ''''By the way, am I allowed to use magic as well? No, that''s a bad idea. It seems to be a purely sword-based match. Well, I don''t want to use magic from the end but it''s going to be too one-sided. I just wanted to check it out. "What about the demons? Please don''t do this to me! Of course, I just asked this too. ''Okay. Let''s get started then. Just until the blessing is gone. You don''t think it''s possible for you to lose to me, do you? Hmm, is it clear to you? I can see it in his face! Laina sniffed there, huffing and puffing. If you can afford it, I have a wager to make. "Bet? ''Yes. ...How about ... the one who loses has to listen to one order of whatever the winner gives? I don''t mind, but... Are you sure?If you lose, no matter how unreasonable you are, you''ll always have to listen to me, okay? You''re talking about losing.I won''t lose, I''ll be fine. ''Huh, huh, huh... you said that?You don''t have two words for a man, do you? Lifting the corner of her mouth and smiling wryly, Lyna drew her sword. Then for a moment, the sword itself seemed to glow faintly. Hmm, it doesn''t look like it''s just a sword. Even though I just pulled it out, I feel a tremendous pressure. ''''This is a God()story()-class sword that I got as a bonus for attacking that sword city dungeon. I see, it''s that dungeon I''ve dived in before. The fact that it''s a capture bonus means that you must have reached the lowest level of the dungeon. A sword is a part of a swordsman''s body. Even if it is a sword with special abilities, it is not strange to fight with it. Moreover, it is something that Laina obtained by herself by hiding in the dungeon. ''Well, no matter what kind of abilities you have, it doesn''t matter? Suddenly, something strange happened to her body. I tried to move my body for some reason, but it wouldn''t budge. It''s as if his entire body has been turned into metal. Could this be the sword...? ''Yes!That''s the power of this sword!The ability to completely block your opponent''s movements is truly mythical, right?Though the effect is only a few minutes at most. Okay, I tried to put all my strength into it, but I really couldn''t move at all. You can''t even swing a sword like this. It seems like you can use magic that doesn''t require you to move your body, but I''ve decided in advance that magic is forbidden. ''''........Isn''t that indeed unfair? All I had to do was win. They don''t mind winning this way. What was this rigorous training? ''''Well, it''s not too late to surrender. I don''t want to give up. Well, then, live with the pain. Then you''ll just have to live with the pain. You''re used to it. Laina slashes at me. But before she can get in time, the slash I fired first hits her torso. ''''Wha...?What did you just do? What? I attacked you before you attacked me. Don''t tell me it''s magic?I told you!He said no magic! No, it''s not magic. It''s a regular slash. ''Don''t be silly!You''re not supposed to be moving right now. You don''t need to swing your sword to unleash a slash, do you? What do you mean? I explained simply. ''Just picture it. It will definitely cut," he said. Then you''ll really cut. I don''t know what that means! ''Well, if you don''t have enough imagery to learn how to separate personalities, it''s going to be difficult. What''s that separation of personality law all about in the first place? Laina shouts with her head in her hands. ''This isn''t the time to be looking in the corner! Geez. ........d*mn it, you''ve got to be kidding me! Laina fights back in a losing effort, but my attack is faster. The best way to do this is to have a good idea of what to do. Really?It''s pretty tiring, though, so I can''t spend hours on it. "...we lost... With all the blessings gone, Laina had her hands on the ground and was hanging down. ''Don''t be so downhearted. I think I was getting stronger, don''t you?That''s what I''ve learned from my mother in person. ''It''s no consolation at all!What a lot of effort I''ve put in over the past few years to even lose to an opponent who couldn''t move! It was quite an embarrassing loss, to be sure. Woooooooooooooooooooo! I made him cry again. Even though I''m already over twenty years old, I''m still crying like a child. ''''It can''t be helped. I''ll do whatever you say, and I''ll do whatever you say. So cheer up. Oh, really? Yeah. Really, really, really true?Since you asked, we''re screwed!Don''t tell me what to do! Really. So what were you going to order me to do if I won? Laina wiped her tears away with her arms, and suddenly she turned bright red. Well, it''s just that we-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa-whoa... Kekeke? Keke, will you marry me... I don''t know. Oh, I don''t know. That''s good. 131-Episode 3: I fell in love with it I was getting married to Laina. When I went home to tell my mom and dad, they were delighted, saying things like, "Finally?" and "It took you long enough. We''ll have to have a wedding! That day, Mom began preparing for the ceremony with great effort. Thanks to that, the wedding ceremony was held in the town''s only church and was attended by a large number of people. ''Congratulations, Alleru-kun! Happy holidays! I entered the ceremony as they filled the seats, celebrating with me. ''Congratulations, Mr. Arrell,'' When we walked up to the altar, there waiting for us was Rosette, the bishop of this town who has been in charge of the blessing ceremony for many years. She is currently in town because this year''s blessing ceremony will be held in just a few days, and she will be giving the blessing words at our wedding ceremony. We waited for a while, and then Laina came into the ceremony hall alongside her father. There were gasps here and there. Next, a faint laugh. ''And dad, you don''t have to cry so much about anything, do you? ''Ughhhh!Because, Laina.........Daddy is so happy and happy........! The reason for the laughter was probably because Laina''s father, Evans, was already crying a lot. It''s certainly a bit comical to see a big, bear-like man crying with his nose in the air. ''I''ve been worrying about your daughter for a long time, you know. He was a late bloomer, so he''s even cuter. But that''s a relief. Good for you, Miss Evans. As a former vigilante leader, people all over the city knew him. The warm words from everyone made Evans cry more and more. ''''Oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! Stop it!.........Totally, it''s embarrassing for me....... Laina came over to me, letting out a sigh. ''''What''s going on...?I don''t mean to stare at you like that... No, they''re so beautiful, I couldn''t help but admire them. "Nanna. Laina was beautiful in her wedding dress. Her red hair stood out against the pure white outfit, and her well-defined face was enhanced by the well applied makeup. ''''Oh, don''t tease me too much!It wouldn''t look too good on me, being a manly man! No, you don''t.You used to look like a man, but now you look like a woman. You''ve gotten more beautiful over the years, haven''t you? ''''~~~~! Laina''s face turns bright red. ''''Oh my God, Arel-chan, flirting in front of everyone. Mother, it reminds me of our youth. As me and Laina stand side by side, Rosette looks at me first and asks. ''Do you, Arel, take this woman, Laina, as your wife, and swear to love her in riches and in poverty, in sickness and in health? "I swear. Then he turned to Laina. ''Do you, Laina, take this man, Alel, as your husband, and vow to continue to love him in riches and in poverty, in sickness and in health?'' Chichi, I swear! Rosette nodded divinely. Then kiss your vows. ''Wait a minute! Suddenly, with a shout, the door of the church was opened and a small figure jumped in. ''That oath, big sister, will not allow it! It''s my sister. ''I mean, why didn''t you get invited to the ceremony in the first place when you''re the big sister?I found out for the first time yesterday and flew in a hurry! It had to be because of the possibility of doing something like this. ''I couldn''t give a pretty Arellu that kind of woman a chance!Let me take over that area for you right now. ''Hmm, sister?What kind of spanking would you like to receive today? ''Hi, Mom!d*mn, but today, I don''t care if it''s my mom, I''m not going to let her down!Hey, guys! My sister shouted and eight women came into the ceremony hall. I''ve seen these guys before. They were the eight generals, I believe. ''''We''ve brought all our eight generals with us today!I don''t care if it''s your mom, you can''t lose to--?What do we do now?Why are you guys grabbing me and... Your Majesty, forgive me. This is a move for your sake, Your Majesty. "We mustn''t make that mother angry. The eight generals lightly lifted her sister''s body. ''''It''s yah(yah)meh(yah)!Let me down!Oh, why isn''t the Heavenly Fate working? I had to wear earplugs to make sure this would happen. ''Ahoy!You profane people! In the end, my sister was carried out of the ceremony hall without any way to accomplish this. Goh, Gohon. Rosette sinks the scene with a cough and continues as if nothing has happened. ''So, this time, kiss your vows. I approached Laina. "Hold on, wait! What''s going on? I''m going to have to prepare myself for this! ''You are such a lovely bride to be nervous about kissing. "Isn''t this your first kiss? No way. Couldn''t she be? The attendees are whispering to each other in hushed tones. ''Yo, all right!Don''t do it. Come on, come on, come on! Finally ready to go, Laina declares emphatically. He seems to be fired up as if he is about to have a match. ''''Let''s go.'''' This time, I''m going to close the distance between me and Laina. .... but... Hold on, hold on!Tammas!I''m not ready to go... He turns away from his bright red face and starts to say that again. Oh boy. This isn''t going to end any time soon. The attendees are indeed beginning to be dumbfounded. This is the place I should do something about it. --This is the place to do something about it. I close the gap between us in an instant and pay off her legs. ''''Hiyah!'''' I caught her firmly in the air with both arms. Then, with the princess hug in place, I took her lips. .....Hmmm, soft. ''''Ooohhhhhh!'''' For some reason, the ceremony sprang up. ''''~~~~! Buhuh! When you think steam has risen from Laina''s head, she passes out with a mysterious scream of ''squeak''. ''''You''re overreacting, at least for a kiss. ........Anyway, this is how I got married to Laina. 132-Episode 4 Dont forget your ex girlfriend After the wedding ceremony, there was a big banquet held in our yard. People from all over the town were merrily making noise with drinks in their hands as they lined up the dishes that my mother had spent a lot of time preparing. Arel is a lucky man. You are a lucky man, to have such a beautiful woman as your wife. ''And it''s cute as a first time thing. Hmmm. ''You''ve shown me some nice things at your wedding!Hahaha! The drink seems to be about the wedding I mentioned earlier, after all. ''''~~~~! She brought herself up, and Laina turned over, her face red. ''That''s fine. In fact, it was cute.'' Uh-oh, shut up! I teased him lightly, and he punched me with a fizzy punch. I''m monstrous, so it''s not so much a faintness as a doggone gun!That''s about it. But then the blonde girl got involved. "What are you flirting with?Are you showing off?We''re showing off, aren''t we?Is this a challenge to me, who is still in the mid-20s and still on the road to singlehood? He seems to have been drinking a lot, and his breath, which smells of alcohol, pokes his nose. ''Hm?Who was this blonde?I think I''ve seen this somewhere before. What?Don''t forget your ex-girlfriend, please! Who''s your ex-girlfriend? I don''t think I''ve ever been with you. What? Yeah, no. You''re still the same, this blonde woman (Lilia). She seems to have heard rumors of the wedding from somewhere and came all the way from the Sword City. Even though I didn''t invite her. "I can''t believe you''re so callous!Why didn''t you invite me?You didn''t fight together to protect the guild!I guess you could say we''re war buddies! No, that''s an exaggeration. ''No exaggeration!On the contrary, as they work together to achieve the same goal, they gradually become attracted to each other and eventually fall in love!Oh!But fate has ruthlessly torn them apart........! He started talking like a musical out of nowhere, but it''s all a fabrication. This guy is pretty drunk. Well, even when he''s not drunk, he''s still like this. "Hey, you''ve had too much to drink, Lilia. Laina looked dumbfounded and took the liquor bottle from Lilia. Lilia tried to take it back while she tried to get it back. Shut up!Not only do you want to deprive me of Mr. Are you trying to deprive me of Arrell, you are also trying to deprive me of alcohol! "Okay, okay. I''ll just drink some water and sober up. The winner, Laina, doesn''t understand how a loser like me feels. I ended up crying. Hmm, I think it''s time to pick it out. No, no, no, please be nicer than that!I''ve been thinking about it for a while now, but Arel-san doesn''t have a good way of handling a maiden! She''s right! ...Mm. Here comes the troublemaker. It''s my sister. She should have been made to leave the wedding, but she seems to have joined the banquet before I knew it. She seems to have drunk a lot and her face is bright red. There''s a nearly empty liquor bottle in his hand, but he looks completely childlike, so it''s just uncomfortable. ''''Arel should be nicer to his big sister than that! ''Oh, you''re Arrell''s sister, as they say!I understand that feeling very well! Oh, whoever this is, do you understand me? Of course!I mean, I''ve been feeling sympathy for a while now on my own! He''s my friend at heart! They suddenly embraced each other. Then they started drinking together. Apparently, they hit it off. We''re both like each other. Thanks to this, I didn''t have to deal with them. Hm?Speaking of which.... Suddenly, I looked around to see if I could find her. But she was nowhere to be seen. ''Where did Mila go?'' She had apparently gone back to the house and when I looked at the window of her room, I saw that the lights were on. We welcomed Laina into our home the next day and our newlywed life began. Not much had changed since we had lived in the house for years, though. However, my dad made this proposal to me. Why don''t we build a new house?Our house isn''t that big. There are some demons you brought with you and there could be more in the future, right? Mom agreed with that. ''Mom, I can''t wait to see my grandchildren''s faces. I want at least three ... no, I still want five. Laina, please do your best, okay? Yes, yes.... ''Oh, of course, don''t be shy at night in the house now, either. Even if you hear their voices, your mothers-in-law won''t mind. What do you mean, "What are you talking about? ''''Oh my goodness, you''ve turned bright red, you''re as original as ever. ........I should have told you about the night after all, shouldn''t I have told you? So we''re building a new house. The prize money of the King Tamer Cup is so high that it would be enough to pay for a house in the city. In the countryside, you can probably build a big house. But I''m going to miss you guys... When it came down to it, Dad said something like that, even though he''d suggested it himself. ''I guess so,'' But we still have Mira at home......... That Mila is also a blessing ceremony for the day after tomorrow. Depending on your occupation, you won''t know how long you''ll be home. ''Not likely!Mira will be in this house for the rest of her life - or at least for as long as my dad is alive! But still, I don''t see him much because he''s always holed up in his room.... Maybe she''s nervous before the blessing ceremony. 133-Episode 5: If there is such a person, I would like to see his face ''I could hardly sleep thinking about what kind of occupation Mira would be given, Dad, I was so nervous! Yeah, well, so is your mother. Dad and Mom have an exchange that I''ve heard somewhere, but today is the day Mila receives her blessing. I remember ten years ago today. I was given the profession of "unemployed". It''s the outlier of the outliers with no benefit from skills, but....... So the last decade has proven that it didn''t matter if you didn''t have any skills after all. ''I don''t think we should generalize about that...'' Laina looks at me with half-lidded eyes. ''Hm?Is that right?I think anyone can do it if they work hard enough. There aren''t many people in your position that could put forth that level of effort. Why am I being dissed by my wife in the morning? Could he be in a bad mood? ''I see. Because I haven''t kissed you good morning yet. I don''t see it much these days, but my mom and dad used to do it a lot. I heard that was the secret to marital bliss. What are you talking about? ''You needn''t be so shy. Last night-- ''Waaaaaaaah!Don''t say that here! Laina turned red and ran away. ''Speaking of which, Mila hasn''t woken up yet, has she? ''Oh, yes. We should be getting ready soon. Okay, your father will go wake you up. ''Please don''t do this, it will put me in a bad mood. It''s a day to receive a blessing from the Goddess. Why, Mira!Daddy loves you so much! ''It''s because you try to kiss my sleeping face. Can I ask you for a favor, Arel? Of course. While Dad starts to cry, I head to Mira''s room. I don''t do the folly of going into her room like my dad did, but I knock on the door and say to her, "Mira. I knock on the door and say, "Mila. You have to get up soon. ........Mira? But no matter how many times I called out to him, he didn''t answer. ''Mira, I''m coming in.'' I had no choice but to go in. "....not there? The bed where Mira was supposed to be sleeping was empty. Is she already awake? I couldn''t find him under the bed or in the closet. I also looked around the bathroom, my room and my dad''s bedroom, but I couldn''t find him anywhere. ''He''s not in here, is he? When I opened the door of the warehouse that I don''t usually use much, I found Laina inside. ''''Well what are you doing?'''' Uh-oh. Anyway, it''s all about Mira now. I''m going back to the living room. "Dad, Mom, it''s hard. I can''t see Mira anywhere. What? Don''t tell me he''s already gone off on his own...? ''Mother, you''re right, that''s not going to happen. I''d love to see his face if he''d leave his family and go off on his own. "...and... For some reason, my dad and mom give me a subtle look at my words. What did I say that was so strange? And then Befi, who was lounging on the couch, pointed out the window. I just saw him walk away. Are you sure? "Hm. How long? About thirty minutes ago. Maybe. Judging by the direction, it''s the church. I don''t think she really went alone? ''Mila''s gone greedy...'' "...and... Mom and Dad look at me again with a subtle look on their faces. We had no choice but to follow Mira to the church, me, my dad and my mom. Laina I don''t know what''s going on so let''s just let it go. ''What?'' What''s going on? When I enter the church, the usual solemn atmosphere is gone, but for some reason it is noisy. And there is a small crowd of people in front of the altar. It looks like someone has fallen down. As I approached, I realized that it was Rosette, the bishop who also took care of me and Laina''s wedding ceremony. Of course, she is also an important person who will be performing today''s ceremony. "Hey, what happened? Leon!And Farah-san and Arel-kun...! We ran up to them, and they all looked back at us in unison. ''Leon-kun...'' Even Rosette, who had fallen down, noticed us and let out a thin voice. She seems to be conscious. ''''Are you okay?'''' Don''t worry about it I''m just feeling a little sick... He looks pale, but from the looks of it, he doesn''t seem to have any trauma. ''The sooner you rest in the back the better...'' ''No ... but before I do ... I have to tell them this ...'' Then we were shocked by the words Rosette uttered. ''Just now, Mira came here alone and I performed a blessing ceremony for her...'' ""What?" After all, Mira had come alone, it seems. But the blessing ceremony was supposed to take place after everyone had gathered. Just because you came first doesn''t mean you can''t receive it first. So why Mila alone...? She......you and your family are the only ones who can save her....so.... What the hell did Mira do? .... So what does she do for...? "...wha...wha...I can''t...wha...I can''t...say it...out of my mouth... Mr. Rosette! Rosette''s lips quivered as if she was frightened of something. Her complexion, which had been on the verge of getting better, is rapidly deteriorating again. ''You''d better let her rest at once! Let''s get him to the nap room! Rosette was carried into the back by everyone. ''Anyway, let''s find Mira,'' Well, I guess... Yes. I''m going to split up with my mom and dad and we''re going to look for Mira. 134-Episode 6 Leave No Evidence I was looking around town for Mira. "Come in," I said. Hey, isn''t that you, Arrell? What can I do for you today? Grandma, have you seen Mira? Mira?I haven''t seen you. Okay. Let me know if you see him. I wasn''t in the item shop in my neighborhood. ''Oh, Arel, what''s up?What are you looking for? Have you seen Mira? I haven''t seen her. By the way, I hear she''s getting more and more feminine lately. I was wondering if you would be so kind as to introduce me... Mira''s only ten years old. Think about how old you are. The familiar face of the old man, 32, who is also a member of the town''s vigilante group, doesn''t seem to have seen Mira. ''Hmm?What''s out there?Mira? Whew! What a cat. The cat that had been scavenging the trash can ran away. I looked everywhere after that, but I couldn''t find it. Arel, were you there? None. He''s not here either... It''s a small town, so the three of us could finish seeing all the notable places in about an hour if we split up. We decided to take another look at it to see if there was anything we missed. Maybe they are hiding somewhere. It could be up in a tree, or in an abandoned house. Even in a small town, it is indeed quite painful to try to find that much. Before I knew it, the sun was beginning to set. But still, we couldn''t find Mira. In fact, there was almost no news of her sighting. I''m not going to be able to find it here....could it be outside of the town...? If that''s the case, we''re in trouble. There are demons outside the town. The town is surrounded by a wall, and there are only two entrances and exits: the north and west. I came to the north gate. My father should have seen this place once, but I decided to check it out again just in case. ''Yes. I''ve seen him. Are you sure? Then a woman near the gate reported seeing someone who looked like Mira. ''I think she was in a carriage heading north to the city,'' Carriage...? If it was a carriage, there would be an escort on board, so there would be less danger, but now there would be another problem. Riding in a carriage is not at the level of going out of town for a bit of a change of pace. ''''Don''t tell me Mira is planning to go on a trip...? You didn''t say anything to your family? Anyway, let''s go after it. According to the woman, it was in the morning when the carriage that Mira said she rode in left. That means she may have left the church and come straight to the boarding area. Matty," he said. Tell Dad and Mom and then Laina what you just said. Hey, yeah. Sending out the submissive demon as a liaison, I decided to follow the carriage. After Arel left town following his sister''s ride in the carriage. The woman who had provided him with the information went into a nearby building. And there, waiting for her there was Did your brother leave town in pursuit of Mira as planned? It was exactly the person in question that Arel was looking for at the moment - Mira. ''Yes. It seems that he believed the sightings we had. It''s superimposed. The woman reported, and Mila nodded with satisfaction. Then, sister. The rest is up to you. Out of the corner of her eye was her sister, Astaire. Now that she was already overtaking her height, Mira would look more like her sister from the edge. ''''Umm... but are you sure you''re okay?'''' Don''t worry. I will master this profession in two.......no, one year. So in the meantime, I want you to use your subordinates to keep my brother apart like you are doing now. In fact, the woman just now was one of Astaire''s subordinates. ''''That thing should be a hindrance to your sister as well. My sisters and I will join forces to get rid of it.'''' But hey... if Arel finds out... ''I don''t leave any evidence. With this profession, I should be able to do that. But it''s only a year... Mila could tell that her sister wasn''t too keen on the idea. Speaking of which, I found a mysterious diary in the back of my bed. ''Nuh-uh!I thought I threw it away properly! It was so interesting that I''ve memorized the contents perfectly. Now I''m going to go into town-- I''ll help!I''ll help you and I don''t want you to do that! Astaire cries out with tears in her eyes. The women under her command are slightly dumbfounded by the sight of such a pathetic lord. ''''Kureha, are you there?'''' Here. When Astaire called out to her, a petite Eastern girl dressed in a ninja costume appeared out of nowhere. She is one of the eight imperial generals and specializes in various covert missions. ''''Therefore, take care of the rest. "As you wish. It was Astaire who eventually threw everything to her. ''''Well don''t make it easy for me to say that. It''s extremely difficult to guide that monster.'''' Kureha secretly complained later. I was chasing the carriage that Mira said she rode in. It was flying through the air and was many times faster than the carriage. I thought I might be able to catch up with them on the way. Are we already in a town up north...? I''ve seen a few carriages that looked like that on the way. But in none of them was Mira riding in the carriage. ''It''s a town,'' Eventually we reach the town to the north. It''s a small country town not much different in size and population from Fainot. The sun has already set. Still, I call out to the townspeople to see if there have been any sightings. "Have you seen him? Yeah. I saw it. But we don''t know where they went, do we? Apparently, he was still in town. But I didn''t know any more than that. ''''Well it can''t be helped. We''ll stay at the inn for today and resume our search tomorrow. ''Wait, Master Kureha!I''m already over here!Too fast, right?'''' "So I told you. "I told you to watch out for that guy. ''To begin with, it''s a two-day journey by carriage!This is usually overtaking you!In the meantime, I gave you false information in the guise of a townie, with my sister arriving first! "...He knows? "No, it didn''t feel like that, but... ''I see. Maybe I''m too crazy to have any common sense. Thank God. 135-Episode 7: Special treatment is not possible Searching the town to the north, a few days. There are occasional reports of Mira''s presence in the town, and it seems certain that she is here. But no matter how hard I search, I can''t find Mira. Maybe he knows I''m looking for him and he''s running and hiding. It''s a shock to my brother. But she used to be a cute little sister who used to miss me a lot, and I''m sure we''ll be able to have that kind of relationship again. I''m sure that we''ll be able to get our relationship back to the way it was back then, so I keep chasing after Mira. And so a few days passed. I got new information. "West Town? Yes, I think it was the day before yesterday. It was the day before yesterday, I believe. I saw you riding in the carriage to the western town. To my surprise, they had already left the town. I immediately decided to head west to the town. Thus began my days of chasing after Mira. When I heard that Mira went south, I jumped south. When I heard that she went east, I went east. When I heard that she went west, I went west. If you hear that she went to the north, you go to the north. However, everywhere he went, he could get testimonies that he had seen Mira, but he couldn''t find the person in question. ''''Keke keke, you''re like a stalker--dee-deep! ''Isn''t it normal for a brother to chase his sister? Yes! Did you talk to your father and the others? Of course Death! I know from the testimony that she is safe for now, but I don''t know what will happen. After all, she is only a cute 10-year-old girl. In the first place, a mere 10-year-old is not able to run around like this. I went from town to town and city to city, until I came to my thirteenth city. I was informed that I was on a carriage heading here. ''That''s a pretty big city,'' It seemed to be quite prosperous, and the place was full of people and activity. It wouldn''t be easy to find a single person among them. The more people there are, the harder it is to get sightings. ''''In that case... let''s send a request to that place. So I headed to the Adventurer''s Guild. There are adventurers who specialize in finding people. I''m sure they are familiar with this city and it''s much more efficient than looking for them alone. Besides, if Mira is running away from me, it would be better to use someone else. ''Here.'' Since it was a large city, the guild was a magnificent building. It seems to be a five-story building, with restaurants, taverns, and even lodging facilities all around. Welcome to the Adventurer''s Guild. What can we do for you today? I would like to make a request, please. I told the woman at the reception desk that I wanted to find my sister. ''Mila, is that you.......how old are you?'' Ten years old. She''s a very pretty girl with dark hair. .... For some reason, the receptionist raises her eyebrows thoughtfully. ''What''s wrong?'' No I think I might have seen that person before. Are you sure? I didn''t expect to get a sighting from the receptionist of the Adventurer''s Guild. ''''Where did you see her?'''' I don''t say that I saw it, but as a matter of fact, just the other day, this girl who calls herself Mira-san registered as an adventurer here. "Registration? Yes, sir. Mira is an adventurer here...? But Mira is only ten years old. Can a kid like that be an adventurer? The system allows you to be an adventurer from the age of ten. But there''s an exam, so few people can become adventurers at that age. However, since Mila-san has passed the test... What a... I can''t help but be surprised at what I didn''t see coming. ''''........By the way, what is Mira''s occupation?'''' If the newly blessed Mira could become an adventurer so quickly, it would most likely be a combat-type profession. It could be the highest level profession as well. ''''I''m sorry, but I can''t give you that much information. Okay. Anyway, if Mira has become an adventurer, we might be able to meet her here. It is said that this city has the world''s largest dungeon, and adventurers from all over the world come here to get rich. So to speak, this is a sacred place for adventurers. If so, there is a possibility that Mira is also hiding in this dungeon. ''Mira is only ten years old!That''s dangerous! ''I don''t need to be told that...'' Mu, that''s true. ''In the meantime, I''ve instructed you to take on the dungeon with a party as well, so as expected, I think it''s solo. ''No, it''s not. I can''t imagine that Mila would be partying with anyone else. After all, as far as I know, she doesn''t have any friends who are friends. "...and... ''No,'' ''No, Mila is a very sweet and nice girl. But she grows up a little too fast and doesn''t fit in with the other kids her age. That''s why she hasn''t had any friends in the past and that''s why she''s always tried to do everything by herself. I''m sure he''ll try to take on dungeons by himself first. The receptionist looked a little pitying, and I explained it firmly to my sister''s honor. ''I want to dive into that dungeon too,'' "Then you will need to register as an adventurer. Our guild is in charge of it. What?Do I have to go out of my way to be an adventurer? ''Yes. You must first make an appointment for the exam... yes. Right now, the earliest you can take the exam is probably in three days. Three days later?But we need to go help Mira right away. I''m sorry, but I can''t give you any special treatment under any circumstances. How inflexible you are........ ''''I''m instructing them to try out the shallow tiers at first, so if they''ve passed the exam, I''m not that worried. The receptionist saw the young man leave after finishing his exam appointment and told his colleague that he was going to the bathroom, and then left the window. Instead of going to the bathroom, however, he found himself in a corridor that was not very popular. There was a young woman dressed like an adventurer. As I approached, she silently handed me her bag. The woman left without saying a word. The receptionist checks the contents of the bag and smiles. There was a large amount of gold coins in it. ''''..............................It was a delicious job. Of course, she didn''t know about a ten-year-old named Mira, and the fact that the child had taken the test and become an adventurer didn''t exist. ''And yet........I don''t think it''s possible for an unemployed person to become an adventurer. Well, it''s none of my business. 136-Episode 8: Both avant-garde and rear-guard can be done The dungeons are inhabited by numerous demons and dangerous traps. Maybe Mira is overconfident in her own strength because of her profession, and she''s challenged a hierarchy that doesn''t match her abilities. In order to pursue her sister, I''ve decided to become an adventurer as well. But in order to do so, I''m told that I have to take a test. Three days later, the day of the test finally arrived. Of course, I didn''t spend the last three days in a daze. He had been searching the city and staking out the adventurer''s guild. But I couldn''t even find them, let alone get any information. They must be hiding in the dungeon after all. In one corner of the Adventurer''s Guild''s spacious entrance, a large number of people, including me, had gathered there. There are probably more than thirty of them. It seemed that these were all the people who were going to take the test this time. All right, it''s time to go. I''m going to explain the outline of the test now. I will only say this once, so listen carefully. He saw that all the stern, middle-aged men, probably skilled adventurers, had gathered together and proceeded with the exam. The test is divided into the first and third tiers. I''m sure you''ll be able to find a great deal more information on the subject. Well, good luck next time. It''s like a sieve. Perhaps the content of the test will become more and more difficult. The first test will be quite simple. Now, I''m going to run through the city. You are to follow me. And only those who can follow me to the end will be able to move on to the next test. It''s a test to test the minimum physical strength required for an adventurer. ''However,'' the examiner continued. ''You''ll have to carry the load on your back. Men who looked like staff members carried a backpack with them, looking quite heavy. From the looks of it, there are two different sizes. In consideration of the difference in physical strength, the weight will vary depending on whether we are the vanguard or the rear guard. Apparently, the vanguard is carrying a fifty kilogram load and the rear guard is carrying a thirty kilogram load. ''''Wow, this is pretty heavy........'''' I don''t know if you''re going to walk or run with this thing on your back, but...? Lifting the luggage, the candidates frown and moan. ''''Haha, from my point of view, this is just like not carrying anything on your back. On the other hand, the one who sniffed and lightly lifted the fifty kilos of luggage was a big, muscular, Mohawked man. Hmm. It''s called making a difference between the vanguard and the rear guard, but I''m applicable to both of them. ....................So I''m supposed to carry both? Well, it wouldn''t be much weight for this. I carried fifty kilos on my back and brought the thirty kilos in front of my body. ''Hey, dude, what are you doing?'' Then the examiner blamed him. ''No, I can be both the vanguard and the rear guard. I thought it would be better if I carried both. "...those guys usually only need the heavier ones... Is that so? To begin with, people who can do both are very valuable. If you pass, you''ll be competing with many different parties. That alone is enough to get you through the first round. ........By the way, Magic Swordsman?Or is it the Holy Knight? No, I''m not. ...What? There was a lot of laughter from those around me. "Hey, hey, it''s "Unemployed"! How can an unemployed person be an adventurer? "Pupu, you can''t do vanguard or rearguard, that''s a mistake! The big man from earlier approaches and laughs as he looks down at me. ''Kukku, you don''t have to force yourself to have so much, you know?You can barely stand still, can you? I''m not pushing myself. In fact, they weigh about eighty kilos together, which is about a margin of error. You''re a nobody, but you''ve got the chops to show for it. Well, at least you''ll reach your goal before the sun sets. Then the candidates line up, led by the examiner. ''You''re going to drop out soon anyway. Get to the back. When he said that, I was pushed to the back of the pack. It wouldn''t make much difference which position we started in, and I''d be in the back of the pack quietly. ''Then let''s get going,'' As the examiner started to run, the candidates followed in unison. ''''Ko, this is........'''' Isn''t that a bit fast...? Normally, it wouldn''t be much of a pace, but with all this weight, it''s going to be tough...! Now I won''t be able to follow that "no-job" thing from earlier. One of the candidates, who looked back at the tail end of the line in amusement, rolled his eyes. ''He''s running without a care in the world! ? I''m walking as fast as I am walking, and that''s not going to make me catch my breath. If the pace is like this forever, I could run forever. I doubt anyone will drop out of this, right? I was only a mile or so into the run. One of the people in front of me started to lag behind and dropped back to the back of the line where I was. ''''d*mn I didn''t expect it to be this hard in the first round........! He''s breathing hard and sweating. He looks quite painful. Maybe he was in bad shape from the start. "You shouldn''t push yourself too hard if you''re not feeling well, you know? Oh, shut up.Whew..... In the end, when he was more than ten meters behind, that candidate stopped. Furthermore, starting with this one person, one by one, people start dropping out. Since I''m at the very back of the line, they all fall off past me. ''''I''m at my limit.......'''' Hahaha.... why is the Unemployed still here...? Then, in the blink of an eye, more than ten people dropped out, and when we were down to about twenty All right. All right, let''s pick up the pace. The lead examiner declared that. 137-Episode 9 is within the margin of error All right. All right, let''s pick up the pace. The examiner leading the way lightly announced, and a scream came from the candidates. ''''Really?!'''' I thought we''d keep up the pace to the end! I''m not listening to you! But their protests were empty and the examiner sped up. ''''d*mn I wanted to follow you...'''' I can''t do this... In the blink of an eye, two new people are eliminated. Furthermore, the Mohawk man from earlier also began to lag behind. Apparently, he had power, but not endurance. He persisted for a while, but eventually he too dropped out. There were fifteen people left. The examiner slowly slowed his pace and eventually stopped. ''''Alright, that''s it. Those of you here are the ones who have passed the first round.'''' ""It''s over..." Everyone stopped at once as well. They who had remained up to this point were also breathing quite well, and they had a look of relief on their faces as they crouched and fell down. ''''Zeez........'''' But then the man with the mohawk arrives late. Unfortunately, only those who have followed me to the end have passed the test. Try again next time. Oh, are you f*cking kidding me? At the examiner''s unsympathetic notice, the mohawk man shouted out. ''''There''s no way this [unemployed] bastard passed and I failed!There must be some mistake! He points at me and says something like that. The examiner raises his eyebrows. ''He definitely followed me to the end. Whatever his profession, he passed this first round. I don''t get it!Hey, man, you did something bogus!I just didn''t think there was any way he could run like that with 80 kilos on his back!This one must be light, unlike the others! With that shout, the Mohawk man lumped the load I was holding in front of his chest. ''See, look how light--whoa! He couldn''t seem to hold it in one hand and dropped it on the ground. Perhaps because the scene was a bit ridiculous, the people around me started laughing. ''Wow, don''t laugh!It''s just heavier than I thought it would be!This is thirty kilos...? Wait, this is... A dubious examiner tries to lift the load. ''''Ha!I knew it.........this isn''t thirty kilos. It''s sixty kilos. ""What?" The examiner also checked the package I was carrying. It''s not 50 kilos. It''s a hundred pounds. ""A hundred kilos!" The examiner explains. ''The reason the capacity is almost the same is because it''s packed with a special metal of twice the density. It was made for the training of advanced adventurers but apparently they''ve been mixed up. So it was subtly different in color from the others. I guess I was trying to tell them apart. In other words, it seems I was the only one running while carrying a hundred and sixty kilos. It''s more than three times as heavy as the other vanguard, or five times as heavy as the rear guard. Well, it''s within the margin of error. ""There''s no way!" We were all plugged in at once. ''''Well anyway, let''s move on to the next exam. The examiner tells him, puzzled. But it''s the guy with the mohawk from earlier who doesn''t like it. Well, hang on!I don''t recognize you! ''Admit it or not, he followed me to the end, carrying more weight than he should have. There''s no way he could have done anything other than pass. I know it''s a mistake!As a matter of fact, there''s no way this poor body has more muscle power than me! The Mohawk man shouted and suddenly tried to grab me. I grabbed his hand back the other way and we formed a pair of hands together. ''Maybe they''re ornamental muscles?'' Shut up! The Mohawk man pushes you with all his strength. As you would expect of a man who prides himself on his strength, he''s quite good at it. I decide to get a little more serious. Muscles rise and both arms become thicker than a Mohawk man''s arms. ''''........What?'''' He crushed the stunned Mohawk man''s hand in his grip. There was a cracking sound of bone cracking with a crunching bang. ''''~~~~! He also lifted the Mohawk man''s body with just his arms. Pop. So I tossed him a few feet away. It''s also a distraction to the exam. It seems that the second test will be held in the training area set up in the basement of the Adventurer''s Guild. The examiner said as fifteen people gathered, including me, who had passed the first test. I''m going to start the second test now. But she will be in charge. I''m Elius, who will be assisting you with your exams. It''s a pleasure to meet you. She was a beautiful woman with a bewitching atmosphere. She was dressed in revealing clothes, and the male candidates were stretching their noses. I wondered what the hell kind of exam was going to be. Come on out, Bohr. As she called out to him, a huge shadow appeared from the back of the training grounds. ''''Well, demon?'''' Bravo! It was a boar that was over two meters tall and five meters long. Its limbs are as thick as the trunks of large trees. It''s a powerboa kind of monster. But don''t worry. But don''t worry, I''ll make sure he''s well-behaved. Apparently she is a demon trainer. As her name suggests, she is very proud of her power and is very good at rushing through the city walls to destroy them. It''s a demon that even seasoned adventurers would run away from if they encountered it. She said happily as the candidates gasped. ''I''m going to have you guys fight this girl from now on. 138-Episode 10: You may die if you are unlucky From now on, you''re going to have to fight this girl. The female examiner, Elius, who seems to be a demon trainer, says happily. In short, they will be judged on whether they pass or fail by watching them actually fight the demon. "This, with such a big demon...? How do you expect me to fight this...? The candidates backed away as if frightened. ''It''s okay. I''ve given you firm orders not to kill them. If you are unlucky, you might die, but well, adventurers are always in danger, aren''t they? The female examiner looked extremely happy and added something deliberately frightening. ''Boer, are you ready?'' Buh-hoo, buh-hoo, buh-hoo! The boar demon called Boa - the power boa seems to be very excited, probably because there are many first-time humans in the area. ........Are you okay? I don''t seem to be able to discipline myself properly. So, let''s start the second test. '''' the female examiner declared, and the next thing she knew, she was slapping the powerboa''s body. ''Bufo!'' ''What?Hey-- Suddenly, the power boa goes out of control and dexterously throws the female examiner away with its thick nose. She was slammed against the wall of the underground training area and passed out. ''''What?'''' The examiner was suddenly attacked by a subordinate demon, leaving the candidates stunned. ''''Bufo-oh! The power boa stood up on its hind legs alone and let out a loud yell as if to declare its freedom. It then slammed its front legs into the ground with great force. The impact alone caused the building to shake violently. ''''Dude, what''s going on here! ''I thought you were supposed to be disciplining them properly! The candidates scream and turn their backs on the powerbore and try to run away at once. But that''s the worst possible decision. Most demons have a tendency to attack fiercely those who try to escape, and they are usually faster than humans. Therefore, they will not succeed in escaping first. If you really want to escape from a monster like this power boa, it is better to somehow avoid the initial rush and then try to escape. That way, we''ll have a somewhat better chance of success. Sure enough, the power boa was going to run at once toward the candidates who had turned away first. Zang. Well, I cut its head off before that. The power boa''s huge body collapsed. A large amount of blood poured out of the severed surface and dyed the ground red. ''''Hey!What are you doing to me? A high-pitched voice hit my earbuds. I turned around to see the female examiner who should have been blown away by the power boa earlier, and she was about to run up to me with a change in her blood. ''''Boa, are you okay!And it''s not okay by any means! She turns blue in front of the power boa, which is no longer the breath of a bug. ''I thought you were fainting?'' It was an act! Acting? ''''I was going to see how the Squire Demon would deal with the sudden outburst of disregard for the trainer''s orders!It''s more tense that way, and more importantly, it''s interesting and pleasurable to see the candidates panicking! This female examiner has quite a twisted personality. ''Hey! What are you going to do?How much money do you think it took to train him to this point!I was going to make good money on that from now on! The female examiner screams hysterically. It seems that she''s more worried about the money than the life of her followers. She''s a terrible trainer. "Speak of the devil-- It''s nothing, Death. Compensation ... yes, you''ll have to pay for it! ''That''s not what you''re saying. It''s usually worse if you weren''t expecting to be beaten by a candidate. ''I mean, the Boers are a Danger Level A demon!There''s no way the examiners can beat me! I''m telling you that I wasn''t aware of that. ''Well, whatever it is, all you have to do is treat it, right? What?Treatment?I know it when I see it!Totally deadly!I can''t be cured! I think I can fix this one just fine. You can fix it yourself, if you insist!Even if it''s a hypochondria, of course it''s impossible! Hmm. Let''s try it then. --The Perfect Heel. It was too loud, so I quickly cast a healing spell. Then, as I looked at it, the power boa''s wounds were closing up. ''''Buhu?'''' The powerbore whipped up as if nothing had happened. ''It''s all right now,'' "Huh! The moment it saw me, the power boa started running backwards at a terrific rate. It''s surprisingly fast even when backed up. As it is, it hits the outer wall of the training grounds from its buttocks and shakes itself shakily. Apparently, he''s afraid of me. Maybe it can''t be helped because I''m the one who was almost killed but I''ve healed him properly. ''''Lie.........healed.......?I''m sorry, was that healing magic...?And to heal a wound like that in an instant... More importantly, what are you going to do about the test? Ha. Well well Boer, can we fight again now? The female examiner approached the powerbore as she asked that question. ''Bufoosh!'' Then the power boa started to ramp up again, as if it were excited. ''Hey, just calm down!Enough with the acting! Boohoo!Buford! Despite his best efforts to soothe her, the power boa didn''t seem to calm down. On the contrary, he attacked her again with the tip of his nose. ''''Geez!What the hell is going on? Boohoo!Buford! It seems that he has realized his master''s true nature and has stopped doing what he says. In any case, this would make it impossible for her to continue the exam. While the power boa was attacking her, the examiners sneaked out of the training area, hoping not to eat the rolls. 139-Episode 11 Come with me There was a lot of confusion, but the test to become an adventurer was over. Six people passed the final exam. Of course, I passed, too. "Let''s get in the dungeon now! As soon as I received my guild card, the proof of my adventuring, I headed to the dungeon. The entrance to the dungeon is located in the center of the city. It is surrounded by thick walls and heavily guarded. It''s unlikely that any demons will come out of the dungeon, but since it''s in the middle of town, it''s probably necessary to relieve the anxiety of the surrounding residents. The gate at the entrance and exit seemed to be constantly controlling entry and exit. I present the guild card I just received and go inside. The inside of the wall was reasonably spacious, as if they''ve secured a space for combat just in case. And there were adventurers camping and street vendors dealing in food and items needed in the dungeon. ''I guess we don''t need a dungeon map. We''ve mapped out ten levels of dungeons. Moreover, it includes data on the monsters that appear in the dungeon. If it''s your first time diving, this is a must-have. You can get a gold coin for a great deal! I decided to buy it because the street vendor recommended it to me. ''Maido ari'' Looking at the map, I found that this dungeon has a rather complex structure. Even on the same level, there are stairs here and there and many passages intersecting each other. And it''s vast. The entrance to the dungeon was a vertical hole about ten meters in diameter. There is a spiral staircase that surrounds it. When I descended the stairs, I found a space that resembled an ancient temple. A corridor continued ahead and to the left and right, and it seemed that the path was quickly divided. The map showed the shortest route with arrows, so we followed it to the right. Since it''s only one level, the demons that appear are all slimes, goblins and other small fry. There were few traps, and I easily found a staircase that led to the next level. At first I came to the tenth level that the map I purchased covered. ''There''s no Mira...'' I haven''t been able to meet Mira so far. Should we continue on to a lower level, or should we turn back and look for the level we''ve been on? While I was pondering, a group of three people who seemed to be adventurers came running from the road ahead, looking impatient. It''s a party of three women. ''''Ta, please help! If you look closely, you''ll see that you''re being attacked by a swarm of demons. Orcs and trolls, which are common demons in this hierarchy. ''Join them.'' I told them and walked past their sides to stand in front of the crowd of demons that were approaching me. "''Divine Sky Slayer''. An invisible slash ran through the void, cutting the demon''s torso in both directions collectively. ''''It''s over.'''' When I turned around, the trio were stunned. ''What?What did you just do? Wow.... All three of them must be about twenty years old. Judging by their equipment, one is a swordsman, the other is a wizard, and the last one is... a bandit? From the looks of it, he doesn''t appear to be injured. ''''Thank God I mean, he''s insanely strong. Female thieves (?) thanks me. Then he looks like he''s huffing and puffing. ''Yes, that''s right........!You can.........! ? ''In fact, one of our guys got caught in the transference trap! She appeals to me with a tense look. ''''That transference trap........the amount of magic power generated when it was activated was quite large, and if it was poorly executed, it could have sent me to the depths......!But we can''t go there by our own strength. If you''re going to go into the depths, you''ll have to find her! I ponder on that suggestion. In any case, I''m looking for Mira, and since I have no idea what I''m looking for, I have no choice but to search in the dark. But will the novice Mira really be diving deeper than this? ''She just became an adventurer... and she''s only ten years old. She''s very good at hiding, so I don''t think she''ll be easily beaten up... but she''s probably crying with anxiety by now. Apparently, there are adventurers similar to Mira. When I think about it, I feel like I can''t leave them alone, however, it wouldn''t be wrong for an older brother to put his sister ahead of a stranger. ''''I''m sorry, but........'''' Well, her name is Mira, but... ''What?Mira?Did you just say Mira? Yes, yes.... Mila is my sister! "What? After listening to the details, it seems that Mira had formed a party with this trio and was hiding in this dungeon. ''''Mira, just wait and see. Knowing that my sister is in danger, I break off from the trio and run as fast as I can. Even if they are there, they''ll probably be a liability, and it would be faster to find them on my own. The task I was personally assigned by Master Kureha was a nerve-wracking one, but it looks like it went well. She watched as Arel ran at breakneck speed and patted her heart in her chest. Next to her, the two women rolled their eyes. ''''How fast...'''' Are they really people? She thanked them both. ''Thank you both for your help. Here''s your reward. Oh, thanks, man. That was a lot of easy work, though. Really. I mean, it doesn''t make any sense at all. In fact, I wasn''t even at a party with these two guys. They were just strangers who had just met each other. They had captured an adventurer who was based in this city and asked her to form a party. She was under the control of [Shinobihime] Kureha. She had been given the role of tricking the young man from earlier and keeping him in this dungeon for as long as possible. For this purpose, she had gone to the trouble of taking the test and registering as an adventurer. (Even so, it''s almost impossible to find a single person in such a vast dungeon.......you didn''t even pretend to be lost at all....... (Are they really trying to find him?) Of course, the sister the young man was looking for wasn''t in this dungeon. And that was when the young man came back to us. Somehow the young man came back to us. She tenses up, wondering if her lie has been exposed. ''''D-Do you need help?'''' You''re not a thief by trade, are you? ''What?Oh, yes, yes, but.... She was actually a [Senior Position] [Jounin] of the [Senior Position], but if she said that, there was a chance that she might be mistaken for an Imperial official, so she lied about it. However, that would lead to disastrous results. ''Then it''s just fine. Come with me.'''' What? He was suddenly picked up by a young man. It''s a way of holding it as if it were a piece of luggage. And just like that, the young man runs towards the back of the dungeon. ''Eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee! 140-Episode 12 Im not at a loss at all I went down to the eleventh level looking for Mira, but then I remembered that there was no map after this level. As expected, this would take too much time. ''''There was a [bandit]-like figure in the party just now. With that in mind, I hurried back to the place I had just left, and fortunately the girls were still there. ''''How can I help you?'''' You''re not a thief by trade, are you? ''What?Oh, yes, I do. It''s a basic job with an excellent search ability. Although they lack combat skills, they can be said to be indispensable for exploring dungeons. ''''Then that''s just fine. Come with me. What? It should be a lot more efficient than me searching for them alone. Even if I''m slowed down in battle, I can still fight while protecting at least one person. I take her in my arms and start running. ''Eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee! Then he came down to the eleventh level again. ''''I just remembered that there''s no map from here. The Thief could map it, right? But I can do it, but I can do it, but... But? No, no... I don''t know why I''m getting teary-eyed, but for Mira''s sake, I have to ask her to be patient. Still, since it''s Mira, I thought she was diving solo, but surprisingly, she had a party together. In the end, I ended up getting sidetracked, but it was a wise decision. Maybe Mira has grown up without me knowing it. You know, we haven''t even told each other our names yet. My name is Arel. I''m Mira''s brother. I know ... (blah blah blah) Hm?What did you say? No, it''s nothing. Well, I''m a holly-hiela, that''s my name. Heera. Nice to meet you. Let''s go. After a brief introduction, he was about to run off again with Heera under his arm. ''So, if you could, could you hold her a little better!Or at least a piggyback ride! ''Hmm. Surely that''s a good way to keep both hands free. I started again with her on my back. I asked as we ran. ''I don''t know where Mira is, so I''m going to go lick her up, but do you have any idea how far away she is from your current location?'' Wow. I can get within a 50-meter radius. Not bad. With the search skill of the Thief, it''s also possible to detect situations in the vicinity that are invisible to the eye. It seems that an expert can instantly understand the map up to a hundred meter radius from your current location, or the presence or absence of demons, traps and treasure chests. With Healer''s help, I ran around the 11th level. Finally, the mapping of the eleventh level was completed. Unfortunately, Mira wasn''t at this level. I''d like to go to the twelfth level next, but It''s been two hours. ''''Rather only two hours, but........ Normally we can''t map this quickly........I mean, why do demons die on their own....... Still, at this pace, it would take too long. So, you see. Worst of all, apparently the deeper you go in this dungeon, the wider the floor gets. There was no telling how long it would take to find Mira with a lickety-split strategy. If it was a dungeon in the City of Swords, each level was equipped with a transfer magic circle. But this dungeon doesn''t have them. In other words, once you''ve gone under, you have to return to the surface by yourself. If only they could find a safe place to hide.... Still, there are food and mental problems. It''s not easy to find food in the dungeon. And of course, water is hard to find. It seems that they had a minimum amount of food with them, but even if they had it, it would be a week at the most. ''''Well okay, let''s destroy the dungeon core. Yes? Dungeon Core. As the name suggests, it is the core of the dungeon - the heart. The dungeon is maintained by the magical power supplied from this core, and it is also the power of this dungeon core that constantly generates new monsters and traps. If the core was destroyed, the dungeon would naturally become unsustainable, and the dungeon itself would collapse. And when it collapses, all foreign objects in the dungeon - adventurers and explorers, for example - would be automatically spat out of the dungeon. In other words, if you destroy the dungeon core, you will be able to return to earth no matter where Mira is. ''That sounds faster. Of course, there''s a chance we''ll be lucky enough to find Mira on the way. No, no, no, this is supposed to be the largest dungeon in the world!It''s not going to be that easy to deal with.You can''t just start running... you bit your tongue... ouch... ... After that, I just tried to go downhill and downhill. Even so, the first level took an hour or so, but the pace of the attack gradually increased. This is despite the fact that the lower levels have more powerful demons and traps. ''''Well I have a feeling it''s this way.'''' When the fork in the road comes, my gut tells me to move on. Oh, the stairs. It would prove to be the right thing to do. Such things were gradually becoming more and more common. ''''........Isn''t it strange that you''ve been acting so strange for a while now?You''re not lost at all, are you? I''m starting to figure out which route is the right one to take, somehow. What? Or rather, this dungeon, this do-or-die approach to misleading the explorer, or rather, the tendency to mislead the explorer, was common at each level. It was as if there was a person who had designed it, and their personality was reflected in it. For example, if there was a route that caused psychological resistance, it was usually the right route. If there was a designer, he or she must have a twisted personality. Also, I''ve been getting better at using my ''detection'' skills. Yes? That''s a cul-de-sac to the right of there, and that''s where the demons are. ''What?How do you know that! It''s surprisingly easy if you can sense the magic, the flow of air, the reverberation of sound and all that sort of stuff. Well that means you don''t need me anymore, right? 141-Episode 13: A true swordsman can kill an enemy without a sword ........How did this happen? My name is holly. I am under the command of Kureha-sama, the Eight Imperial Generals. As a Senior Shinobi, I was entrusted with this mission because of my abilities. Since my opponent is the Emperor''s younger brother, failure was unacceptable, and I even hired Sakura in advance to make the preparations well in advance. However, my original plan was to end up only guiding him, but I was forcibly kidnapped and forced to help in the search for my sister. Moreover, it''s a tremendous method of searching each floor of the building. To begin with, my sister is not in this dungeon. Knowing this, I want to go home now, but I can''t just run away. I have no choice but to continue this pointless search. But that was still better, and I was about to learn the hard way. "Alright, let''s destroy the dungeon core. No, no, no, this is supposed to be the biggest dungeon in the world! Your brother suddenly said something unintelligible. Do you want to conquer this dungeon? I''m not going to make it! According to what I''ve heard, the current highest record is forty levels. It''s almost four times deeper than here. Yet we still haven''t reached the lowest level, and we don''t even know how far the end is. Besides, in general, the deeper you go into a dungeon, the more powerful the traps and demons become. If you''re serious about conquering them, you''ll need a large party. And yet there are only two of us. I tried my best to appeal to him, but he wouldn''t listen to me. On the contrary, my brother is going lower and lower, lower and lower. More and more, more and more, more and more. No, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no. I mean, the lower you go, the faster you get! ''''Isn''t there something wrong with you earlier?You''re not lost at all, are you? I''m starting to figure out which route is the right one to take, somehow. What? What skills are those? I''ve never heard of it. Even if I''m a jounin, I can understand the map of the area, but I have no idea of the correct route until I can see the goal point. "Also, I''ve become able to use my ''detection'' skill. Yes? That''s a cul-de-sac to the right of there, and that''s where the demons are. ''What?How do you know that! It''s surprisingly easy if you can sense the magic, the flow of air, the reverberation of sound and all that sort of stuff. Easy...? Apparently, the word "easy" is not what I know. I''ve heard rumors about your brother for a long time. They say that he is "unemployed" and yet he can use skills and magic for some reason. As they say, even though he is "unemployed", the eight imperial generals couldn''t do anything about it. According to him, even though he was unemployed, he rode into the imperial palace by himself and beat up Her Majesty and left. To be honest, I thought, "No, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no. Apparently, I was wrong. This person is bad. ''''It''s too late now, but why are demons dying on their own just now...?'''' Because I''m cutting them up. "How do you slay a demon from about 50 meters away?You don''t have a sword, after all, do you? "A true swordsman can slay his enemies without a sword. I don''t know what it means at all. As we were going through this exchange, suddenly a huge hole appeared in front of us. The road was completely cut off and it must have been nearly two hundred meters to the other side. We couldn''t see how far down the hole was, as it was completely dark. ''''I can''t go on like this...'''' As expected, even this uncommon brother of mine didn''t seem to understand that there was such a big hole in the ground. When I was somewhat relieved Hmm?Let''s move on. Saying that, he jumped straight for the hole. .........What? ''Hey, what are you doing? Are you stupid? Are you trying to die? If you''re going to die, don''t let someone else die with you, die alone! I realized that after cursing so much in my mind. There was no sign of falling at all. ''And flying...? So you can use flight magic........ If that''s the case, please tell me........your life span has been reduced....... Eventually, the boat landed on the other side of the river as if nothing had happened. After that, my brother continued to traverse the various levels of the river at a terrific pace. ''''Take a right here, then the third corner to the left, and then go straight ahead for about a hundred meters, and if you take the narrow passage on the right, you''ll find the stairs beyond. ''So how do you know that...'' In fact, it was. It was five hundred meters away. Or rather, it''s obvious that my accuracy is improving. It''s no longer a "clairvoyant" skill, is it? No, that may be an exaggeration indeed. After all, the clairvoyant skill is a skill that can be used by the illusory ninja gods and bandit gods. ''''Clairvoyant?'''' Yes. I''ve heard that he can see a thousand miles ahead. ''Heh, I didn''t know you had such a useful skill. I''d love to learn it. I''m going to... Normally, I would have laughed at the ridiculousness of it. But I''m afraid that this guy would really do it. 142-Episode 14 You are going straight ''Take a right here, then a left at the third corner, and then go straight ahead for about a hundred meters, then take the narrow passage on your right, and you''ll find the stairs at the end of it. Each time I stepped through the labyrinth, I was able to see pretty far ahead. The accuracy in reading the intentions of the creator has also improved, and thanks to that, it is possible to break through each level in a few minutes. ''''It''s no longer a ''clairvoyant'' skill.......'''' Clairvoyant? I ask back, curious about Heera''s mutterings. ''''Ha, yes. What''s more, they can see a thousand miles away.'''' ''Heh, I didn''t know you had such a useful skill. I''d love to learn it. Currently, I am able to detect places that I can''t see with my eyes because of things like magic power, air flow, and sound echoes. Although each has its own advantages and disadvantages, the ability to ignore obstacles along the way and sense distant beings is still largely due to the magic power. Regardless of whether it is inorganic or organic, everything emits magical power, and all of its vibrations are unique to it. The current range is only a few hundred meters, but if they can improve their ability to sense magic power, they may be able to grasp it a thousand miles away. ''''Hmm, we''ve come a long way. Be that as it may, we had already dived down to the forty levels, which as far as we knew was the record for the highest ever reached. From this level, the demons became even more powerful and the traps became more and more troublesome. Many troublesome traps were also becoming more and more troublesome. For example, there are doors that can only be opened by defeating special monsters placed at various levels, and you have to go back and forth to the next level. Thanks to this, it took me nearly twice as long as before, but once I reached the 50th level, such tricks were gone. The number of traps also decreased. However, on the other hand, the demons became more vicious. They didn''t just get stronger. The number of demons that use troublesome magic and special attacks has increased, and they attack in organized groups like an army, or take advantage of the structure of the dungeon to attack, so it''s not a simple matter. ''Well, we''ll just crush them from the front. You''re on the straight and narrow... When I got to the fifty-seventh level, I encountered an oddity. ''The demon is dead?'' For some reason, the corpses of demons had fallen all over the passage. From the looks of it, it didn''t look like much time had passed yet. In the first place, demons that died in the dungeon would be absorbed by the dungeon and disappear after a few hours or so, so it''s not strange that the corpses are fresh. ........if this is a shallow layer. The shallow layers are filled with people who challenge the dungeons, so the corpses of demons killed by them can be found lying all over the place. Basically, it''s because you only get the materials you need and leave the parts you don''t need. However, after passing the 20th level, such corpses were rarely seen. This is because there are almost no people diving that deep. "But do you mean to say that there were other people besides us who came this deep...? From the looks of it, it doesn''t look like a human did it. A close examination of the bodies revealed that they were all cruel. They were torn to shreds by what looked like fangs or claws, and some of them seemed to have been bitten off. With a human opponent, it would indeed not be a corpse like this. Eventually, when I went out into a large room, I came across the true nature of the mutation that was happening on this level. ''''Hee.'''' Heera let out a twitching voice. What was in the great hall were the corpses of countless demons. Their number lightly exceeded fifty bodies, and the smell of blood was pervasive. And on top of the pile of corpses that were piling up. ''''Monkeys?'''' There was a mysterious creature. It was probably about the size of a human child or goblin. It had four limbs, a curled back, and a small head. In terms of silhouette, it''s close to a monkey. However, it wears an aura of evil darkness, and the body is not clearly visible. It was as if a shadow had been condensed into a single entity. It seemed to be fearlessly devouring the corpses of the demons lying at its feet. As soon as it thought it had easily torn off the red troll''s thick arm, it bit him vigorously. Is the sound of rivulets sounding because it is chewing the whole bone? ''''Nah, what is this........'''' Heera moaned with a shiver. Then a mysterious monkey heard her voice and turned to me. ''''Kishaaaaah!'''' Immediately afterwards, he leapt at a terrific speed. There was once an entity known as the Demon King. He was feared by all creatures as a disaster that would bring destruction to the world. But for some unknown reason, the Demon King was defeated by the warriors whom the humans called "heroes. The humans called him "Hero". But the Demon King was not completely destroyed. He divided his body and soul into several categories and stored them in different parts of the world. One of them was me. Because I had divided my body and soul into smaller pieces so that those abominable heroes would not find me, some of them might have lost the battle for survival or been lost in a tragic accident. But I was fortunate enough to survive. Even more fortunate was the discovery of this dungeon. There was a never-ending supply of food here. No matter how much food I ate, new ones would be born from the dungeon. And the deeper you go, the livelier food you will find. If it can become my blood, my sustenance, then these guys will love it. Of course, they have resisted the bait, trying not to be eaten so easily. There have been a few close calls, but I''ve been lucky. My body is now more powerful than that of a dragon. Although my body is still far more fragile than it once was, I''m sure I''ll be able to regain my strength in the not too distant future. Oh, and it''s delicious nonetheless. This muscular troll in particular is my favorite. I tear off its arm and bite into the bone. ''''What, what is this........'''' Then I heard a voice and I turned my gaze to it. Humans? There were two human beings there. Furthermore, I looked at one of them and marveled. What a delicious human being! At first glance, his physique looked slender, but his muscles were incredibly dense. On top of that, it was covered in immeasurably dense magical power. If I eat it, I''m sure I''ll be able to gain even more power. "Kishaaaaah! I was driven by an intense appetite, and I found myself throwing off the arm of the troll I had been devouring and pouncing on that human. Zang! ....What? Something about my vision splitting to the left and right.... My consciousness was cut off there. 143-Episode 15: Read the Air, Get the Air A mysterious creature jumped at me and I slashed at it. It was cut in half and slammed to the ground in a squishy manner. ''''Hm. What was that thing, this thing?'''' I checked the split corpse, but it was still a mysterious creature I hadn''t seen before, like an ape or a goblin. It must be a demon, at least in part. ''But the fact that demons were dying all over the place is probably the work of this guy. However, the demons that dwell in the dungeon coexist with each other and rarely kill each other. Maybe it''s an exotic demon. I''ve never seen a demon outside of a dungeon before. Eventually, we arrived at the 70th level. Hmm. It seems that this is the lowest level. How do you know that? ''There''s no space down here. That''s probably because the lower levels don''t exist. ''So how do you know that...'' The bottom level is not a maze like the past, and what awaits you after descending the stairs is just a long, straight passage. At the end of that passage, there is a huge door that is comparable to a city gate. ''''This can''t be........'''' Looks like there''s a dungeon boss up ahead. Well good luck with that. Where do you think you''re going? He grabbed Heera by the collar as she suddenly spun around. ''Because you don''t have to have me there! That''s right. You''ll have to wait here then. Maybe there will be no demons. There''s no way to know for sure. I walked closer to the door by myself. Then, for some reason, Heera came after me. ''''Ya, I''ll go with you after all I''m afraid to be alone in a place like this...'''' I don''t think there are any demons, do you? The lowest level is probably the only boss behind this door. However, I can''t say absolutely. ''''..........It has to be an absolute.......because in my case, if I had to fight even one demon in all likelihood, I would die for sure......'''' In the end, I ended up going with Heera. Goggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggoggogg.... The door opens on its own with a heavy thud, as if it recognizes us. As I duck through the gate, I say. ''Depending on the boss''s ability, it seems more likely that a stray bullet will hit you and kill you. Well, he says he''s going, so it''s no use. ''''Please tell me that soon! Gogogogog..... Wait a minute!Don''t close it yet! Heera tried to rush back in, but before she could, the door closed. He''s a slamming, noisy guy. It''s a vast space. At the end of a forest of pillars connecting the ten-meter high ceiling and floor, there was a throne. It''s been a long time since I''ve seen anyone come down here. It''s been a long time since anyone has come down here. Sitting comfortably on the throne was a brown-skinned old man. However, he was not a human. He had horns and wings, and parts of his body were covered with black scales. A demon? No, the dragonborn? You are the fourth, or is it the fifth?The last time it happened was five hundred years ago. I don''t remember it clearly. Hmm, I guess I''m not the first person to get this far. But no one has ever returned from here, unfortunately. Of course you have! Immediately afterwards, the old man''s body underwent a strange change. The scales that had only covered a part of his body until then spread out over his entire body, and his body swelled up even more. It seems that he is transformed. "''Divine Footsteps'' --Zhusha! "Huh? Heera and the old man''s voice came together. The old man''s head flew through the air and fell to the ground, rolling over and over. The rest of the old man''s body came to a halt, looking somewhere between a man and a dragon. ''''Wait, you were still in the process of transforming! No, don''t bother waiting for it to happen. You do have one!Read the air, read the air! Maybe it''s because of the high life force, or maybe it''s because it''s a live head, but it''s none of my business. I have to capture the dungeon as soon as possible and save Mira. I am Bahamut. An evil dragon that was sealed in this land for defying the gods. That seal was incredibly powerful. I tried to lift it several times, but I failed, so I have given up on it now. Hundreds, no, thousands of years must have passed. Frankly speaking, I''m bored and bored every day. It would be easier if I died, but unfortunately, I have the life force to live forever. And I have been prevented from committing suicide. What a horrible way to kill yourself. The only amusement is that every few hundred years, a conqueror comes to the lowest level of this place. This place seems to be a dungeon, and the people who reach this level are all fierce by human standards. To me, it''s like a child''s play, but it''s still a bit of a waste of time. While I was thinking about this, two people came up to me. But no one has ever returned from here," they said. And of course you have too! He says, intimidatingly, "I''m not going to kill you," but I''m not going to kill you. I''ve killed so much that I don''t enjoy it any more. Of course I will not send you home. I will make it my plaything for the rest of my days. But it doesn''t seem to be at all frightened by me. Now that I think about it, it has taken on human form. It''s been so long that I''ve forgotten about it. I quickly returned to my original form. Now, look at me and be afraid of me! "God''s Foot Street. Thud! ...Hmm? My vision started to spin around and around all of a sudden. And the ground.... Huh? Was I in fact beheaded? I didn''t expect someone like this. This could have been the most interesting fight I''ve had in a long time.... I mean, I don''t want to wait until I transform! He doesn''t know how to read the atmosphere! 144-Episode 16: There was Gachi When I broke the dungeon core at the back of the boss''s room, the entire dungeon began to shake greatly. It seemed to start collapsing as soon as possible. A shifting magic circle appeared at his feet. And my whole body was enveloped by the light that flooded out of it. I found myself outside the dungeon. The square where the entrance to the labyrinth was located was crowded with adventurers who would have been inside the dungeon by now. They all rolled their eyes, wondering what had happened. A huge earth-shaking sound of the dungeon collapsing could be heard from their feet. ''''Well, I don''t think the dungeon has been captured! ''Oh, my God!It''s one of the largest dungeons in the world that''s been around for hundreds of years! He finally managed to swallow the situation, but that caused more astonishment. Well, that''s not the point, it''s about Mira. I look desperately for my sister, who I''m sure is somewhere in the square. But I haven''t been able to find her. "No way, it''s already... "...General Kureha, it''s holly. "Huh!It''s so late.'' ''''Yes I''m sorry I was originally going to leave as soon as I got the target to leave, but due to unforeseen circumstances, I''ve been in the dungeon until now. A skill that can be used by ninja-type professions - telepathic communication - that allows them to keep in touch no matter how far away they are. It is a convenient ability to keep in touch no matter how far away you are, and the girls use it to get ahead of Arel. However, this had a weakness: it couldn''t be used in the dungeon. ''''Unexpected circumstances?'''' "Yes, sir. Actually, the target has forced me to go with him. Yeah. So, how much more time do you think you''ll have left? "I can''t do it anymore... "Why? ''''That''s because........I''ve conquered the dungeon.......'''' ''.................what? One of the world''s largest dungeons has existed since far back in ancient times. I hadn''t even expected to capture it in the first place. In fact, he had planned to use this place to stall for at least a month. ''''It''s only been five days since we went under, though? "Yes........five days..... How many layers were there? Seventy levels. ''And that''s all in five days?And on your first try?'' "Yes... ''What a joke ... anyway, we''ll have to do something about it. Lead me to my next destination. "I understand, sir! You''re not suggesting that I''ve already... Only the living can come back. In other words, if you have died in the dungeon, you can''t return. Despair fills my chest. And then. ''''Arel-san!'''' Heera rushed up to her in some kind of panic. There are two of her party members behind her. ''''Actually, the two of them have seen Mira-san,'''' Really? Oh, yeah, really. The female swordsman nodded. ''When and where did you see it?'' When I crowded in vigorously, the female swordsman said, "Huh? And with a surprise. Yesterday. He got back on his own from the dungeon. I''m relieved to hear that. We''ve been misplaced, but it looks like he''s okay. ''''So where are you now?'''' ''The thing is... oh, I told him about you, but he told me to just tell my brother that I''m alive...'' He seems to have just left town. ''Well....'' I guess I''m being avoided, after all. ''In case you''re wondering, I''ve only heard that you''re going south...'' And now we''re going south. Even though I''ve made it to the dungeon, I still couldn''t catch Mira here after all. But I won''t give up. I''ll find Mira if I have to. I thanked the three of them and left the city at once. It was not long before Arel conquered one of the largest dungeons in the world. Mira had come to a certain place by herself. ''''According to the information, there should be a city here, but...'''' As she muttered this, she stood in a wilderness that was nothing but dirt and rocks as far as the eye could see. They were on foot. She had been riding in a passenger carriage until halfway through the trip, but as expected, there were no flights to this area, so she had walked from the middle of the trip. The coachman said to me, "It''s dangerous for a child to go to that place by himself! He tried desperately to convince me again and again, but Mira would not listen. We continued on in the wilderness for a while, and eventually found a small tower that stood in the middle of the road. It''s not clear what it was built for, it''s a simple exterior without a shred of design. But Mira approaches the tower with a look of discovery on her face. At that time, men of less than sturdy appearance appeared one by one from behind the surrounding rocks. ''''Young lady~?It''s dangerous to come to this place alone.I wonder if they don''t know what this place is like~ One of them, a large, shaved-headed man, spoke to me in a purposeful catnip. The others grinned and sneered. ''Of course I know. I came knowingly. ...huh? Mila''s brusque reply made the shaved head lift the corners of his mouth in amusement. "So you''re ready for this, right? The men surrounded Mira. Some of them blatantly turned their gaze downward. ''''Hehehe, if you look closely, that''s quite an upper ball. Oh, come on, man, it''s only a kid, okay?You''re a pedophile. Shut up. I like it that way. I like to be half that age. "''There''s Gati........ In front of the men exchanging such an exchange, Mira ------ disappeared. ''''Huh?'''' 145-Episode 17: I will kill you next time The prison city of Gergeos. It used to be a gigantic prison where violent criminals were held. It was strictly controlled by armed guards, and was known as a prison that was absolutely impossible to escape from. In fact, the guards were proud of the fact that they had never forgiven an escape in the past. But one day, instigated by a single criminal, the prisoners all rioted en masse. After a fierce battle, the prisoners completely take over the prison. Since then, evil people from all over the world began to gather here. Most of them are the [Basic Position], the [Thieves] and their [Senior Position]. Many of them have committed crimes in some country and have fled. Fights, rape and murder are commonplace. There are several gangs in existence, and every night there is a violent conflict somewhere. Not a day goes by where people don''t die. It is in such an extremely dangerous place that Mila leaves home and sets her sights on. If a ten-year-old girl said she wanted to go there, everyone would do their best to stop her. In fact, before she could reach the entrance of the city, she was surrounded by men with bad faces. ''''What?'''' But they all let out a uniformly dumb voice. Because suddenly, the girl in front of them disappeared. And in the next moment, the man who was behind her fell to the ground. Noticing the sound, the men all turned around at once. Before they knew it, Mira, who had escaped their encirclement, was standing beside the fallen man. ''''Huh?'''' When did he move...? The men look away from the incomprehensible situation. As if to mock them, Mira disappears again. And when she appeared again, another man had fallen. ''In a manner of speaking, both of them have only pruned their consciousness. But I''ll kill you next time. The men finally rushed to set up their gains, but Mira told them nonchalantly to control them. The murderous atmosphere is very hard to imagine that of a ten year old girl. --The Assassination Princess. That was exactly the occupation given to Mira. Normally, it''s the Highest Position that can be reached only after passing through the Higher Position from the Basic Position, the Thief. His assassination skills were such that even if the opponent had found him once, he could completely erase any sign of himself. ''''~~~!'''' The men in the bad guy''s face hurriedly threw their gains on the ground. Apparently, they were intelligent enough to realize the difference in their abilities. Or is it animal intuition? I''m sorry. You''ll have to forgive me. We had to give it a try. In the midst of all this, one person came forward from among the men. His age was thirty or forty. He looked both young and old. He was slender and short, and had an air of being a lowlife. No one would pay any attention to him among these evil-looking men. But Mira soon realized. It''s a good idea to be able to have a good time with them. I''m the guardian of this gate, so to speak. I''m the guardian of this gate, so to speak, and I''ve been entrusted by the Patriarch with the task of finding out if he''s worthy of entering this city. Oh, I see. So you don''t mind if I come in? "You passed with flying colors. That''s quite an accomplishment for a man your age. You''re one of the best in the world. But what kind of city do you live in where talent is the only thing that matters?We''re kind of cute, aren''t we? This place is full of people with their heads screwed off. It''s going to be worse than death. Mira was unfazed by the middle-aged man''s unexpectedly kind threats. ''''I hope so. Otherwise, it would be impossible for you to get stronger in this short period of time.'' And so, he approached the door of the tower. Yes, this small tower is the entrance to the prison city. In order to prevent the prisoners from escaping, the prison was built underground. This tower is the only entrance to the city, and the walls and doors are all made of indestructible adamantite. The door seemed to be locked, but it was easy for Mira, who has the skill to open it, to open it. When I went through the door, I found myself in a narrow tower. The only thing that existed was a spiral staircase leading to the basement. Mira went down it without hesitation. Beyond that, there was a vast underground space that was large enough to completely contain a small city. It must not have been cleaned up since it was occupied by prisoners. Garbage was scattered here and there, and the stench stung. Mila couldn''t help but scowl. Most of the people on the street were men, and from the looks of it, few of them were decent. Even if they were there, they seemed to have a thing or two in their stomachs. I heard angry voices and turned my gaze to see a group of drunken men fighting - no, killing each other - with knives in their hands in the daytime. ''''Young lady, what are you doing here?'''' It''s not safe here, okay?We''ll get you to a safe place. One girl in such a situation would be very conspicuous, but within a minute there were those who approached me. Their ulterior motives are fully visible. ''''........Again?'''' Sighing, Mila lifts the corners of her mouth. ''I guess we can hone our skills quickly here, after all. The prison city of Gergeos. A city full of villains and the most unsafe city in the world. Conflict is the order of the day in this city. However, no one could have known that the arrival of a single girl would cause such an upheaval that it would upset that routine. 146-Episode 18: Im Not Suicidal Chasing after Mira, I headed west and east. I have now come to the magical land called the Forest of No Return. Many explorers challenge this forest because they can obtain a variety of valuable materials that cannot be obtained elsewhere. However, due to the dangerous demons that live here and the unique nature of this forest that disrupts one''s sense of direction, many of them never return. That''s why it was given such a mysterious name. ''''Don''t tell me it''s in that forest this time...? Just by looking at it from a distance, I could immediately see that the entire forest was covered in a dense magical power. It''s called a dungeon, how much does my sister love the danger zone? After canvassing the town closest to the forest, I obtained several testimonies of having seen someone who looked very similar to Mira. And one of them included that she had headed into the forest. ''I stopped her, of course. Why didn''t you ask? I wish I could have found Mira in the town, but I still couldn''t. I quickly headed into the forest. There was an open area near the entrance to the forest, where several tents were lined up. Apparently, this is the base camp for those who challenge this forest. There are also street vendors selling potions and armor. When I was about to enter the forest alone, I was approached by a group of four men and women. Hey, you. You are not going to enter this forest alone? Yeah, but, They nodded and they all started laughing in unison. ''''C''mon, you don''t know how dangerous this forest is, do you? "I''m throwing away my life trying to get into these woods solo. What do you mean? You don''t even have your armor on. You''re not suicidal by any chance, are you? He seems to be worried about me, albeit in a somewhat ridiculous tone. ''''It''s okay. This much is no different than a walk on the plains.'''' It reminds me of the Great Plains of Batuda, where the behemoths were. That place was also known as a demonic land, but it wasn''t that difficult to get to. The topographical difficulty would increase as it was a forest, but the strength of the demons wouldn''t be much different considering the density of magic power. They huddled their faces together and began to whisper. ''''I heard that........maybe you''re an amazingly powerful person?'''' I don''t think so. I mean you look weak by all accounts. Why don''t you check it out just to be sure? When the meeting was over, they resumed their posture. What do you do by the way? Unemployed. ""What?" There was no more time for useless exchanges. I turned my back on them in a daze and stepped into the forest. ''''Wait a minute!Seriously, I''m unemployed! The first demon will kill you! I mean, he''s not there! ''What?Where did you go...? He tried to follow, but I''d already gone a few dozen yards by then, and he seemed to have lost me. ''But then again, there are so many trees it''s hard to go on. "I''m making progress, cutting down the trees and grasses in front of me with the Divine Sky Slayer, but it''s piling up underneath my feet and I can''t walk very easily in the end. Shall we burn it? I decided that it would be more efficient to walk around if I burned it with magic. ''Inferno.'' Gooooooooooooooooooooooo! Tremendous flames erupted and the trees ahead of us instantly turned to ash. Okay, this is easier to walk on. ''Rainburst.'' To avoid the fire from spreading, we''ll make it rain so that the fire is completely extinguished. It''s not like my goal is to destroy this forest. And so, I proceeded to go deeper into the forest. "Gaaaaaaaah! Sometimes they would scream, but that was because there were tree-type demons, such as torrents, in their path. There are many beast-type demons in the forest, but they don''t attack us at all. It''s probably because they were afraid of the flames and ran away. I don''t know where Mira is, but for now, let''s head straight for the center of the forest. What the hell kind of speed is that thing? I think you''re actually quite good at this, don''t you? So you''re lying about being unemployed? Either way, why don''t you just let it go! They followed the mysterious young man into the forest and lost sight of the young man. They were adventurers. Their age was around twenty years old. They were still a fledgling group, but they had just arrived a few days ago to take on this forest known as the Devil''s Landing when they were promoted to the B rank. A few days before that, their confidence, which had been brimming with confidence due to the fact that things had been going so well up until then, had been shattered. Our elated first attack had been a stark reminder of the horror of this forest. The dense trees made it difficult to move, and more importantly, it was a tricky field that would distract you from your sense of direction. It''s a nasty field that makes it difficult to move in, and more importantly, it''s a nasty place to lose your sense of direction. You''ll also have to deal with the grotesque insect-type monsters, which will attack you from the trees. The grotesque insect-type demons were very distracting, especially to the women. Even so, the pride of being a B-ranked adventurer didn''t allow them to give up the challenge. And after reflecting on the past, they were about to try again, this time with renewed determination, when they encountered a young man who was about to enter this forest by himself. ''Whoa, that''s hot?'' Suddenly, a fierce hot wind blew in from ahead. Sweat gushed out from all over my body from the scorching heat, as if the sun had just fallen on me. ''''Oh, hey........what is this.......? The tree.... What they saw was a scene of a changed forest. The trees that should have been there had completely burned out, creating a path about three meters wide. ''''What happened...?'''' Look, look, there''s... One of his companions pointed ahead. The path of burn marks led for a hundred meters, and beyond that was the back of that young man. Then they witnessed. ''Inferno.'' Gooooooooooooooooooooooo! The sight of that young man burning down the trees of the forest in an instant. ''''Eeeeeeeeeeeeeeee!'''' 147-Episode 19: Youre a Victim You''ve come pretty deep into the woods. It took about an hour to advance, burning trees and demons. A long path of ashes had been created behind me. I made sure it was a straight line, so if there were people on this path, I would be able to see them. If we''re lucky, we might be able to spot Mira. As I was thinking about this, a person jumped out of the immediate area. Could it be Mira? Nuh-oh!What the hell is this? Not at all. He was an old man who looked nothing like Mira. And he''s huge. He''s probably over 190 in height. On top of that, he has a good physique. I don''t know why he was wearing short sleeves even though we were in the forest, so his well-developed arms were in full view. Still, it smells pretty bad........ With shaggy white hair and tattered clothes, he looks like a hobo. ''''Kid, could it be that you''ve done this? Yeah, but, "Ha-ha!You''re good!But I am no match for you.Doryaaaah! For some reason, the mysterious old man rivaled me and thrust his fist out with his cleaver spirit. Zgooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! Oh.... I couldn''t help but marvel at the sight. The trees in front of us were smashed into pieces of wood, creating a path that stretched for several meters. Perhaps he had converged his fighting qi into a fist and fired it along with a fist strike, but it was quite powerful. ''''You see that!Hahahaha! An old man with a dynamic laugh. He''s an oddball by all accounts, but maybe he''s looking at Mira. I asked him, just in case. ''My God, a child is lost!That''s a lot of work!I''ll help you find it too! He offered to help me, even though I didn''t ask for it. ''Don''t worry!I already know these woods inside and out!After all, we''ve been wandering around for six months already! I think you''re the one in trouble. ''Don''t be so sure!Hahahaha! It''s not a case of laughing. I mean, no wonder it stinks. I''m not sure how many things are wrong with the old man, but he can be an asset to the war effort. I''ve been using magic for an hour straight, even though I have plenty of magic power. It''s a good thing I''m not the only one who''s been in a position to do that. So, we made a road (?) and I followed behind him. ''Doryaaaah!Nooooooooo!Shut up! The old man pushed forward with an angry voice. Sometimes he would deviate from the straight line, so it took some fine tuning, but thanks to him I was able to conserve my strength and go deeper into the forest. And then. ''''Kishaaaaah!'''' Suddenly, a mysterious creature jumped out of the bushes. As it was, it bared its fangs and leapt at the old man. ''''Nuh-oh!Phew! The old man panicked for a moment, but as expected, he punched it away with his reaction. ''''Gah!'''' It screams as it crashes into the trunk of a tree. It''s about the size of a human child or goblin. It has four limbs, a curled back and a small head. And it wore something like an aura of darkness-- I mean, that''s... It looked familiar. The one we encountered in the lower levels of the dungeon. Is it the same kind of demon as that one? The mysterious demon attacked the old man again. The old man returned fire. ''''Hnu!'''' "Geez! Oh! Shh! Move it! "Pfft! He might be a bit stronger than the one I encountered in that dungeon. Still, the fight was even, or maybe the old man had a slight advantage. ''''Mwah!You''re running away! Deciding that it couldn''t win at this point, the demon suddenly turned on its heel and tried to flee. ''''I won''t let it.'''' Huh? If left unattended, Mira could be in danger, so I blocked the demon''s escape route. I take a heel-drop to the head and unleash my magic from my face to the ground. ''Inferno.'' Gah! A mysterious demon that echoed the voice of the demise while being consumed by the flames. It turned to ashes as it was. ''''Hahahaha!What a brilliant heel drop that was! The old man runs over to me happily. Just so you know, I''ve learned all the skills of the Sword Fist Fighter. But I can''t compare to an expert fighter like my grandfather. I thought that wizards were only poorly trained people, but there are others like you!Hahahaha! After that, the old man and I pushed on through the forest for several hours. I decided that we wouldn''t have come this deep into the forest, so I decided to turn back once. We made a clean straight line, so we didn''t have to worry about getting lost. ''Hm?Really?I thought I could defeat the Lord of the Forest with you. "Lord of the Forest? I felt like this old man had completely forgotten that I was looking for someone, but I was curious, so I asked him back. ''Hmm. As its name suggests, it''s a demon that rules this forest. According to one theory, it is a mythical -- nuh-uh? Suddenly, the old man falls down with an unnatural movement. I jumped down from the spot as quickly as I could, trying to ask him what the hell was going on. ''A branch?'' The thing that snatched my leg was what looked like a tree branch about ten inches thick. If you look closely, you can see it tangled in the old man''s leg. ''''Noooooooo!'''' The old man was being dragged by that branch deep into the forest. I chased after the old man while burning the branch that tried to get entangled again with red magic. And-- ......... We came to a slightly open area, which is unusual in this forest of dense trees, and there was a large tree that towered high like a tower. The width of the tree''s trunk would easily exceed ten meters. The monstrous large tree had a face made of a hollow. It was probably a kind of tree, but I couldn''t imagine how long it had been growing like this. This is probably the owner of the forest my grandfather had mentioned. 148-Episode 20 Dont destroy the forest too much "....I forgive you for your misfortune in the forest... A giant torrents of branches and leaves rustling and shaking. Apparently, he''s quite angry. And if you think about it, I''ve just destroyed the forest to the hilt. It''s only natural that the owner of the forest would be angry. "Whoa! The old man, who had been suspended in midair by a branch, was thrown into a cave in the trunk, and the cave closed. Then the cave closed. ''''Eaten...? I''ve heard that torrents catch and eat small animals and other animals that approach them. Perhaps he also has the ability to digest them like an insectivorous plant. If you don''t help him right away, the old man will melt away. ''''Death.... The giant Trent stretched out its branches and attacked me. I twisted my body to avoid the sharp branch, which was approaching like an arrow. The branch gouged deep into the ground. It''s quite powerful. There was more than one branch approaching. Countless branches were coming at me, one after another. Zubazbazbazbazbazbazbazbazbaz! He prevents it by slicing through the branches with his sword. But slashing and slashing doesn''t stop the storm of branches. If you look closely, you can see that the branch grew out from beside the slash and turned into a sharp spear again as it attacked. In addition, branches were popping up from the ground as well. No, it''s not a branch. This is a root. It''s not just a matter of time before you''ll be able to get your hands on a few dozens or even hundreds of branches that are uninterruptedly closing in from up and down and left and right, and as expected, your hands can''t keep up. "--Permafrost. The frigid cold air froze everything around them. Of course, branches and roots also froze and came to a complete halt. Furthermore, I put my maximum magic power to freeze that entire giant torrents as it was. The old man inside might freeze as well, but I wouldn''t have to worry about it for a short time. It looks strong. ''''Aaaaahhh.......'''' The giant Trent was suffering. But it began to shake its huge trunk at high speed. The rustling sound of leaves rubbing against each other hard could be heard. The branches and roots, which should have been frozen a moment ago, began to gradually regain their movement. I see, the friction generated heat. That''s clever, even for a tree. If that''s the case, burn it with fire magic - no, that would indeed kill the old man inside. Furthermore, the shaking of the branches and leaves caused something to fall to the ground from the top of the tree. They are nuts. A sweet smell wafts from them lying at your feet. It''s a nice smell. Somehow it calms me down and makes me feel sleepy.... '''' Quickly coming to myself, I took a huge leap back from the spot. After a moment''s delay, countless branches and roots pierced the spot I was in all at once. It was a close call. Those berries, they seem to be emitting a substance that makes me feel sleepy. I use my green magic to create a wind and try not to breathe in its scent. The fruit wasn''t the only thing that fell from the top of the tree. They are insect-type demons such as giant caterpillars and fungus. They attacked us all at once, perhaps to protect their homes. They kicked away the rolling caterpillars and swatted down the flying kamikillies with their swords, opening their large jaws. And with the fury of the resurrected branches and roots, it was impossible to even get close. At this rate, the old man will be digested. And then. Zdohhhh! Thud! Thud! An explosion that comes from nowhere. Trent begins to suffer. ''Oaaaaaah! As if the place where the old man was just eaten had been greatly enlivened. ''Doryaaaaaah!'' With a roar, the bark of the tree popped and an old man jumped out from inside. ''''That was a close call!Hahahaha! He''s still a hell of an old man to have escaped on his own. It''s just that his clothes seem to have dissolved in the digestive juices and he''s completely naked. I saw something I didn''t want to see..... Anyway, there was no need to add or subtract for the old man''s safety now. ''Explosions.'' "~~~~? An explosion with raging flames hit the giant torrent. Okay, as I thought, it''s only trees, and red magic seems to work. I was about to fire another series of Explosions when... Stop! A small shadow flew in front of me. It has transparent wings on its back, but it looks like a human child. ''''........A genie?'''' Apparently, she was a tree spirit living in this forest - a doliard. She has been in a symbiotic relationship with the giant Trent for a long time. ''''She''s also necessary for the order of the forest.... So please, don''t kill her...'''' He complains with tears in his eyes. When the old man heard this, he laughed as loudly as ever. "Ha-ha!That''s a bad thing to do!Then we must leave this place as soon as possible! He doesn''t mind at all that he was about to be eaten. By the way, he''s now hiding his crotch with the leaves that had fallen around it. ''''Thank you!And you''re... ''Well, that''s not why I''m here, and I don''t mind. But have you seen a human girl?About this tall and with hair like mine. ''Ummm ... haven''t you seen it?But wait a minute. I''ll ask the other kids.'' The wood spirit meditated for a while, as if communicating with something, but eventually snapped his eyelids open. ''I''m sorry. I asked the kids in Morinaka, but no one seems to have seen it. Are you sure? They say that Doriad is everywhere in this forest. If they haven''t seen them, does that mean Mira didn''t enter this forest in the first place? While tilting my head to see what was going on, I decided to go back the way I came with the old man, or rather, the path I had made. By the way, Doriade told me, ''Don''t destroy the forest too much...'' 149-Episode 21: You know the reaction I''m done with this one. "Ha-ha!Let''s meet again, young man! As he watched the young man leave, the huge old man - Humba - waved his hand in the air. His age has long since passed the 60 mark. But his body did not deteriorate and he still travelled around the world to train. ''But to meet such a young man, the world is still wide open!Hahaha! After reaching the Fist(God()", his strength had transcended the human dimension. Therefore, he trains exclusively with demons and nature. But even I realized in an instant that I couldn''t win against him. "But even I knew instantly that I was no match for him. Humba was in a good mood after meeting someone like that for the first time in decades. And for some reason, he felt a sense of familiarity with that young man. It wasn''t as if they had never met before. But I don''t remember meeting him at all. Come to think of it, is my grandson about that age now? He had an only daughter, and as far as he knew she had two children. It had been a decade, no, twenty years since I last saw him, and at the time, his second child had just been born. Her husband was opposed to the marriage, partly because he was a poor wizard. As a result, he has become estranged from his daughter and her family. It''s been a long time since I''ve seen you. You don''t remember me, do you? It suddenly felt like that, and Humba turned his steps in the direction of the town where his daughter and her family lived. But it was off by about fifty degrees. ''''........was it this way?No, this way?Mm, definitely!You should have headed to the other side of the sun! He said confidently, but unfortunately the misalignment had extended to ninety degrees. Although he didn''t realize it, Humba was severely directionally challenged. It would be a year before he could safely reach his daughter''s family. Hmm, it should be around here somewhere. It had been almost two months since I left the magical world of the forest of no return. I had come to the wilderness. There was no sign of a city at all, just a wasteland of rocks and dirt that stretched on and on. Could it really be in a place like this? The prison city of Gergeos. What I''m looking for is a city that is said to be the most unsafe in the world. Originally, it was said to have been a prison for incarcerating violent criminals, but it is said that the prisoners revolted and took over the prison. Initially, the surrounding cities cooperated in an attempt to retake the prison, but they all failed, and now it is said to be completely abandoned. Thanks to this, criminals who have escaped to this city can no longer be caught, and it is said that it has become a base for criminal organizations around the world. ''''........The dungeon and the demon world, I guess Mira has become a girl who loves danger zones after all......'''' Of course, we followed Mira''s footsteps to get there, but as an older brother, I couldn''t hide my confusion at my sister''s change. As we walked through the wilderness, we found a mysterious structure. It''s a small tower with a simple and nondescript appearance. But the fact that it is in the middle of such a wilderness makes me feel a strong sense of discomfort. At that moment, the multiple signs I had sensed earlier emerged from behind the rocky area where they had been hiding. They could be bandits or gangsters, but in any case, they were not hardy. ''Yo, brother. You know what this place is like? Yeah. I''ve heard of this place called the Jail City. Oh, yeah? It''s in the bottom of that tower. Downstairs? It''s a prison, remember? They built it in the basement to keep the prisoners in. I see. No wonder there is no city as far as I can see. So the entrance is here? I walked closer to the only door set up in the tower. But before I can, men surround me. "Unfortunately, this is not a place for people like you to enter. The only people allowed to enter this city are people like us who can''t live in the surface world. But it''s a different story if you''re doing business with the products. Okay. I ignore him and slip through and try to open the door. ''Nah,'' Hey, don''t ignore him! Several people came at him angrily and punched him, but he blew them away with a light wave of his arm, as if to chase away even a featherworm. ''''........What?'''' What the f*ck did this guy just do...? But they have to do something about this locked lock in order to open the door. Can someone lend me this key? ""Hi." When I lightly hit the fighters, some of them fell on their buttocks in place. Even those who weren''t began to shake their bodies in a shaky manner. ''''What the hell is this guy...?'''' How is that fair?That''s a big deal! In the midst of all this, a man in the back comes forward. A child would be scared to run away, but he looks like a civilian, or a lowly one, in the midst of these bad guys'' faces. But that''s just the way it looks. The fact that he didn''t move much even under my fighting spirit made me think that he must have gone through a certain amount of shura. ''What the hell do you want here?It doesn''t look like a person who has been involved in crime or a so-called "villainous profession" such as "bandits", "assassins" or "con artists". If it''s just out of curiosity, then get out of here. I''m looking for my sister. ...Sister? To the man who raises one eyebrow quizzically, I tell him. ''Have you ever heard of a girl named Mira?Ten years old and very pretty. Huh. For a moment, I didn''t miss the man''s shoulder bounce. ''That''s a reaction I know,'' Yeah, of course I know that. 150-Episode 22: Crying and sitting down Of course I know that. The man assured him unequivocally. ''Are you in this city now?'' Yeah, I''m here. It was about a week ago, I think. A girl of about ten years old came here by herself. I thought I had a pretty good product, so I immediately tried to capture her and take her to my base in the city. What... what? Well, don''t be angry but don''t worry, he''ll be fine. You will be. What do you mean? He got away with it in the middle. And he hasn''t passed through this door once since then. That means he''s still somewhere in this city. I need this key. ''I''m telling you,''They''re not going to let you into the city. ''Hmm, looks like we''re going to have to use force to get them to listen to us, huh? Ha, you can try if you can. The man snorts and sneers. ''We live in a world where violence is an everyday occurrence. Not a single one of your balls is going to make a sound at the slightest bit of torture. Five minutes later, the man was begging me with tears streaming down his face. ''Open........!I''ll open it!So stop this already.........! There isn''t a single scar on your body. That''s because I used my white magic to heal them. "As I thought, the white magic is very useful. I can hurt him without worrying about killing him, and I can do the same thing over and over again. Humans, when the pain goes beyond a certain point, they become numb and don''t feel pain anymore. But thanks to the white magic method, it can give you fresh pain every time. And no matter how much the wounds heal, the damage to the spirit will not heal. Shit.... With the shivering men''s minions in his wake, he let the door open. In doing so, they did not use a key. If you ask me, there is no key to this lock. That''s why you need to use your skill to get in and out. And as I was about to enter, it occurred to me that ''Yes. If Mira tries to leave the city, will you hold her back somehow? All of them were shaking their heads buzzing and shaking their heads. Just as I had expected, the inside of the city was terrible. First, the smell. This was due to the garbage scattered everywhere. No, not just trash, but vomit and what looks like filth, making the streets dirty. There were dirty men drinking and screaming in the daytime, and a man with completely irritated eyes, perhaps on drugs, screaming about something. In the distance, you can hear intense shouting and screaming, as if hostile organizations are fighting each other. In a slightly open area, dangerous drugs and weapons were being bought and sold in an imposing manner. ''''It''s a terrible city,'''' It''s not a good place for a girl to be. We have to find Mira as soon as possible. But the vast underground space is just like a dungeon. The structure was complex from the start to prevent escape, but the complexity of the prison must have been increased in the process of remodeling it into a residence. Moreover, since the additions and alterations are made in a disorderly fashion, there is no unified intention. Is this one locked up too? There were doors all over the city, many of which were locked. This was probably set up to prevent prisoners from escaping when it was a prison. There are also many doors that block the way to go, and thanks to this, the area to search is greatly reduced. We''ll just have to catch the people in the area and have them open the locks from one side to the other. I should have brought that man with me. Remembering the time when the man gutted the lock, I was inspired to give it a try. Luckily, a wire that had fallen nearby was wide, and I inserted it into the keyhole of the door in front of me. ''Like this?''Isn''t it? Like this?It won''t open. ... how''s that for you? I tried many things, but I couldn''t get it to work. But after a while of trial and error, it clicks. "It''s open. It''s a surprisingly easy thing to do, isn''t it? Now, we''ll see what happens next-- What the f*ck? The moment I opened the door, I was greeted with a horrendous shout. It was a small room with a latticed window, which was probably originally a cell, with an unobstructed view at the end, with only a toilet bowl on the floor. A sharp-eyed man with a bare ass crouched over the toilet, and it seemed that this was his residence. It seems that this is his residence. And he had just been doing his business. ''Excuse me,'' I quietly closed the door. I guess this was an outlier. I quickly moved on to the next door. After that, I kept looking for Mira as I opened the door, the city door. Occasionally I''d get into trouble with the residents beyond the door, but it was resolved through discussion (physics). ''Hey, you!You''re the one who''s been trolling our territory for a while now! Have some balls, man! Suddenly, a group of about twenty people come around me with a shout. You don''t look familiar, do you?What group are you new to? Who are you with? Hey, you''re a stray, mate. It seems that people who do not belong to any organization are called strays. We are the largest organization in this hierarchy, the Abyss Devils. We are the Abyss Devils, the largest organization in this hierarchy. I''ll be d*mned if I didn''t know. The guys who broke in here don''t mind me saying so, but I''m gonna make them pay for it. What do I mean by this hierarchy? I''m not sure, but if it''s a large organization, there''s probably a lot of information on it. Let''s ask them where Mira is. 151-Episode 23: Im still ten years old The members of the group known as the Abyss Devils are rolling and moaning all over the place. "This guy''s for real... This is a lot of stuff for one person, but there''s no way you''re gonna... I tried to ask them about Mira, but instead of answering me, they suddenly attacked me, so I did it back. I crouched down beside one of them and asked him again. ''I''m a girl who just turned ten,'' But she''s a little more mature, so she might look like she''s about twelve. Don''t you know? I don''t know... Are you sure? I don''t really know! It seems that he is not lying. I don''t know how big this Abyss Devils thing is, but it''s probably a lot more than that. If you ask them all, someone might know. And it looks like they''re coming to join the party just in time. ''What the hell is this?'' Hey, which gang did this to you? One of the fellows pointed towards me. ''Oh, he''s...'' What?You''re not going to tell me that that kid alone got you, are you? The new guys - about fifteen of them this time - are all staring at me at once. Next time I''ll ask them. I just want to know what happened to Mira, but they don''t answer me very quietly, and I end up having to fight again. Eventually I found myself lying on the ground with about a hundred people, surrounded by almost twice that number. But despite their overwhelming advantage in numbers, they were just wary and wouldn''t move. It''s a good idea to be on your guard. This bastard has no idea what he''s capable of. I mean, what the hell is this thing?Why the hell are you dealing with a knife flying at you from behind? Then the noise behind them seemed to increase, and part of the siege broke off. A man walks in from the other side of it. ''''Boss........'''' The boss is here... Hmm, this guy seems to be the boss of the organization known as "Abyss Devil". He has a skinned head and looks as if he''s going to stare his opponent down. He''s wearing a leather jacket, but the upper half of his body is covered in hideous tattoos. The skinhead looked around at the constituents lying around and a blue streak appeared on his forehead. ''Looks like you''ve had a good run in our territory, huh? ''Because I just wanted to ask you something and you didn''t listen to me and attacked me. What''s the story? Surprisingly, they''ve shown interest. Maybe they could talk a little more for what they look like. ''I''m looking for my sister. Her name is Mira, and she''s a ten-year-old girl, and she should be somewhere in this city. Mira? The skinhead''s cheeks twitched as he twitched. ''Are you the brother of that woman Mira?'' Yeah. What do you know about it? Yeah, I''m no stranger to that. Are you sure?Where are you? Shut the f*ck up and stay the f*ck away from me. The skinhead raised his hand in a killing motion to stop me, and he told me easily. ''A woman named Mira would have taken me to the lowest level of the city, man. The bottom line? What, you don''t know anything about that? Skinhead says the city has a hierarchical structure: upper level, middle level, lower level, and lowest level. When the city was a prison, the more serious criminals were housed in the lower levels of the city. And even today, the lower you go, the more dangerous people are under control of the prison. Compared to the middle and lower levels, we ''Abyss Devils'' are just a bunch of cute guys. When it comes to the lowest level, it''s unimaginable. The skinhead contorts his face. He said that the only people at the lowest level of the city were the city''s Patriarch and his entourage. ''''What do you mean by the Patriarch?'''' "The strongest and worst criminal and former death row inmate - and the man who once incited the prisoners to take this prison from the guards. I''ve never seen his face, but I''ve heard horrible stories about him. There are no rules in this city, but the Patriarch is the only one who can be crossed. I''ve been told that the entire organization will be wiped out, no matter what kind of vicious criminal organization it is. Hmm. So you''re the founder of this city, and you''re still at the top. I don''t know the details, but it''s rumored that he was discovered by someone in the high places. I don''t know the details, but it was rumored that he happened to meet her by chance. I don''t know how they treat her. The lowest level is a place that I can''t even set foot in, I felt strong indignation. ''What a pedophile!Sure, Mila is ridiculously cute, and she''s grown so tall and mature all at once lately that you could call her a beauty, but she''s still only ten years old! .... For some reason, the skinhead looks at me with half-lidded eyes. I can''t stay here. I have to save Mira from that pervert right away. But just as I''m about to thank him for the information and leave, the skinhead stands in front of me. "Wait. You, what are you doing? I know. I''m going to go to this Fhrer and get Mira back. I told you.You cross the line and you die. Why don''t you come work for me?It looks like I have more than enough firepower for a hundred of my minnows, and with you here, we''ll be a lot bigger. A skinhead solicits me. Of course the answer is no. ''Sorry, no.'' That''s a shame. If you''re going to be my guy, I''m going to consider it a servant''s quarrel, but... A moment later, the skinhead disappeared. Hmm, that''s a decent amount of speed. Moreover, he seems to be using his skill at the same time he moves, and if he were a normal person, I would have surely lost sight of him. But I could perfectly see the skinhead coming around behind me and sticking the knife out towards my back. I turn around and finger the knife. ''....nah? You mean an [assassin] in a [senior position]? But if you''re going to assassinate me, you shouldn''t have shown up in the first place. 152-If it is Episode 24, I will show you around The skinhead took me to a place that was said to lead to a lower level. In the center of the circular space was a small building with a door. ''This is it. No, it''s here. There''s a staircase inside that building that leads to the lower level.'' A skinhead with a completely different attitude tells me. ''Oh, right. Thank goodness. I thanked the skinhead and approached the building. But then I sensed a strong killing force and jumped back from the spot. Immediately after, a huge man fell from above my head. A huge battle axe was held in his hand, and the guillotine-like blade was swung down to the place where I was just a moment ago. ''''Oaah........kill.............'''' The giant man has an odd appearance with his entire body covered in bandages and is muttering mumbling things. ''''Hm, what does this mean?'''' I turn around and ask the skinhead. Then his attitude from earlier is gone, as he lifts up the corners of his mouth. ''''Kukku, that''s the gatekeeper to the middle class. He once slaughtered a hundred people in one night, and he''s going to kill anyone who doesn''t get past here, no questions asked. You want to get to the middle level, you''ll have to take him down. Well, I''ll just wish you well. That''s all I had to say, and then he quickly ran off. Hmm. Then I will do so. "Swoosh! The bandaged man swings his battle axe and attacks again. I didn''t have to duck. I caught the axe with one hand. ''''Huh?'''' I could see the bandage man gasp behind his bandages. He tried desperately to swing the axe away, but I didn''t freak out. I crushed the blade with just my grip and smashed the axe with all the force I could muster. ''''~~~~! He didn''t expect to be defeated by an opponent who was clearly smaller than he was by force, but even with his face bandaged, his astonishment was palpable. ''''Well, now it''s our turn. ''''~~~~? Surprisingly petulant, the bandaged man turned away and ran away in a hurry. ''Hey, you''re forgetting this,'' I throw the axe I took from its back and give it back to it. ''''Gugee!'''' The hilt hit the back of his head and the bandage man fell down. He seemed to have fainted and wouldn''t get up. Leaving the bandaged man alone, I approached the door. It seemed to be locked, too. I try to open the door with a wire. Hm, it''s an important door, but the lock is also very tight. Thanks to this, it took a little time, but I was still able to open the door in about five minutes. We went down the stairs that were beyond the door. ''So this is the middle level?'' The atmosphere in the middle level was similar to that of the upper level. However, the jail was much more solidly built, as it only housed more felons than the upper level. Then, there were torture devices that looked like they had been used for punishment in the past, or something like that, installed here and there. As I got closer and took a closer look at them, I found blood on them that seemed to be relatively recent, so maybe they are still in use today. ''''Hey, hey, you don''t look familiar. Are you a newcomer? Well, we''re gonna have to take good care of her. Then a group of five or six people approached. They may be middle-class residents, but as usual, they were not uptight by any stretch of the imagination. They were suddenly surrounding me, and it didn''t look like they were going to be friendly. ''''Hivugu?'''' Gah! So I use force to bring him to his knees. "Wow, I''m sorry........give me a break! I didn''t know he was this powerful... As soon as they knew they were no match for us, they immediately bowed their heads. The organization of the bad guys has a very strict hierarchy, so they may be more likely to follow those with power without condition. I don''t want to do anything about you guys. I don''t have a problem with you, but I want to know. How do I get to the lower levels? What, lower level...? You want to go downstairs? Yeah, yeah. Well, then I''ll show you where it is! Thankfully, he''s going to take me to the place. This room. "Hmm, can you get to the lower levels from here? I stepped into the room. Originally, it would have been a good size, but it felt cramped due to the large number of boxes that were piled up in the room. The best way to do this is to have a look at a few of these things and see if you can find out what they are. Probably this guy''s friends, and one by one, those with weapons appear from behind the box. Well, I knew it by the signs. It seems that we are not the kind of people who surrender to others so easily. You''ll regret picking a fight with the Red Scarf! They all leap at once. Instead of each of them moving apart, they attacked me while working well together. Even now, one of them is throwing multiple knives to keep my attention, while another one is aiming for an opening in my blind spot. However, that''s not enough to take me down. You''ll be able to grab the knife with one hand without looking at it, while reversing your body and kicking the man who was slashing at you from behind. ''''This guy, does he have his eyes behind his back or something? "Don''t get upset!There''s more help coming!Keep attacking without a break! Apparently, more support is coming. 153-Episode 25: Do you feel like making a hole in the floor? When I came to the middle level, I was fighting against members of the martial bandits based here - the Red Scarf. Since they are bad guys, they also use unorthodox attacks. For example, smoke balls. The fist-sized ball that was thrown at my feet, as soon as it hit the ground, it spat out a fierce smoke. It spreads in the blink of an eye and tries to take away my vision. And it''s not just smoke, it seems. ''Phew!That''s toxic smoke!Inhale, and in a matter of seconds your whole body goes numb. What did you say? What? I was behind the man who threw that smoke screen. ''If we move faster than the smoke spreads, we won''t have to worry about being consumed by it. Gubey. I hit him lightly and knocked him out. ''Keh, out of the smoke!'' When did this happen? They thought I was in the smoke, and were wary of covering their mouths with a cloth to prevent them from inhaling the poison, when they noticed the sound of the current beating and turned to me in unison. And at that time, I felt something strange in my leg. ''''.......what is this?'''' I tried to get my feet up, but they were stuck to the ground and wouldn''t leave. ''It took!I put some strong glue on it beforehand!So much adhesion that not even a large demon can escape!You''ll never move again! I tried my best to pull it off. Bock!Boom! ""~~~~!" Hmm, that sure is a hell of a bond. The floor itself is falling off. Bullshit. What leg strength! It''s a little hard to move, but it''s well within the margin of error. I''m going to dive straight into the enemy camp. "Gubey! "Yikes! It''s a monster. When the number of fallen humans exceeded a hundred, the support finally ceased. There are signs of a few hiding around, so I put them away just in case. Honestly, we don''t know what they''re going to do to us. It''s better to be vigilant. "Well, shall we get instructions on how to get to the lower levels? Apparently, it was a place that was once used as an execution site. It was like a little square, with a crucifix for crucifixion set up in the center of it. Back in the days when it was a prison, horrible punishments were carried out here, such as feeding the bodies of thugs to demons and burning them at the stake. ''''So how do you get to the lower levels?'''' I''ll ask the leader of the Red Scarf, who led me here. A man of the "Great Thief", with a mouth split open like a snake and a deep scar that runs the length of his right eye. "I don''t know. The snake man spat. ''It''s not that I don''t want to tell you,'' said the snake man. It''s just a fact. We middle class people ain''t taught how to get to the lower levels. Okay. Then why did you bring him here? That''s because this place is big enough for a middle-class crowd. This is a pattern again. You really do breathe out lies, these city people. People are gathering in the square one after another. It seems that even organizations other than the Red Scarf have called for support. "Hee-haw!I''m here! "''Hi-ha!'' Here comes the Dragon and Break!Yoroshiku (Yoroshiku) ugh! "''Night dewy death torment! Some of them were on dangerous drugs or something, and there was a group of people with mohawk heads and regent heads that were screaming at each other. I don''t know what it is, but they''re the kind of people who seem to show up even after the world ends once. ''''Hyahhhh!.........not, hahahahaha! The snake man must have gotten caught, because it seems he laughed the wrong way, and then went to the trouble of laughing again, and then We usually don''t like each other, but if we let them do whatever they want in the middle ground, this prison city will go down the tubes. So you''ve put the pride of the city before the pride of the organization. It''s indeed a pain in the ass to deal with all of these guys. They don''t seem to know how to get to the lower levels - if that''s true - and if you can''t get it out of them even if you defeat them, there''s no point in doing so. ''''Well it can''t be helped. Just so you know, it''s a city, so I tried not to destroy it too much, but... I strained my upper body. My muscles swelled up and the jacket I was wearing popped off. ''''What?'''' Go ahead. Then he swung his fist down to the ground. Zugong! With the sound of the explosion, a radiating crack runs around it. And another one. Zugong! Then I slammed my fists into the ground one after another. Zgozgozgozgozgozgozgozgozgozgozgozgozgozgozgozgo! The floor shook violently, the cracks widened further, and then a cloud of dust flew up. ''''Nah, nah........'''' The hundreds of people who had gathered in the square were stunned. They were unable to stand properly due to the shaking of the ground, and without exception, they fell to the spot. ''''Hey, wait a minute!What are you doing!What are you doing?! "The leader of the Red Scarf shouted as he gasped. ''As you can see, we''re going to the lower levels. Are you trying to make a hole in the floor?Nonsense!You can''t do that!I mean, or, I mean, my body is sinking! The ground had caved in, and already all I could see from the outside was my head. Eventually the sound of the beating changed, and finally a hole opened up and led to the other side. It widened that hole further, making it big enough for each of us to get through. ''So that''s what we''ll do then,'' With a light wave to the stunned mid-level dwellers, I jumped into the hole. 154-Episode 26 Youre already here What awaited me when I landed on the lower level was a labyrinth of dim light, unlike the previous levels, where there was almost no light. The pathways have become more complicated and even traps have been set up, perhaps to prevent escape. Moreover, the traps seem to be functioning properly. Do people really live in such a place? According to the snake man, there are only two organizations that use this lower level as their base. The first is a global group of assassins. It seems that their main customers are the royalty and aristocracy of various countries, and it is said that history has been changed by their power more than once. The second is the Black Market Association, which controls the world''s black market. Whether it is true or not, it is said that they control every possible underground economy in the world. These two organizations are both under the direct control of the City Patriarch. Hmmm, what kind of person is this Viceroy? At that moment, I felt a faint killing spirit, and I immediately interrupted my thoughts and turned my consciousness outward. Immediately after, there was a figure jumping at me from behind a pillar. I avoided the knife that was thrust out and took its arm. ''''Huh!'''' Yeah. He twisted his arm and threw it away while using his opponent''s momentum. The figure was momentarily white eyed as it slammed into the ground, but without a moment of pain, it immediately tried to fight back with its free hand. Its arm was equipped with a claw-like armor. ''''It''s useless.'''' Huh! Before I do, I''ll stomp on your arm and seal it off. Still, he''s quite skilled at it. He''s used to controlling pain, and he''s not afraid to kill. I couldn''t get through to him, but he was also very good at hiding his killing intent and presence. Probably an assassin. And I don''t think there was only one attacker. Since they descended to this level in such a flashy way, they would surely be wary of me and attack me as a group. Moreover, they are good at cutting off the signs, have the advantage of the ground, and yet this darkness. ........it''s a pain in the ass. My goal is to get Mira out of here. I''m not here to fight assassins. I kicked the ground. I use green magic to create a tailwind and run at breakneck speed, using green magic to create a tailwind. No one should be able to keep up with this speed. ''''Huh?'''' Sure enough, there were signs of breathlessness coming from everywhere as I passed by. By the way, I''m running with the person who attacked me earlier. The iron fetters made with yellow magic are attached to his hands and feet, so he can''t move. ''''~~~~! His mouth is also sealed with an iron mask so that he can''t scream. ''Well, are we safe here?'' Having succeeded in scattering the assassins, I hunkered down in a private toilet cubicle. I rolled the assassins I had brought with me to the side of the toilet bowl and took off my iron mask. ''There''s no point in trying to scream. I''ll crush your throat before you do. "~~~! The hapless assassin''s shoulders bounce as he is hit by my killing intent. No matter how much training I''ve done, it''s hard to completely suppress my fear. ''It''s not that I''m trying to take your life. I''m just asking you to show me how to get to the lowest level. I ask him, but I don''t expect him to answer. Torturing him won''t make him talk so easily. Do I use mesmerizing magic? No, it probably won''t work against an assassin of this class. It has to be something more powerful. "Inslaive. It''s a subjugation spell. Those who are made subordinate by this are forced to obey my orders as their master. It''s a rough job of binding the opponent''s body and mind with magic, so even if you cancel it later on, there''s a possibility that there will be aftereffects. So I didn''t want to use it against humans too much, but it can''t be helped. ''''Tell me. How can I get to the lowest level? The assassin shook his head from side to side, trembling. ''''Wow, I don''t know. I haven''t been taught. Maybe the boss would know, but... This is the pattern again. Well, it was to be expected. The lowest level is said to have only the Patriarch and his entourage. And one of their entourage is the head of a group of assassins, who sometimes appears at their hideout in the lower levels. ''''Then take me to that hideout. Okay, okay.... He left the bathroom. Then he led me to a place that was once used as an accommodation compartment for the guards. It''s only natural that they would find us if we came too close. However, although I''ve been sensing signs of surveillance for a while now, they haven''t attacked me. Is it a trap, or have they realized that it''s useless to fight? When you enter a room that looks like a cafeteria, a man is waiting for you there. ''Welcome. You look like you''ve had a rough time of it. He is a man with narrow eyes, a long face, and a medium build. At first glance, he gives the impression of being a gentleman, but the guy here can''t be the person he seems to be. ''''Boss........'''' The enslaved assassin quivers his lip beside me. ''I see, so you''re the boss. So you must know how to get to the lowest level, where the Fhrer is. ''Yes, of course I know. Whether or not I teach it is another matter. ''Well, worst case scenario, I don''t mind if they don''t tell me. Because then you''ll just punch another hole in the ground. I made a motion to hit the ground. If this guy was the boss, he''d at least know how I got down to the lower levels. ''No, no, that''s not good. It''s made of special building materials and it''s hard to repair.'' Then get this Fhrer out of here. Ha, don''t worry, the Lord Commander is already here. What? That''s when it finally dawned on me. That before I knew it, there was some kind of thin thread wrapped around my limbs. Immediately after, I was being fished upside down on the spot. 155-Episode 27: How to catch Something like a thin thread is wrapped around the limb, and it is fished up into the air as if it were fished out of it. Apparently the thread is made of a special material and is sturdy. But since it''s so thin, I should be able to at least tear it off. Thinking that, I put some strength into my arms and legs, and the thread didn''t break easily, but bit into the flesh. .........Hmmm, it seems to be a fairly strong, yet well-cut thread. "Don''t think you''re going to force your way out. You don''t want to lose the ends of your limbs. A small figure approaches. It was a very small old woman. I wondered if she was bent at the waist, but her back was straight and tight. She seems to be simply short in stature from the start. The footsteps are not at the level of solid.... but rather, they are seamless and excellent. It was clear from the signs that he was no ordinary man. "No way, you... Yes. Yes, I am the governor of this city you have been looking for. That''s me. This old lady with a p*n*s? But when he thought about it, it was decades ago that this prison was taken away from him by prisoners. The leader of the prisoners at that time could have been an old man of that caliber. As expected, it is completely unexpected that it was an old woman and not an old man. By the way, this cockiness looks just like someone else''s. It doesn''t seem to have shrunk with age, so it must have been small to begin with. The old woman with the dickhead, right?Click, click, click. The old woman suddenly starts laughing. But her eyes aren''t smiling at all. The Yuu-man from earlier moans with a very pale face, ''''Two of the Sohyo''s complexes at the same time.......'''' ''''Who''s the dickless old lady, you little shit!For all intents and purposes, she''s a nice buddy beautiful witch! Huh! Suddenly, he yells at me incredibly loudly. At the same time, the thread holding me tightly tightens, and my flesh is plucked and blood begins to flow out. Repair by the blessing occurs, but the thread is still tight, so my flesh breaks again. I mean, what''s a beautiful witch? I am the master of your life now. Watch your words, will you? The old lady is threatening me with a terrific killing spree. Hmm, it''s just as expected of the ruler of this city. This mysterious thread is also controlled by the old lady. If you look closely, you can see the magic power flowing from the old lady running through the thread. You can''t tear it off with force. If that''s the case-- Zubazbazbazbazbazbaz! I cut the thread. But I didn''t swing my sword. This is because when you''re around my age, you don''t need to swing your sword to release a slash. I free myself from the string and land on the ground. The old woman''s wrinkled mouth says, "What? It was open in the shape of a ''Oh, my lord, what did you just do?Is it magic? No, I just cut it up. Did you cut it?What do you mean? It means he didn''t use his sword to unleash the slash. .... The old lady gives me a probing look. You may be trying to figure out if it''s true or a lie, but I didn''t tell a lie. I''m sure you''ll be able to find out what''s going on. It''s just as I heard. Grandma, Mira-- You''re not going to call me Miss Smith! ''''Miss, you know Mira, don''t you?Where are you now? I had no choice but to call the old lady Miss and ask her about Mira. Since I had assumed that the Patriarch was a man, I feared for Mira''s chastity, but when it comes to the old lady, the situation is a little different. From the way he was talking now, I had a feeling that he wasn''t being treated badly somehow. I''m afraid I can''t teach you for free. I''m afraid I can''t tell you that for free, but I think we''ll play tag now. A game of tag? The rule is simple. If you catch me in the act of escaping, you win. I''m going to tell you where my sister is. Is that what you want? Hey, don''t lick me, or you''ll get hurt.Then let''s get started. A moment later, I kicked the ground and closed the distance between me and the old lady at once. The old lady wasn''t able to react. From the position of my center of gravity, there''s no point in trying to escape now. ''I got him.'' Shame. What? Just when I thought I had him, the old woman suddenly disappeared. ''This way, this way.'' When did this happen? And then, thirty meters away, there is an old woman. Was it an afterimage that had been here a while ago? No, there was definitely a feel to it when I touched it. There was no substance to the afterimage. But the old woman thirty meters away looks real, too. Even if she were to move in an instant, it should be impossible for her to slip through my arms. What the hell does that mean? As I was confused, I heard an old lady''s voice from behind me. ''There''s another one over here?'' What? I turned around and saw an old lady there too. ''There are two of them, you say?'' No, no, no, there''s one of us. Three? Where are you looking? There''s another one. Four?No, five, six.... There were more and more old women. And each one of them looked like the real thing. "This is the ultimate skill I possess - my alter ego! Shadow selves? This is not an afterimage. This is not an afterimage, for it can create a definite body that will never disappear. In addition, it has the exact same appearance and powers as my body. In other words, everything is identical to the real thing. It''s impossible to tell them apart. Incidentally, it''s possible to create up to ten of them at once. How are you going to catch it? As expected, I was almost at a loss for words. 156-Episode 28 is exactly like your brother Hey, boy, over here. Sorry. The real one''s this way. No, that''s a lie. The real thing is this way. But actually, you''re over here! Just when you think you''ve caught it, the old lady disappears. I just keep repeating that over and over again from earlier. The old lady''s petty lines and face are nerve-wracking to me. I want to punch her in that face. ''But it''s a nasty skill,'' Unlike the Afterimage skill, the Altered Image skill creates an entity. You can produce or erase it whenever you want, and it was completely indistinguishable from the main body. There''s no doubt that there''s a main body somewhere, but if we can''t distinguish it from the main body, then we''ll have to capture it in a very small way. Judging that, I ignored the old ladies who were mocking me for a while. I ignored the old ladies who were laughing at me and began to search the vicinity. But I couldn''t find them. "Now, then, it''s a waste of time! You wouldn''t find that in any other place. Shame. See you next week. Either they''re so completely out of sight that even I can''t find them, or those alter egos are controlling them from a remote location. If it''s the latter, I''m completely screwed. .... wait? I suddenly had a question. Can it really be possible to create an alter ego with that much performance without limit? Isn''t there some kind of restriction? What I''m worried about is that the moment I catch it, its alter ego immediately disappears. Why is it necessary to erase it? If you use your alter ego to restrain me or attack me, you should be able to buy that much time. Maybe that''s exactly what the "alter ego" skill has to do with its limitations. Well, it''s possible that he''s simply having fun pretending to be someone else, but.... It''s worth a try. I interrupted my search for the mainframe and pounced on the nearest alter ego. "That''s a shame, I''ll have to share... Thud! Before the old lady disappeared, the slash I fired slashed through her. ''''Gyaaah!'''' The next moment, the old ladies screamed in unison. I nodded, satisfied with their appearance. ''''I see. So you mean that the alter egos are sharing the sense of pain with each other? ........No, no. Are you saying that there are no alter egos in the first place and everything is the same as the main body? When you think about it, it explains a lot of things. There is no distinction between the main body and the alter ego, those things are all the main body. So if even one of them is damaged, all of the old lady''s blessings will decrease. The blessings are shared, and they don''t increase in proportion to the number of alter egos you have. "I was apparently deceived by the name of the skill called ''alter ego''. Master, you cut the old man down without hesitation! I thought you didn''t like being treated like an old lady? Now, let''s get Mira out of here as we agreed. I glare at the old lady. ''Kakka, Mira isn''t here anymore. She''s back at her parents'' house. To your parents'' house? Yes. You said you were done running away from home. .... If that''s true, it''s a relief, but it doesn''t add up. What in the world was Mira moving from place to place for? Well, if you feel better after traveling, that''s fine, but something is stuck. ''What was Mira like?'' He was an excellent apprentice. I, the God of Assassination, personally taught him the art of assassination, and he absorbed everything I taught him in a flash. I didn''t expect him to catch up with me in just six months. There''s no one he can''t kill now. Wait a minute. Assassination?Six months?What are you talking about? It was six months ago that Mila left home. She must have come here much later. "Okay, okay, you''re sure?Six months ago, he suddenly appeared in this city, just like your current master, and was running amok in the upper levels. According to him, he thought he could learn the skills of assassination in the shortest possible time by coming here. If that''s the case, then who was it that I was chasing? No, come to think of it, I didn''t see Mira. The only thing I was after was information about Mira. What if it was all a lie? ...The old woman-- Miss Mira, what in the world does she do for a living? She is the assassin princess. I don''t know what is happening to him now, but at least that is what he was given when he was blessed. At that moment, he thought to himself. This is the one I can kill," he said. Can you kill it?Who the hell are you........me? But if that''s the case, why did you go to your parents'' house? We''ll have a better chance of success if we wait in this city. "Well, you are a very slow learner, aren''t you? You are completely unaware of your sister''s true intentions. It''s true that one day she may turn her back on you, but for now it''s someone other than you. Besides me who else? Dad or Mom? ...You don''t think so, Laina? That''s a long time to be away for a guy who''s only been here six months. Mira murmured quietly as she looked at the exterior of her parents'' home, which she was used to living in. The past six months had been the most intense time in her life. As soon as she received her blessing, she left her home and went to the prison city by herself. There, in what is said to be the world''s most unsafe city, she spent her time training bloodily in order to master the vocation she was given. And-- I''m sure we can get him now. Completely oblivious, Mira sneaks into the house through the bathroom window. It''s late at night when everyone is asleep, but you can never be too careful. Mira''s mother, in particular, has unusually keen senses. Even if she was asleep, an ordinary thief would be able to detect the intrusion at the same time. It wouldn''t be an exaggeration to say that most of her training in the prison city was to acquire a level of covert skills that even her mother couldn''t notice. Furthermore, there are now mythical grade demons living there as well. Perhaps because of their powerful power, they are less cautious, and they would be less likely to be noticed, but even so, they should never be underestimated. Mira continued down the hallway and took the stairs to the second floor. She passed her parents'' bedroom and then her brother''s room at the back. Carefully she opened the door and crept inside. Then, sleeping on my beloved brother''s bed was a woman with red hair - Laina. She doesn''t seem to notice Mira''s intrusion and seems to be sleeping soundly. But Mira never let her guard down and approached the side of the bed. Then she enters the pause. The current Mira would be at a distance where she could finish off her opponent while he was asleep. ''''Huh?'''' And, as expected, she was nervous, and it was only when she got here that she realized that there was more than one sleep on the bed. In the arms of Laina, who was sleeping on her side. There were two little lives being held there. A baby. A boy and a girl, too. They were sleeping close together, seemingly close to each other. They both have hair color similar to Laina''s, especially the girl one, who looks just like her, even her face. And the boy one. You look just like your brother. 157-Episode 29: Its absolutely useless I hurried back to my parents'' house. I flew through the night and it was already morning. I''m exhausted, but more than that, anxiety drives me on. ''Laina!'' He kicked the door open with a mighty kick and ran into the front door. Then he ran into the living room. ''''Are you okay?'''' My mother and father were eating a leisurely meal there. It was the usual peaceful morning scene. ''Arelle-chan?'' You''re back. But there was no sign of Laina. "Rah, where''s Laina? Laina... And that''s when Laina comes into the living room with a mix of absent-mindedness. ''Laina!You''re safe! Oh, Arel? I ran to her side and tried to hug her with all the momentum I had, and then I realized something. Laina was holding the baby. And two of them. She was still asleep and looking sleepy. ''Um ... where''s the baby from?'' Your baby, of course. What? I cringed at those words, which were said with a dumbfounded look on my face. My child...? You mean, me and Laina''s kid...? ''Of course. You wouldn''t be holding someone else''s child. Twins, by the way. A boy and a girl. Upon closer inspection, I saw that they both had the same red hair as Laina. The boy looks a lot like me when he was little. The girl looks just like Laina. It was six months ago that I left town to chase after Mila. Generally speaking, a child was born about five months after conception. ''''Totally, it''s an unfit father to even be present at the birth. Laina was smiling somewhat happily, even though she said it accusingly. The girl is still out of it, but the boy seems to be waking up and looks at me with a strange look on his face. ''This is your father,'' As I tell her that, Laina tries to hand the boy over to me. ''Can I hold him?'' ''You''re a father, of course it''s good. But you must be nice to him. Oh, yeah. I took the baby with trepidation. It was so small and light that it looked like it was going to break. He showed no signs of crying, even though he was suddenly in the arms of a stranger. Does he understand that I am the father? Uh-oh. But all of a sudden, he scowled. She stretches her arms toward her mother, as if she wants to get away from me. She doesn''t seem to like it. Maybe it''s my first time, so I can''t blame her, but I''m a bit shocked. But then Laina wrinkles her brow as she moves her nose toward me. You stink. You should''ve given her a bath before you let me hold her. Apparently, the reason the boys didn''t like it was because my body smelled bad. I could certainly smell it myself and it smelled like sweat. I handed the twins back to Laina and I decided to take a bath. ''But what the hell was that, what was the rush earlier?'' No, I hope you''re okay. I mean, yeah. What about Mira? ''I''m sure Mira would still be sleeping in her room. You''re home, aren''t you? Yeah. Was it the day before yesterday?I was home before I knew it in the morning. I patted my chest. That old lady tricked me. No, I was right up to the information that Mira had gone home to her parents. Maybe she thought it would be irksome to just tell me. She''s a totally inedible old woman. When I came out of the bath, the girl was fully awake. Laina hugged her and said, "It''s your father," but she looked puzzled. ........cute. Boys are cute too, but girls are even cuter. It''s probably because they look like Laina. She''s been properly bathed and cleaned up, and she shouldn''t smell. I tried to get the girl to let me hold her. ''Uhhhh!'' But as soon as it was about to be handed to me, the girl started crying loudly. Clinging to her mother. ''Gah!'' I''m in for a much bigger shock than I was earlier. I don''t even smell weird now. So it''s pure rejection. In contrast to my depressed state, Laina chuckles. Don''t worry about it so much. This one is a little shy. She''ll get used to it. She''ll let you hold her. Alright, that''s it, don''t worry. He''s not a scary old man. Agggh. Dad came over from the side and said proudly. ''Haha, Arel is your father and he doesn''t like you. Dad will let you hold him properly. Come to Jieji. With a sickening smile, Dad extends his arm to his grandson. ''Ya!'' It was rejected easily. ''''Gah... why... why... you let me hold you yesterday...'''' Dad crumbles to the ground. ''Oh, dear. "You''re in the wrong place at the wrong time, Dad. I want my mom now. Huh?And you don''t mind your grandmother?Oh dear. The mother receives her granddaughter with an unusually happy look on her face. She must be used to dealing with children, having given birth to three children and raised them. ''Bah.'' Yeah, yeah, yeah, it''s me. The girls seemed to miss it completely. ''Speaking of which, what about the boys?'' ''I''ll be in the garden with Mila. She likes to be outside for some reason. Mom tells me. I look out the window and see Mila sitting on a bench in the yard, holding a boy in her arms. And she is patting the boy''s head somewhat lovingly. ''At any rate, Mira looks fine too,'' I''m still not sure why I left the house after all, but I''m back safely, so I guess that''s good. After that, we had to decide on the twins'' names. Apparently, it was decided to wait until after I got back. Hm, how about Kiki and Lara then? ''I don''t know why, but I have a feeling that''s an absolute no-no...'' 158-Episode 30: The earlier the better Hey! Buhhhh? The orc screams as it takes a sharp slash at its huge body. ''''Huaiavoor!'''' ''Pgaaaaah! The orc was burned by the flames that flew by without a moment''s notice, and the orc died with a scream of despair. ''''You did it...?'''' I got it. I told you.He said he could take down an orc already. I said laboriously as I approached the two of them, who looked down at the burnt orc in amazement and caught their breath. ''Yeah!Daddy was right! The one who looks back at me is my daughter with a cute, innocent smile - Leila. As if the rejection when I first met her was a lie, she is now completely attached to me and hugs my legs tightly. ".......... On the other hand, it is my son - Ark - who does not raise his voice and rejoice like Layla does, but quietly exhales a breath of relief. Unlike Layla, he was a mature child, or rather a child who did not show much emotion. Five years had passed since then. The twins, who were babies then, have grown up quickly and energetically, and now they are fully capable of using swords and magic, and although it takes two of them, they are able to defeat at least an orc. This is the result of my daily training of swords and magic since they were about a year old when they started to walk. When I get home, I tell Laina with confidence that my education was not wrong. No, no, no, no, no. Orcs are dangerous!They''re five years old! For some reason, I was pissed off. ''We took it down without a hitch, though, right? That''s not the point. You''re almost halfway to your blessing.It''s a bit early to start training, isn''t it? Typically, it is rare to learn swords and magic at an early age. Most of the time, it was only after receiving the blessing and learning the skills. When it comes to magic in particular, it was believed that only a wizard lineage profession could use it in the first place. Well, that was a big mistake. I had a theory. "The sooner you train, the better. That''s what it''s called. From my experience of learning swords and magic without skills, I''m convinced of that. Because of my mother, I only took a small bite out of the sword from a young age, but I didn''t start training in earnest until I was ten years old. If I had started earlier, I''m sure I would have been able to master it in a much shorter time. ''''I don''t know what kind of profession the two of you will get, but I''m sure your current training will definitely help you in the future. That said, though... Laina looks worried. Perhaps sensing this, Leila is Mom, I don''t have a heartbeat.Leila, I love to ''kunks'' with my dad. ''If Leila says so...'' Yes! Really, Leila is a good girl. I patted her head, okay, and she laughed happily and said, "Ehehehe. Leila, I want to be better! Well said. So you''re going to be the next Wyvern. "Hey! Laina''s shouting sounded. After that I continued to train them both. And after another three years had passed. Hm, you two have worked so hard to get this far. The two of you now are far stronger than you were when your father was around your age. I''ve made him learn swords, magic, and even bandit-type skills, all in one place. He''s only eight years old, so his physical abilities are not encouraging in some respects, but in terms of skills, he''s closing in on me when I was twenty years old. ''''Really!Yes! Well, that''s what you get for all that. The two have a contrasting reaction. Layla is genuinely happy and Ark lets out a tired sigh. Their attitudes were contrasting even in their normal training. Layla would take on any challenge without fear, but Ark''s impression was that he had no choice because Layla would do it. ''''But there''s still something missing between the two of you. What''s missing...? Is that...? I told them, as they looked at me with a mysterious look on their faces. ''Experience,'' The two of them have always trained in and around this rural town. However, the demons that appear are all of a similar kind. They are so used to the nearby river and forest that they can now call it their own garden. I don''t have much experience in competitive battles. Of course, I''ve fought against me, we''ve fought together, and I''ve had Befi and the others take me on (though not people), but fighting the same people all the time is going to bias your experience. ''''Therefore, I''m going to embark on a practical training journey now. Journey!Yes! Oh, Leila''s eyes lit up with joy, and even the normally calm Ark looked happy. ''We''re going to go to dungeons, to the demon world, and probably train harder than ever before. Yay! Up. To Leila, who was still pleased as ever, Ark twisted his face in disgust. So, the good is in a hurry. I have to tell Leila about this as soon as possible and get ready for the trip. The Pazan Holy Kingdom, which had the best history and tradition on the continent. It was just around the time when Arel had announced to the twins that he was going on a practical training trip to that royal palace. ''''Your Majesty!They''ve identified a demon race in the west! ''''I see........ If that''s the case, then the Demon King is still back....... A man of fifty sitting on the throne let out a deep sigh when he received the report of his subordinates. He was the king of this country, Liocour-Pazan-Palmeria. ''''But, Your Majesty, we were also preparing for this moment by gathering new candidates for heroes from all over the country. I''m sure they will defeat the Demon King. Hmm, yeah. After nodding at the words of the minister who was standing beside him, Riocour announced. ''All right, we will call them here at once. 159-Episode 31: Mama is an Adult, but Cant Fly? Dad, this is great!I''m running! "A ship on land... Leila screams with a glint in her eye and Ark rolls his eyes. The ship carrying us is running at breakneck speed on land. "Can we call it a land ship? I made this thing using alchemy, and although it''s a ship, it has wheels like a cart on the bottom of the ship. It''s just a matter of time before the wheels are moved by magic and the ship is able to run on land. ''''You''ve made another strange thing...'''' It is Laina who says with a dumbfounded look on her face, "I''ve been making these magical things for a while now. Lately, I''ve been addicted to making these magical things, and my house, which I just built, was already nearly filled with all sorts of creations. ''Because Laina insists on going with you,'' I wouldn''t want to leave you two to your own devices!In fact, why were you trying to make me the outcast? Because I can''t fly. That''s rather funny that you can fly, even though you have no job! We can fly, too.Huh? ''Yes!Leila and Ark can fly!You''re an adult and you can''t fly? Leila asked, and Laina told her, wrinkling her brow. ''Leila, okay?Normally, even adults can''t fly, you know. Grandpa and grandma can''t fly either, can they? Oh, really? It''s so easy to do. Huh... totally, I''m having a hard time with my dad''s gifted education... Laina lets out a sigh for some reason. I was actually going to go with just me and the kids, but Laina, who can''t fly, said she was going to accompany me, so I made this ride in a hurry. But if it doesn''t, we''ll get wet when it rains. Shall we put a retractable roof on it? ...do what you want. Nevertheless, there are many aspects that can be helped by the presence of Laina. Especially the food. I can do the bare minimum, but to be honest, the food Laina makes is many times better than the food she makes. By the way, we''re heading to the city of swords. If we go there, we''ll be able to give the two of them enough experience in fighting against each other. Just then Ark, who was looking ahead, shouted out. ''''Dad, front, front!'''' Hmm? When I looked in the direction Ark was pointing, I saw a group of people running towards us. It''s not like they''re running. It''s a desperate look. ''''Are we being attacked? Chasing them was a pack of wolves. Apparently, they were running away. ''A ship!Why on land! I don''t give a f*ck, but you need to get out of here! He is surprised to see us on the boat. ''Hey, what are we going to do?We''re going to run into them if we don''t? I''m going straight in. Are you trying to pull them off? Laina screams, but I keep moving forward, not slowing down. And then I fly. ''''Huh?'''' As Laina, Ark, and Leila gasped, the ship flew through the air and over the heads of the fleeing people. It jumped over them and landed on the ground, this time plunging into a pack of wolves. ''''Wah-oh!'''' This ship was created by alchemy and was of considerable weight. It slammed into the ship at high speed, and the wolves were blown away. After reaping the wolves in one motion, he brought the ship to a halt. ''Hmm, looks like it''s not just any wolf. The wolves were staggering and trying to get up on two legs. ''''It''s a demon called a werewolf. ''''Gruaaaah!'''' He leaps at us in anger. ''Kudos ... let''s do it! Wait. What the hell? Laina stood up as she drew her sword, but I tugged on her ponytail. ''What the hell are you doing?!'' ''I''ll leave this to you two. I''ve never fought a demon before, so it will be a good experience. I''m in charge!Ark, let''s go! Okay, all right. Leila cheerfully runs into a pack of werewolves. The werewolves pounce on the human children and other human children as if they were just a bite with their prized fangs. "You''re too late! Huh? Leila easily ducked her fangs and jumped over the top of the werewolf''s head, and a flash. Blood splatter danced from his neck and the werewolf died as it was. ''''Gulp!'''' The other werewolves shouted in surprise, but by then she had already fleshed out into another unity. ''Well,'' Gah? The second body also crumbles to the ground. ''''Grrrr........'''' The werewolves, who are said to be more intelligent than wolves, probably understood that the other party is not just a child, so they are wary and retreating back. ''''.........Hey, it looked like Leila just used the ''Shrinkage''? That''s right. A contraction, to be exact. ''What are you teaching an eight year old...'' It''s not just the sword. Leila was just about to activate her magic. ''Explosions.'' A blast of fire engulfed the werewolves. ''''See?'''' .... For some reason, some of the barely surviving werewolves were trying to escape while Laina was half-eyed. ''''Oh, wait a minute!Well..... As they fled in disparate directions, Leila was unsure which one to chase first. Countless ice arrows flew over her head. ''''Gawd! GANG! Aon! It stabbed at the fleeing werewolf, and this time, he finished it off. ''Ark!'' As usual, you''re a bit of a tightwad, Leila. Ugh! Leila stepped on the ground drumstick in frustration. 160-Episode 32: Ill Cure You Immediately The escaped werewolf was annihilated by the blue magic Ark unleashed. ''''I thought you must have trained quite a bit since it was you... but isn''t that too much as expected?'''' Really? It''s clear from the fight we''re having now that we''re not quite ready to pack it in yet. I almost let him get away with it. But Ark followed up well, so it''s probably a fair point. Leila, who is proactive in everything, is the type that rushes forward and makes many mistakes, while Ark is passive but calm and collected, and his judgment of the situation is accurate. Together, they could be considered a good combination. Layla and Ark are coming back. Leila looks a little frustrated. And then the people who were running away earlier came in. ''''Ta, we were saved. ''''I never thought I''d be able to take down that many werewolves...'''' ''It looked to me like a kid knocked it over... no, it can''t be that way, can it? But what is this ship...? We heard that they had been attacked by a pack of werewolves during their wagon ride. I heard that they escaped while their guards were fighting for them, but just as they were about to catch up with us, we passed by. When we returned to that carriage, we found several people lying wounded amidst several dead bodies of werewolves lying around. ''''Ugh...'''' Hey, some of them are still alive! But with this wound... Oh, God, that hurts! Leila, who was interested in everything, moved closer and scowled. ''Oh, come on, little girl, you shouldn''t be looking at that. We''ll get you well soon! What? Leila used her recovery magic. I taught her to be able to heal her wounds on her own, even if she lost her healing blessing. This might be the first time I''ve actually used it against someone. ''''Hey, I''m healed...?'''' Don''t tell me you can do white magic, little girl...? But you''re not old enough to get the blessing yet...? Apparently it worked. Then she would heal the other survivors, but Ugh, he''s not waking up. I fixed him up. ''It''s not your fault, little girl. If she''s dead, you can''t bring her back to life. No, not really. Dad! I crouch down beside a man who''s already out of it. ''You haven''t been dead long. I can bring you back to life. Bringing him back from the dead is not possible. Well, look. A bright light flashed. And when it subsided, my heart, which should have stopped, began to beat. ''''Oh, what the hell am I...?'''' He wakes up and looks around curiously. Apparently, he has succeeded. ''Nah ... stupid ...'' You don''t think he''s really come back to life? If I had to name it, I would say it''s a resurrection spell. It is a magic that brings back the soul that has once left the body and fuses it with the body again. It''s not just the theory of black magic that will turn you into an undead person no matter how hard you try, but by applying the theory of white magic to it, we''ve made it possible to completely revive you. However, if he was separated from his body for too long, his soul would mutate, and even if he was revived, his personality would go awry. This time it worked because it hadn''t been long since he died. ''Dad, that''s awesome!'' Leila hugs me tightly. ''Good, good, Leila''s always so cute,'' Heh. Then I managed to bring them all back to life. However, as for the horse that was bitten to death by a werewolf, I had no choice but to give up. Unlike humans, animal souls mutate quickly, so even if I brought them back to life, they wouldn''t be able to pull the carriage back to normal. ''''By the way, where was this group headed?'''' The City of Swords. To take refuge there... The City of Swords? Apparently the same destination as us. But what do you mean by "evacuate"? Didn''t you know that?Rumor has it that the Demon King is back... Demon King? ''''Ha, yes. I heard that several countries and cities have already fallen into the hands of the Demon King in the west, and the demons have become violent in this area recently as well. So many people are trying to emigrate, thinking it will be safer if they go to the Sword City... That''s the first I''ve heard of it. It''s a frontier town, so it must be slow to get the word out. Anyway, it''s the Demon King. If it''s true that he''s resurrected, it''s a big deal. It was a dark time when the human world was threatened by the Demon King, who was said to have been summoned to this world by an evil god, and the demon tribes under his command. Until the demon king was defeated by seven heroes chosen by the goddess, many countries and cities were destroyed and many humans were killed. However, there are various theories. This is because the story is hundreds of years old and the lore differs in many ways. I''m sure you''ll be just fine if you say your destination is the city of swords. "Anyway, if your destination is the City of Swords, that''s just fine," he said, "why don''t we take our ship and pull it out? ''What?How is that possible? Yeah. Four of them.... No problem. The four carriages that had lost their horses were linked together in a single vertical line. Then I hooked up the harnesses to the boats. ''Okay, we''re all aboard, right?Then we''re off. It was quite heavy because it was pulling a carriage with nearly thirty people in all, but it still accelerated slowly. ''''Ho, it''s really moving! What''s on that ship? You don''t think it''s a mythical, magical ship! No, I built the boat. Your normal is not normal. Laina looked dumbfounded. 161-Episode 33: Those guys are taking care of themselves The City of Swords came into view in the distance. But something is wrong. I use white magic to temporarily increase my eyesight to check it out. ''''The gates have been destroyed?'''' The massive gates, left open during the day, were now closed, but there was a large hole in the middle of them. Normally, travelers and merchants would be frequenting the gate, but there was no sign of them at all. On the other hand, there were demons prowling around the gate. In addition to werewolves, orcs and minotaurs are all beast-type demons. And the one who seems to be leading such demons is a tiger demon with a large battle axe in his hand - no, that could be a demon race. They are a type of demon race called the so-called beastmen. There are many theories about the boundary between demons and demonkind, but in general, the existence that has the same intelligence as humans and has the ability to speak is called demonkind. From this definition, werewolves and orcs are demons, not demons. But the humanoid tiger chewing out a bored-looking absent-mindedness in front of the gate was clearly intelligent. ''''There might be a demon race here,'''' What?Then, really.... The demon tribe that was once under the rule of the Demon King had been reduced to the verge of extinction due to the battle against the Seven Heroes, and now they were said to be living in the frontier. If the demon tribe had appeared, the resurrection of the demon king might be a certainty after all. Once I stopped the ship, I informed the refugees of the situation. ''''Oh no!'''' Don''t tell me that the City of Swords was dropped by the Demon King...? So where are we going to run to? I can''t just go running into them with their dismay, but I can''t just leave them here. Once we make a U-turn and head into the nearby forest. ''''We''ll go check out the city. I''ll put up a cloaking ward so you won''t have to worry about being attacked by demons. Okay, I understand. Laina will take care of their protection here. Wait a minute. You''re taking two people? Of course you do, though? There are (maybe) demons as well as demons for good measure. There''s a lot to learn when fighting an intelligent opponent. ''''Then take me with you.'''' No, Laina can''t do "covert", can she?As expected, they''re not going to do something like that to suddenly get in front of you. You can use Ark and Leila, right? I can use it, Dad! Ugh.... Leaving Laina, who could only make gurgling sounds, I approached the city wall with Ark and Leila. Flying through the sky to the top of the wall. And this is also not something Laina can do. You can see the city from the top of the high walls. ''''Hmm, it looks like we''re in quite a difficult situation. The city was riddled with demons with their own faces. Looking at the broken houses and roads, it can be seen that this was after a big battle. Some houses are still smoldering with smoke, and it seems that not much time has passed. The sounds of shouting and sword fights can be heard in the distance. Maybe they are still fighting. For now, I''m going to head that way, but there are demons flying around in the sky above the city. Stealth" while flying in the sky is a bit difficult. It would be better to move on the ground. The center of the battle was familiar to me. It used to be the headquarters of my adventurer''s guild, Dragonfang. The building is almost like a fortress, protected by thick walls comparable to the walls of a small town. It was now surrounded by many demons. ''''Cease your futile resistance, you foolish humans!That''ll keep you alive for a while! It''s the gorilla beastmen who are making the loudest noise. Apparently, they are currently holed up in there to continue their resistance. A swordsman on top of the defensive wall was cutting down the demon that was trying to enter the interior. He did not seem to listen to the words of the beastmen. ''''Utterly, humans are truly incomprehensible creatures. As soon as you think you can''t resist when your fellow man is taken hostage, you continue your apparently meaningless resistance without a second thought,'''' The gorilla beastman cowered his muscled, raised shoulders as he did so, and approached the barriers himself. And then. ''Woo-hoo-hoo-hoo! With a terrific yell, he slams his stiff arm against the wall. Zgoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! The walls shattered. ''''What?'''' You''re an idiot!You smashed the defensive wall with your fist? f*cking monsters! The swordsmen who were guarding the defensive walls peeled their eyes and shouted. But as soon as they regained their attention, they all slashed at the Gorilla Beast Man at once. ''''Futile, futile, futile! ""Gah!" However, when the gorilla beastmen swung their arms around, that was enough to blow a few swordsmen away collectively. On the other hand, even if their swords were lucky enough to reach them, their armor-like muscles would be bounced off of them and no damage would be able to pass through at all. ''''This is really a human warrior!Too vulnerable!It''s too sad that such a creature rules the earth with its own face!After all, it is our demon race that deserves to be the ruler of this world! ...This is the demon race.... Incredible strength... Hmm, I''ve heard of them, but those are the demons. It''s more than I thought-- Then, with a yank, Leila tugged at the sleeve of my dress. "Hey, Dad," she said. "Hey, Dad, are they taking it easy on you?I don''t think that gorilla is that strong.... Yeah, I think your father would agree. 162-Episode 34: A red stranger with a little acquaintance ''''Oh, there''s no way we can beat a monster like that... at least if we had a guild leader...'''' "Don''t give up!We have a bunch of A-level swordsmen over here!And then there''s Mistress Lilia...Where is Mistress Lilia? ''Really?Before you know it, Mistress Lilia will be gone! The swordsmen were dismayed when the demon tribe destroyed part of their defenses. Then I felt a presence behind me and I turned around. Zuzu Zuzu........ I was hiding in an alleyway with Ark and Leila, and one of the stone floors in the corner was slowly moving. Eventually, a hole opens up enough for one person to pass through, and then a hand comes out of it wet. ''''Huh, it''s a good thing I prepared a loophole for this to happen. I don''t have time to fight that monster. And the one who emerged was a familiar blonde woman. ''''...What are you doing, Lilia?'''' ''What the hell?And Mr. Arrell!Don''t let me scare you!I thought a demon had found you! If you look closely, you can see that it is dirty with mud and other things on it, and it smells a little bad. Leila asked as she picked her nose. ''Daddy, who is this lady?'' I''m not your aunt! Hey, dumbass, shut up, or they''ll see you. Ha! Lilia presses her mouth down in a hurry. I tell Ark and Leila. ''We''re just strangers who know each other a bit. Terrible!I mean, those kids who look like their parents so insanely, are they two kids, maybe? Yeah. It sounds like you''re in a lot more trouble than that. Yeah, that''s right! ''It seems to be mostly occupied by demons, how could it be so easy?Hypothetically, it would be the City of Swords, right? Well, actually, you know what? Lilia said that it was only a few days ago that the demon race and the demons they led blamed this city. Naturally, the swordsmen of this city fought back. And they had the upper hand at first. However, the battle situation changed when the demons used a sneaky move to take the powerless civilians hostage. Many swordsmen threw away their swords and were captured by the enemy. ''I see,'' To begin with, even though the city of swords is a city of swords, the normal inhabitants are much more numerous. It''s a difficult thing to fight while sheltering those who can''t fight. ''''My father got caught with it too...'''' ''Right. Then why did Lilia keep resisting? ''What?Because I''m not going to be the one who gets caught because of people who can''t fight. Apparently, "I don''t care about hostages! It seems that he had incited some swordsmen to holed up in the guild''s headquarters. He''s still the same guy. ''''........'''' Ark and Leila are looking at Lilia with half-lidded eyes. ''And since it was about to be dropped, he used a loophole to sneak away by himself,'' ''''Because if such a beautiful woman is caught, the last thing she''ll be doing is being used as a consolation prize for all those perverted demons in heat, right? Just ten years earlier, woman. I''m not your aunt! I told you to be quiet. At that time, the swordsmen''s voices could be heard from the headquarters. ''''Don''t tell me Miss Lilia has escaped alone...'''' It can''t be, can it?You''re the one who just moments ago was inspiring us to fight together until the end.You''re right, he''s not that bad of a character... no, it''s possible... ''Well maybe it''s because I''m still not married after thirty and I''m getting more and more twisted...'' It was a horrible thing to say. Well, it wasn''t wrong. ''Oh, t-t-la-la! Lilia shivered, her cheeks twitching. Then, no matter what she thought, she just ran out of the alley. ''''Miss Lilia!?'''' You didn''t get away! ''Of course!She''s not such a cowardly, vile woman trying to sneak away alone and use a loophole to make her escape!As a swordsman, I am determined to fight to the very end! Apparently, she is aware that she is a cowardly and vile woman. ''Mistress Lilia........'' But then why are you in that place...? ''Phew!Listen to me and be amazed!In fact, we''ve brought in the strongest helpers we can get to overturn this situation! Lilia declared confidently. I thought it would be interesting if she sneaked off like this, but as expected, I decided not to. ''''Come on, Arel-san!Let''s take out the demon race in a heartbeat! I knew it was coming. I sigh and emerge from the alley. ''''What, Arel? No way. Um...? ''''You''re that Arel who was unemployed, yet once won the Sword God''s Cup at only fifteen years old! It must have been more than ten years since then, but apparently there was someone who remembered me. ''''I don''t mean to say I remember you, but it''s a legend, and if you''re from this city, there''s no one you don''t know. Is that so? "Yes. By the way, I''m supposed to be your ex-girlfriend (heart). I gave her a light belly pan. Lilia writhing in agony in a kuja. ''You hit that Miss Lilia flat out! That''s heroic Arrell! I don''t know why I was so impressed. ''The best helper?How can a human be a match for our demon race? The gorilla beastman looks at me with a small, mocking laugh. Then he ordered the demon that seemed to be under his control. ''''Crush that one.'''' 163-Episode 35: How about your older sister? ""Woo hoo!" It was Bad Kong, the great monkey demon, who leapt at him with such a cry. ''Too late.'' " " "? I cut off its head as I squeezed through the three giant monkeys. All at once, the giant body collapses. The gorilla beastman has a stunned look on his face. ''''Wha........you, what in the world did you do? Hmm, you couldn''t see that level of slashing? It''s not so bad after all. Good. Ark, Leila, you''ll be in charge of that gorilla. I''ll take care of the surrounding demons. Yeah, okay! Yes. It was Lilia who protested this. ''''Wait, what are you thinking?How could you let a child who hasn''t even been blessed yet fight a demon?Are you going to kill my child? And the swordsmen who were listening in on the conversation. What, you''re gonna send a kid like that into a fight? Don''t you realize how powerful that demon race is? On the other hand, the one with a blue streak on his forehead is a gorilla beastman. Those brats, they will crush you with one finger! Hmm, I''m afraid that''s a tall order, gorilla. What?Oh, when did this happen? Layla was already in between the gorilla beastmen. Even though she had lost some of her presence of mind, she''s still not a great gorilla to allow them to get that close so easily. But it''s impossible for a helpless human child''s sword to injure my body-- Thud! Gah! Blood splatter danced from the gorilla beast man as he was slashed by Layla. As expected, it seems to be reasonably sturdy, and it''s not fatal. ''''You!'''' The gorilla beastman swings his arms around in anger. But there''s no technique or tactics, it''s just a child''s fight-like attack. Leila sees through it completely and ducks without danger. ''Mr. Gorilla, Mr. Gorilla, are you sure it''s all Leila?'' What did you say? That means I''m here too. What? The gorilla beastman''s eyes widened at the voice that fell from above his head. Ark was on his shoulder. ''''Yup.'''' Bushuuuuuuuuu! ''''~~~~~~~~~! A great rain of blood fell. The gorilla beastman, whose neck was cut off, fell to the ground unconscious as it was. ''''Well, he defeated the demon race........'''' It''s really just two kids... I can''t believe... Oh, hey, look. It''s a monster! What? When did this happen? While the two of them were fighting the demon race, I was wiping out the demons around here as I had declared. ''''Dad, I beat them!'''' I saw that. Good job. But I thought demons were a bit stronger than that. Yeah, that was weak! It was an easy opponent for Ark and Leila right now. ''''That was weak...'''' Seriously.... Lilia approaches me with a smiling face. ''''As expected of Arel-san and Laina''s children!By the way, that boy, Ark, is his name again?How about an older sister or something? ''Put your hand on your chest and remember your age. Huh. Hmm?What''s going on? No, no, I feel like there was a huge murderous atmosphere coming from somewhere right now...? For some reason, Lilia was shaking shakily. Well, it''s this guy and he''s probably buying a grudge or two. ''''Where are the ones caught with it? ''I don''t know. Perhaps he''s trapped somewhere... So we''ll have to go through it with a fine-tooth comb. ''''Please be careful. There was also a beastman who claimed to be a member of the Demon King''s army. Hmm, that sounds a little more promising. After repairing the destroyed defensive wall with yellow magic, I took the twins and resumed my exploration of the city. The City of Swords, Central Square. It was there that the captured swordsmen were gathered. While demons surrounded the perimeter of the square, their hands and feet were bound and rolled on the ground. ''''Well,'''' Looking down at them at ease, a single beastman opened his mouth. It was a lion beastman with a magnificent mane. ''''Now the slaughter begins. Are you ready, human warriors? There was a gasping sound here and there. Some swordsmen shouted in anger. ''''Ya, you promised differently! ''You lied to me when you said you would save my life if I dropped my sword! ''''After all, the demon race has no blood and tears.......! The lion beastman scowled, unperturbed by the accusations being hurled at him. ''''That''s offensive. The only people we said we would save their lives were non-combatants. Since you are warriors, you are prepared to die at any time, aren''t you? So you do not intend to kill civilians? Yeah. Not right away, you know? What? ''If we kill him now, the meat will rot, won''t it?The desire for fresh meat is the same for us beastmen as it is for you humans. However, there are some beastmen who only eat grass. The swordsmen shuddered when they learned that it was only to be kept alive as food. ''''By the way, I really like to eat my prey while it''s still alive. Saliva dripped from his sharp, fanged mouth, wetting his feet. Hii, several swordsmen cleared their throats. But then. Suddenly, there was a shadow that leapt at the lion beastman. An unseen flash. But it was caught by the lion beastman''s sharp claws. ''''Chii!'''' With a cluck of his tongue, he took the distance. It was the one-armed swordsman who had been captured with the other swordsmen earlier. A dagger is held in one hand. ''''How did you get out of your restraints?No, that arm........I see......so the prosthetic limb tricked you? The lion beastman nodded his head in agreement. He must have escaped from the restraints by removing his prosthetic arm from its bound arms. Did he keep the dagger in that prosthetic arm as well? I''m not good at surprise attacks, but I still thought I was sure to get them done. As expected of a demon tribe. The ship-armed swordsman frowned bitterly while holding his dagger. Meanwhile, the captive swordsmen cheered. ''''It''s the Guild Chief of Dragonfang! ''''The one-armed Twin Swords King and the most successful winner of the Sword God Cup, Mr. Rod...! He would have been no match for the demons! The lion beastmen fanged happily. ''Ho, apparently you''re a noted warrior among humans. Sounds like just the right amount of light pre-dinner exercise.'' f*ck you, you f*cking animal! The one-armed swordsman kicked the ground and leapt again. 164-Episode 36 Dont forget Oh, my God... The head of the Dragonfang guild... ''''No matter how much of a dagger it is, I can''t believe it''s so limp like this...'''' Voices of despair were escaping from the mouths of the captive swordsmen. Rolling on the ground with a ragged body was the ship-armed swordsman. On the other hand, the lion beastman was nearly unharmed. ''''Well, there''s no need to be so discouraged, humans. You should be proud of yourselves. You should be proud of yourself for being able to continue fighting for three minutes against me. As expected, I wasn''t expecting it either. The lion beastman''s words might seem sarcastic depending on how one listened to them, yet he seemed honestly surprised. On the flip side, it also meant that he was looking at a far lower grade. ''''If it was a lower level demon race, we would have had a good match. But today, the opponent was bad. After all, the person in front of you is me, Leold-les-Laozore, the executive of the Demon King''s army and the leader of the Beastman Squad,'''' You''re the leader of the Demon King''s army... A breathtaking ship-armed swordsman. But then, for some reason, he laughed, "Huh. ''''What was that laugh?Too. ''''No, it''s just the opposite. No, it''s just the opposite. I just think that if the leaders of the Demon Lord''s Army are this strong, there''s still hope for humanity. I know a guy who''s stronger than you, you know? Haha, that''s a cheap threat. But since we''re here, let''s hope for the best. The lion beastman laughed lightly and grabbed the ship-armed swordsman''s head in an eagle grip. Then he opened his mouth, which was lined with sharp fangs. "Rejoice. To be my flesh and blood. He took a bold bite to the neck of the one-armed swordsman - just before he was about to take a bold bite to the neck of the swordsman - and his animal instincts noticed the approach. ''You have good nerve to interrupt my meal, don''t you? He blocked the attack with the claws of his right hand. He also swung his left arm and launched a counterattack. ''''What?'''' But just as the claws sliced through the attacker''s body, the only thing that came back was a scratch on the air. It''s an afterimage. Huh! While quickly jumping back from the spot with the agility characteristic of the feline family, he looked back behind him and lifted his cornerstone. ''''To take my back here... who are you?'''' A young man with dark hair was there. The reply came from behind me. "And that''s just an afterimage... What? I came to the central square of the city where many demons had gathered, and I found that the swordsmen had been captured. And an old man I had met somewhere had fought the demons and lost and was about to be eaten. ''''Father!'''' Yeah, speaking of which. Lilia''s scream reminds me. That one-armed old man, Lilia''s father, the head of the Dragon Fang guild. ''No, don''t forget that! I''m going to go help. I was on top of a building with a view of the square, and I leapt to the square. And here we are now. It''s just an afterimage. What? I was taking the lion beastman''s back again. ''Bah, foolishness!Not once, but twice, you have taken this me behind........! What''s so surprising is that it''s so f*cking seamless? Hm, I was a little wary of this guy because he was said to be a leader of the Demon King''s Army or something, but it seems it''s nothing serious. I think that the demon gods who fought in this city in the past were much stronger than that. "Wha-who was that guy? ''Oh, it''s Arel........!It''s that hero, Arel! What does that mean, that you won the Sword God''s Cup despite being an unemployed person? ''They say it''s a shadow when you talk about it but I didn''t think you''d actually show up...'' Lilia''s father is laughing as he falls. ........I forget his name. The lion beastman nodded as if he understood something while bracing himself in alarm. ''''I see. So you''re the one he was talking about earlier, the one stronger than me? Hmm?I don''t know about you, but I''m pretty sure I''m stronger than you. ''''Don''t think you can win just by getting behind me twice! He leaps at me. By then I was already behind him. ''This is the third time you''ve done this,'' ''Ha!So many times the same hands can get through to me! He turns around and unleashes a claw strike. But once again, it only tears apart my afterimage. Over here! Off. That''s what I''m talking about! That''s an outlier. The lion-beast man who continues to be toyed with by my afterimage. "Oh, oh, oh, oh, oh, oh, oh! As if his anger had reached its peak, he suddenly stopped moving and roared into the sky. ''''Mu........'''' The shockwave drowned out all my afterimages. Furthermore, the vicious intimidation caused the swordsmen to turn white and faint. I, too, was affected by it for a moment and stopped moving. I didn''t miss the opportunity, and they were closing in with their fangs bared. ''''Hahahaha!After all, you are the one who will be eaten by me! That''s why it''s an afterimage. What? He doesn''t learn at all, this guy. They say that the demon race is as intelligent as humans, but is it still stupid because it''s a beast? ''''.........................Afterimage afterimage and that''s all you can do from earlier. If you look, you''re not even holding a sword. Well, I can cut without a sword. Hmm, how about this then? In all, there are five of me surrounding the demon tribe. ''''Another afterimage!This is just such a fudge, no matter how much of a pain and itch it generates, guaaaaaah! The demon tribe let out a scream as the five of us slashed their entire bodies into pieces. ''''This isn''t an afterimage, it''s an alter ego!'''' 165-Episode 37: Dont Become Such an Adult It''s an afterimage, but what I used was an alter ego. This is an imitation of the skill used by the old lady in that prison city, and unlike the afterimage, it has substance, so it can also attack the enemy. Bah, you idiot, what...? The lion beastman collapsed to the spot. ''''Oh, hey, what did you just do?'''' I don''t know...I heard something about being an alter ego or something... "Alter ego?Isn''t that an afterimage? ''I mean, how could you do any damage without a sword?'' If you''re a top-notch swordsman, you can cut with your bare hands as well. If it''s something, it''s possible to cut with just an image. ''....A monster, huh........'' The demons are almost bug breath. ........along with my compatriots, we will be crushed to death by the horde, but okay....... That''s the last thing he said, and then he died. Goggoggoggoggoggogg--. I could hear the earth shaking from somewhere. When I looked, I saw that there was a cloud of sand and smoke rising all over the city. Apparently there really is a large group of demons heading here. If it was just me, I could handle it, but as expected, it would be quite painful if I had to protect the swordsmen who were blocked from moving. ''''Dad!'''' As I was feeling so depressed, before I knew it, Leila and Ark were running around the square to unbind the swordsmen. ''''Great. ''''Ko, child?'''' ''How did you get here?We need to get out of here fast because it''s dangerous! It''s you guys who should run away quickly. No, I''m a swordsman in my own right, so why don''t you let him protect himself? The problem is that I don''t have a sword but can I make one? I used yellow magic to create a simple sword. I point to them as they pile up at my feet and tell them. ''Use this one.'' A sword? ''And so much of it... where the hell did you get it from? Look, it''s coming out of the middle of nowhere, isn''t it? You''re full of surprises. Take it faster than that. As if my silent thoughts were understood, they hurriedly picked up their swords. When I managed to make enough for all of them, a horde of demons was already approaching the entrance to the square. It''s in times like these that the "alter ego" comes in handy. I created my alter ego again to fight off the swarm of demons. Lilia''s father looks at me in amazement. "That really isn''t an afterimage, is it? My alter ego. ''There''s a lot of things that don''t make sense to me, but well, it''s you. What about the kids? .... Ark and Leila followed my example and used their "alter egos". But for now, they can only produce two at a time. "[Oh-oh-oh-oh-oh-oh! And finally, a horde of demons rushed into the square. ........In conclusion, we were able to annihilate the demons without so much trouble. There was no longer a need to go all the way around the city to defeat the demons that were all over the city, so much so that they were rather helpful in collecting them. We also defeated the demons that attacked us with the demons, and it''s safe to say that we''ve almost succeeded in taking back the city with this. ''''That''s as good as it gets, Arel-san!I had no doubt that He would save this city again! ''''So I haven''t seen you for a while, but where have you been while we''ve been fighting the demons?'''' Hey, I can''t believe you asked a maiden that. He was probably hiding somewhere, just himself anyway. I''ll have to make sure that my children are taught not to grow up like this. Then we went to pick up Laina and the others once we had left them outside the city. They seemed to be worried about the kids, and when they saw our faces, they rushed over to us in a hurry. ''Ark, Leila!Are you okay?Are you hurt?! Yeah, don''t worry about it, Mom!It doesn''t hurt anywhere! Well, there must have been demons, right? There were, but they weren''t very strong, were they?Hey, Ark? Yes. I was rather expecting a more taut opponent. I should have let those two Demon King''s army leaders and stuff like that fight as well. The demon tribe was unable to believe the scene he had seen himself. Hiding on the roof of a house adjacent to the square, he was a beastman with the upper body of a bird. He was responsible for circling the sky and finding any surviving humans, but he had come down when he sensed something was wrong in the square. What shocked him even more was that not only the boss, Leold, but also the hordes of demons gathered from all over the city, and even the other beastmen, had been annihilated by at most a few dozen humans. Particularly different dimensions were the dark-haired young man and the two red-haired children he had brought with him. ''''Those guys are dangerous.......I must tell the Demon Lord immediately.......'''' He immediately turned himself around and tried to jump up into the air. But just before he does. You''re not going to get away with this, are you? Suddenly, a voice whispered in my ear that made me shiver. Not just behind me, but almost too closely. If he tried to move in the slightest, he would die. That instinct made his entire body stiffen like a stone. ''''What, who are you........'''' ''You don''t need to know that. Because I''m going to die here and now. ..... Then his consciousness was cut off. 166-Episode 38 Isnt he a master? I actually wanted to have the twins practice training against various swordsmen in the City of Swords, but it looked like it would be impossible for a while due to the reconstruction, so I decided to head to my next destination. ''''I can see it. That''s the magic city. ''Wow!It''s in the middle of the lake!That''s neat, Ark! Yeah, I guess so. I drove a land ship to the magical city where I stayed for a year or so when I was eighteen or nineteen. ''''There are six magical academies here. Six? ''''Ah. I''m specializing in red magic, blue magic, yellow magic, green magic, black magic, and white magic. ''Huh?Why don''t you do it with me?I wish I could learn everything at once! ''''Well Leila, your mother doesn''t know much about magic, but you shouldn''t say that in town too much. Mom, why? While they were talking about it, they were ducking through the castle gates and entering the city. ''What''s that ship?'' ''We''re running on land?A grimoire? The people in the city look at us curiously, but since it''s a magical city, the reaction is muted. This kind of mobile magic tools are usually sold in this city, regardless of their performance. ''''But I was worried because the sword city was occupied by the demon race, but it looks like the magic city is fine. According to the rumors I heard on the way here, the Demon King''s army had attacked once, so I thought it might be in the same state as the Sword City. I don''t know if it was just a hoax or if they were repulsed, but apparently it was a groundless fear. ''''Well, that''s good that we were able to deal with the demon race then. I don''t think that''s a good idea. While Laina was half-eyed, the first place we came to was the Red Academy. ''''Are we allowed to enter the grounds without permission?'''' What? Well, you know... ''I didn''t graduate after all, you know. But, well, maybe I''ll be okay. I''m not sure I can rely on that okay at all. Well, let''s go ask the dean for permission. Unless things have changed since then, but I''ve met the Dean. It shouldn''t be a problem if I talk to him. As I recall, the building where the dean''s office is located is that one. He then headed to the dean''s office, but on the way there, he was stopped by a security guard. ''''I need to talk to the dean. Do you have an appointment? No, I didn''t take it. ''The headmaster is busy. You''ll have to make a proper appointment. How can I get it? Go to the office. So I went to the office. Are you affiliated with our school? Not now. So you''re an alumni? ''No, I didn''t graduate. I only attended for a time. You''re going to be expelled from school........I think that would be a bit difficult. To begin with, the headmaster is very busy, and I''m not sure he''d be willing to meet a stranger at the drop of a hat. I''ve seen him before. It''s a one-sided thing, isn''t it? ''I don''t think so. I''ve talked to him a few times. I''m sure he''ll remember it. Excuse me, but what do you do for a living? Unemployed. ''''Please leave. I mean, to begin with, the Academy''s grounds are off-limits to everyone except those involved? So to get that permission, Then please answer the question here and now. I can''t allow it. And so it doesn''t get anywhere at all. ''''Well that''s what I expected, though. Momma, Leila, I''m hungry! You''ll have to be patient. And then a young man came up to me. What''s going on?Are you in some kind of trouble? ''''Oh, Dr. Kite. This gentleman is here to see the headmaster. But with his identity in question-- ''''Master!Aren''t you the master! Suddenly, the young man saw my face and spoke up. ''''....Who are you?I don''t remember taking an apprentice. Hey, it was me!I''m a kite!Have you forgotten?! He is a young man who points frantically at his own face and insists on it, but unfortunately, he doesn''t remember it. No, wait...? ''Ah!Could it be one of those three guys? Among the group of three that met and took the exam together on the way to the Demon King''s City, there was a cocky boy. But now, the atmosphere has completely changed from those days, and he has become a young man with a gentle impression. That''s why I didn''t notice him. The office clerk asks Kite fearfully, "Um, Kite sensei... ''''Um, Kaito-sensei........is this person you know.......?'''' ''Yes, that''s right. This man, Mr. Arrell, is my mentor. ''I don''t remember being a master, but...'' For me, he''s still my heart teacher from then and now! For some reason, I have a stronger respect for him than I did then. ''''I''ve spent the next ten years studying magic desperately since then, and that''s why I''ve come to understand my master''s greatness even more. ''Really? Or rather, they call you sir? ''''Ha, I''m embarrassed to say that I''ve become a professor at this academy for a change. Of course, I''m still not even close to my master''s feet...'''' Kite scratched his head in humility. ''''That Professor Kite, who became a professor at the age of twenty, can''t even step up to the plate...'''' The desk clerk looks at me in disbelief. Anyway, it was just as well. Kite will be able to help you. "Huh?Would you like to visit this academy with your children?Oh, so these are your master''s children!Is this your wife?She''s very beautiful!Oh, of course I don''t mind!If you''re a master, you''re more than welcome!Please go and meet the dean! 167-Episode 39: It looks as it is At first he was treated as a suspicious person, but a chance encounter with Kite, who is now a professor at this academy, allowed him to get permission to stay safely. The head of the Red Academy hasn''t changed since then, and he''s a well-built old man - Redra. He welcomed me as well. ''''How''s that Leon guy doing?'''' He hasn''t changed at all. You look exactly the same. ''Right. Tell him we''ll have a drink or two sometime when he''s free. It seems that my father and I were classmates when we were students at the academy, and Redra asks me for help with a look that reminds me of the past. I don''t know if he''ll comply, but since it''s a cheap order of business to tell him, I nodded my head. ''''But I see, that guy has grandchildren.......he''s a complete old man now.......'''' Looking at Ark and Layla, Redra muttered sincerely. He''s in his fifties, but apparently he''s still single. ''''Come to think of it, I heard a rumor that the Demon King''s army attacked us, were you okay?'''' Of course they did. When they saw we were no match for them, they ran off with their tails between their legs. Apparently, they''ve repelled it. Because it''s a city on a lake island, it''s hard to attack and easy to defend. I''m sure there was such a geographical advantage, but as expected of a magical city. "Papa. Hmm? Leila pulled on her clothes, probably bored with me and the dean''s talk. Then, taking the twins with me, I looked around the Red Academy for the first time in a long time. ''Dad, Dad!What is that? What are you doing?What''s over there? School is a rarity for Leila to begin with, and she is curious about lectures and labs. Ark is quiet as usual. ''''Maybe these kids can become wizards like their mentor in the future! Kite says excitedly. ''Yes!There''s a training facility that just opened recently. Would you like to take a look at it? Hmm, that should be interesting. The building that Kite took me to was certainly not the one that was in place when I was in school. ''This place is built for more hands-on magical training. I was surprised when I walked in. Most of the training grounds were just empty spaces. However, this place had a field that was designed for actual combat. ''There are three types of fields. The first is the urban area. Then there is the forest and the river. And the last one is the palace. Many of them will go straight into teaching or research after graduating from the academy, but it is not at all uncommon for students to join some country''s magical knights or become adventurers. And the actual combat they would experience would be rather rare to occur in a place like a training ground. ''''Just now, it looks like the students I''m teaching are in training too. Each field is separated from the corridor we''re in now by transparent glass, but it''s low enough that you can see the situation from above. It''s not just a matter of time before you''ll be able to get a good deal more than you think. But flying around were red magic and blue magic. This is supposed to be a red academy, but...? Hey, it''s not Kite. I turn towards the voice and a strong-looking woman walks towards me. ''''Hi, Kufa. Oh, so you''re fighting with a student in your place right now. ''Yes, I do. It looks like my students have the upper hand at the moment. If he keeps this up, he will win. ''They don''t know yet. Unlike your place, which focuses on numbers, this one has powerful magic that can turn things around. That''s already taken care of, by the way. And what about those people you don''t see, by the way? Is Koofa, or is it, you know, that? Master, Master! ''Master...?Don''t tell me that you call yourself ''unemployed'', that doesn''t make any sense! I didn''t call myself that. ''Why are you here? After all, she''s one of those three, and she seems to be the twin-tailed girl who entered the Blue Academy. As expected, her hairstyle is different, and she''s made up well, so she''s become much more mature, but her personality hasn''t changed much since then, apparently. It is said that she is currently also a professor at the blue academy. Huh. In other words, you stopped by on your family vacation with your wife and child? No, it''s not just a trip. It''s for training you two. Training? You haven''t even been blessed yet? As we talk about this, it seems the mock battle is over. In the end, it seems that Kite''s students won in an upset, and Koofa is frustrated. ''''This is the Red Academy, right?Why is there someone from the Blue Academy? The head of the academy called for more cooperation among the academy heads to cooperate with each other. In the past, the exchange between the colleges was limited to the Magic God Festival, but the deans called for more cooperation between the colleges, so joint research and joint training has become more and more popular. I see. It''s true that at that time there was no connection between the schools. No one even noticed that I was attending six of them at the same time. It was all because of my teacher. Me? ''I don''t know the details, but Dean Redra told me that the deans have come to terms with their mentor,'' "Hmm? It doesn''t sound right when you say it. ''Wait a minute, Ark and Leila aren''t here? It''s true. Laina looks around as if in a panic. ''You''ve gone away again through the cracks. "Maybe it''s because you taught him an extra skill... Even I can often lose track of them if I''m not careful. Don''t sound so happy about it! Well, with those two, there''s nothing to worry about. Aside from Leila, Ark is solid, too. Doh-oh-oh! Then a loud explosion sounded. Hmm, it looks like we''ve entered the city center field. "...What? For some reason, Kite and Kufa were rolling their eyes. 168-Episode 40: Im glad my wife is a common sense person Ark and Leila are shooting magic at each other in the city''s field. ''Take this one!Firelance! "Ice Shield. All right!Sandstorm! "Explosions. An intense exchange of magic. However, even after being exposed to the magic of the two of them, seeing that the building was only slightly damaged, though not unscathed, it was probably made of special building materials. ''''Sh, Master........'''' Yeah, I''m sorry about that. My kids are on their own. ''No, that''s fine but you''re not ten years old yet by all accounts, are you? You''re eight years old. ''Why do you normally use magic?'' I mean, this isn''t just normal magic! And then an idea fell into my head. ''Yes. "Well, since it''s time to go, why don''t you hold a mock battle against those two? Kite and the other students arrived at just the right time. They had never given them a mock battle against multiple sorcerers before. ''''Eh?What''s with those kids...? You''re a child, aren''t you?Why do you keep firing off such powerful magic in rapid succession? That and a mock-up?No, no, no, no, no, I can''t. You''ll be killed... Unfortunately, the students looked frightened and frantically shook their heads from side to side. ''''Master I''m sorry, but I''m not sure about the mock battle...'''' ''Don''t worry about being a kid, okay?Those two are well trained by me, and they shouldn''t die so easily. ""We''re the ones who are going to die!" For some reason, the students have been complaining to me. I can''t help but laugh. ''Haha, no way. They''re just kids, you know? It''s not on a child''s level by any means! Laina pokes my head in. ''Hey, don''t push it too hard. You''re in trouble. And you need to learn some common sense. Hmmm, it doesn''t feel right, but if you''re going to say that much, it can''t be helped. ''''Good thing Master''s wife is a sensible person...'''' Well.... Kite and Kufa were exhaling with relief. After a quick tour of the academy, it was getting dark. Thinking that it was time to find a place to stay. In that case, you''ll have to stay at my house. That''s what Kite had suggested, so I decided to take him up on his offer. Kite''s house was located in a residential area that was a good enough walk from the Red Academy. ''''Heh, it''s a fine house.'''' Because it is a city on an island, the land is limited, so the housing in the magical city is not very large. That''s why there are many apartment complexes, but Kite''s house was a single house with a garden. Well, the teachers of the magic academy are highly paid, so they must be wealthy. ''''Right now I''m living with my wife. You''re married? Yes. A year ago. I''d say I''m still a newlywed. Am I interrupting? Yeah, no problem. I''ve already told my wife. We''ve been together ever since we met, but when did I tell him? I''m home. Welcome back. When I go up to the house, Koofa, who I left at school, shows up from the back of the house. Kite tells me, a little shyly. ''Um, this is my wife Koofa,'' What? We''re married. Kite wanted me to, so I had to. Hmm, I had the impression that they were always fighting at the time, but I didn''t expect them to get married. ''''Talking like that, Koofa-chan, you were actually in love with Kaito-kun since you were in your home village! Hey, Colette!I''m telling you, it''s not! Okay. Furthermore, the last of the trio that popped up from the back of the house was the last of the trio, who hadn''t changed much in appearance since then. ''''Arel-san!It''s been a while! Apparently, he heard from Kufa that I was coming and rushed all the way over. He''s currently working as an assistant teacher at the Yellow Academy. ''''Aren''t you rather the one who needs an auxiliary? Oh, that''s terrible!It''s true that I get pissed off for breaking equipment all the time, but... It didn''t seem to have changed on the inside either. Since we hadn''t seen each other in ten years, we had a great time talking over dinner. Well, I was just randomly chatting about what happened after I left this city. ''''Mythical grade demons as followers........'''' As usual, I don''t know what you mean... Great job, Master! That being said, as I was talking to the three of them, I noticed something. ''What are those bruises on your necks, all three of you? ''What?Oh, it''s true. I have one too. Me too. There was a mark on the base of his neck that looked like he had been bitten by a wild dog. And all three of them. ''''Normally, it should be healed with some blessing. Yes. I mean, how did you notice this? I had no idea until you told me. It''s a bit of a strange phenomenon, but well, you wouldn''t know it if you thought about it. ''''Mmmmmm........'''' Leila was on the verge of falling asleep now, probably because her stomach was so full. Ark was also biting off a lack of growth. ''''Ha, they both look tired. Well then, I''ll show you your room.'''' Well, I''m going to go home now. Oh, Colette, are you leaving already? Yeah, yeah. I take back my previous statement. Colette seems to have gotten a little sick. Thus, today, I''m going to rest at Kite and Kufa''s house--. It was in the middle of the night that something strange happened. 169-Episode 41: Because I am sound until the morning I woke up in the middle of the night with a hint of danger. Immediately after, something comes into the room. Hmm, what does it want at this hour? He pretends to be asleep, and then jumps on us as we sleep in bed. He grabbed her by the neck and flipped her over to the floor with force. ''''Aaaaah!'''' Kite? It was Kite, who looked like a different person than in the daytime, whose eyes were bright red, fangs bared and a mysterious voice was raised. ''Hey, what''s going on?'' Laina, who was sleeping beside me, also seems to have woken up and asks me while getting ready. ''''I don''t know. I don''t know, let''s just let her sleep for now. I used white magic to force Kite to sleep. I applied it pretty hard and he finally fell asleep. Thump thump! Just then, I heard a violent noise from the next room where Ark and Leila were supposed to be sleeping. ''''Oh, Ark!Leila! Don''t worry. I''m sure you two can handle this. When I went to their room, I found Kufa lying on the floor. ''Suddenly my sister was scared out of her mind! I don''t know what''s going on. They report back to me. ''Oh, hey, look out,'' Laina pointed out the window as if she was impatient. When she looked, she saw people walking towards somewhere, even though it was the middle of the night without a single light in the city. ''''Laina, take care of Kite and Kufa. You''d better tie up your body with a rope or something just in case you wake up. What are you doing? I''m going to take a look around. Ark, Leila. Huh? Are we going with you? Of course. "Covert", I followed the people of the city with the twins. People came out of nowhere, and before we knew it, there were quite a few of them. And they were all heading in the same direction. While waking Leila, whose eyelids sometimes closed, we eventually arrived at the Red Academy. It seems that they are gathering in the square of the academy. ''''I see, that''s the source of this?'''' At first glance, the one in the center of the square appeared to be a group of humans. However, from the signs they wore, you can tell that they are not similar to each other. "Dad, what are those people? Probably a demon. My people... As I ducked behind the building to watch, I realized that those demons were biting the people of the city around their necks. ''''Vampires........'''' Ark murmurs softly. ''Hmm, you know your stuff.'' ...because I read about it in a book. Do you have a book like that in your house? Anyway, as Ark says, that''s probably a vampire, a type of demon race. Probably it is sucking the blood of the people of the city. ''''Why are they sucking you quietly?'''' Leila asks curiously. ''Vampires have the ability to turn their blood-sucking counterparts into household members. Kite and Kufa must have been manipulated as well. It seemed that they were simply being sucked out of blood, so I decided to check out the city without touching them for the moment for today. Then I discovered that the people who remained in the house would also turn red and attack me if I approached them. Apparently, when they found a human who hadn''t been attached to them, they would try to suck their blood on their own. Apparently, that''s how the people of the city were placed under the control of the vampires one after another. It''s like an infectious disease. Moreover, upon further investigation, it wasn''t just in the area where this red academy was located. People living in the vicinity of the other academies also gathered together and were being sucked by vampires there. The magic city was divided into six regions around the six academies, and each region seemed to be managed by a different vampire group. ''''It''s getting pretty messy. The magic city hadn''t been able to repel the demon king''s army. On the contrary, it seems that the city had fallen into the hands of the demon tribe without the people involved knowing about it. The next morning, Kite and Koofa woke up as if nothing had happened. ''''Huh?Last night?There was nothing unusual about it, but... In fact, I don''t remember any of it. I''ve been sleeping through the morning lately. Neither of them could remember last night, apparently. According to one theory, vampires are vulnerable to the light of the sun. Maybe they can only be subordinate to it at night. ''''We''re going to visit the Yellow Academy today, so you can show us around. ''Really?You''ll still be in the city for a while, right? Yeah, I''m gonna do that. I don''t tell Kite and the others the truth, just in case, and I leave the house with Laina and the twins. ''What are you going to do?'' Of course we''ll take down the vampires. I''ve already located them last night. Their hiding places were all magical academies. There are many places in every academy that not many people enter, especially in the basement where there are several mysterious rooms. It seems that they use it as their base of operations. And if it''s underground, they don''t have to worry about the sun''s rays even in the daytime. Humans are the equivalent of food to vampires. If they try to fight and take the city, they will lose that precious food. So they would have to secretly control it from the inside so that they could have a safe and permanent supply of blood. What a cunning and frightening approach. But maybe that''s why we were caught off guard. When we rushed into the room, the vampires were apparently sleeping soundly. ''''Huh?Two, human...? He jumped up in a hurry, but by that time, several of his compatriots had already been cut down. ''''Ei!'''' Yeah! Ark and Leila also ran around the room, cutting down vampire after vampire. ''''What the hell are these guys?Ha, ha, ha. I''m not letting you go. The vampires ran to the entrance of the room in a hurry and fell prey to Laina''s sword that was waiting for them there. 170-Episode 42: Probably the Right Partner Dad!These people are going to heal their wounds! Hmm, it''s true. The vampires that should have been cut down were getting up one by one. Leila was right, the cuts were repairing themselves. ''''Kuhahahaha!No use, humans!I commend you for locating us, but no more. You will be my bait! The vampire at the farthest back echoed loudly. It seems that this guy is the leader of the group, and the amount of magic power he possesses inside is clearly different from the other vampires. You''re going to be able to get a great deal more out of it. --Holy Ray. Giaaaaahhhh! The vampire who had taken a direct hit roared out a scream as he released a purifying light with the White Magic Law. Even though the light subsided, there was no sign of recovery for the part that had dissolved into sludge after being hit by the light. I wondered if it was because of its weakness to the sun''s light, but it still seems to work. ''''You aren''t a swordsman? Unfortunately, I''m also a magician. I proceed to fire a series of Holy Rays. He also followed my lead and released Ark and Layla as well. ''''Even these kids! You''re kidding me! Giaaaaah! One after another, the vampires were dying out in the light of purification. ''''d*mn!My people...!I will not allow it! The leader vampire leapt at him in anger. ''Holy Ray,'' It''s useless!As an advanced vampire (arc vampire), that level of purification magic doesn''t work on me! Hmm, it seems this guy has a lot of resistance. ''''Let''s try making it stronger. Holy Cross. ''Ggghhhh!'' Whoa, that''s working. I mean, that''s ridiculous.... that you could even use a holy cross... After annihilating the vampires hiding in the Red Academy, we immediately went to the next academy. And we steadily eradicated them. Finally, we finished cleaning up the vampires in the basement of the Black Academy. ''''Okay, that''s all of them.'''' It''s over. Laina asks as she exhales tiredly. ''Hmm.... Can we assume that the people of the city are now free of the vampires'' control? No, I''ve still got one more thing to do. "?What''s that? Shifting my gaze away from Laina, who tilts her head, I turn to it, which sticks to the ceiling of the room. It was a lone bat. ''''I''ve noticed you long ago. Why don''t you reveal yourself soon? Well, even if I don''t intend to, I''m going to expose you for what you are. "Holy Ray. He shoots a purifying light at that bat. However, the bat quickly escapes into the air and comes down to the ground, spinning in midair. At that moment, the bat regains its true form as an enormous amount of magical power is released. ''''Ha!Vampires!I didn''t know you were still alive! As Laina hurriedly braced herself, the vampire cowered her shoulders and let out a breath. ''''Totally, you''ve really made a mess of things, haven''t you? We''ll have to start all over again from scratch, won''t we? "You think I''d let you do that?You''re pretty much the only one left, right? ''Hahaha, there''s nothing wrong with that. What you have defeated is just a pawn. As long as I, Vlad, the true ancestor of vampires, am here, I can create as many as I want. Hmm, I don''t know how they do it, but I heard that vampires breed differently than humans. ''Then I guess we''ll just have to take you down. That''s one way of putting it, isn''t it? But that''s not possible. I say to Ark and Leila. ''That''s why. You two go at it together. ''Yes!I''ll do my best! ''What?Are we going to do that? Leila throws her hands up in the air, motivated, and Ark rolls his eyes. Laina shouts out. ''Wait a minute!This guy''s not just any guy!Probably the head of the Demon King''s army!I don''t care how dangerous it is! Don''t worry. You''ve got a good match. The Demon King''s Army leaders I encountered in the City of Swords were defeated by me. I''ll leave it to the two of you this time. ''''Kukuk.......hahahahahaha! Vlad suddenly burst out laughing. ''The kid?You know who I am?Human parents are terrible with themselves for being the first to sacrifice their children. All right, son, let''s not be so careless. It''s already started. What? Leila had already kicked the ground and was fleshed out. A slash sliced deeply into Vlad''s neck. Vlad looked at him for a moment, but immediately smiled with a spare smile. His neck, which should have been almost torn to shreds, was connected in a flash. ''''I''ll be healed soon~! Leila is amazed at the speed of repair, which is incomparable to the vampires so far. Meanwhile, Ark had come around behind Vlad. The sword''s blade was wrapped in a shimmering light. ''''Ta!'''' Huh? His back was slashed, and Vlad twisted his face. ''''........I see.......So you gave the sword a purification spell? But it won''t work to this extent. However, the scars that should have been exposed to the cleansing light were also repaired in the blink of an eye. ''''Hmm!Okay, here you go!Holy Cross! Layla unleashed a cleansing spell that worked on advanced vampires as well. It enveloped Vlad''s entire body. However, even after the light subsided, Vlad stood there with a fearless smile on his face. ''''It didn''t work very well! It''s like... ''Kukku, I''m a true ancestor, you know?Whether it''s cleansing magic or sunshine, it''s not valid before me here. Then, as what he thought, Vlad slashed his own wrist with his fingernails. Blood spurted out - it was wielded like a whip. ''''Huh!'''' 171-Episode 43 Apparently it seems that you have returned to the original town A whip made of blood attacks the two men. They tried to guard it with their swords, but somehow the whip slipped through the blade. ''''Nghhh!'''' The two of them are blown apart together by a powerful blow. ''''Hahaha, my blood can be coagulated like a sword or fluidized like water! Furthermore, Vlad''s blood parted like a multi-headed snake and attacked them both. It wrapped around their hands and feet and robbed them of their movements. ''''Well, it would be easy to kill them as it is, but it would be a shame to lose such a lively child. You''re right, since we''re here, let''s make him my family. And not just any family member. I can transform you into your own kind of vampire. ''Oh, no!If you''re going to do this, just leave the Ark alone! I''m sorry, too! Well, let''s go get ''em!Explosions! Well, dammit, you''re here. A violent explosion erupted around Vlad. Since it was indoors, there was no way to escape the impact, and the two of them were blown backwards together and slammed into the wall as hard as they could. ''''Ark, Leila!'''' We''ll be fine together. I offset it by launching a slash into the shockwave while protecting Laina. When the blast finally subsided, the walls, ceiling, and floor of the room were curved wide, with countless cracks running through them. Flames blazed redly in the center of the room. Vlad appeared leisurely from behind it. ''''You are a child who does utterly outrageous things. But no matter how powerful it is, normal magic won''t be able to kill me,'''' The burns all over his body are healing in the blink of an eye. It''s tremendous immortality. Ark and Leila, who had been sent crashing into the wall almost by self-destruction, had been able to escape from the blood restraints thanks to them. The damage was also recovered by the blessing. ''''Then!That''s it!Let''s go, Ark! Okay, Leila. They held hands in a friendly manner and raised it forward. Vlad wondered what on earth they were going to do, but he looked at them unconcernedly, as if he was confident in his own immortality. Layla''s magic power breaks up into three different attributes. They are red, yellow and white. On the other hand, Ark''s magic power also separates into three different attributes. This one is blue, green and black. Eventually, each of the three types of magic power mixed together, and then it also fused together again around the two linked hands. That''s right, originally, this magic was to be unleashed by one person. However, the current two of them are still only able to construct up to three magic formulas at the same time by themselves. That''s probably why the two of them decided to share the workload. It''s a trick that can be done because they are twins whose nature of magic power is almost the same. If someone with a completely different nature of magic power had tried to do it, they would not be able to fuse it well in the end, and if it was a bad idea, they would have gone out of control. ''''Illumination!'''' A moment later, everything that was in front of them disappeared. It was no exception, even the air. And of course, vampires. ''''........What?'''' Beside me, Laina has her mouth hanging open. ''Hey, what happened?'' It''s annihilation magic. Annihilation magic...? It is the magic that makes all matter disappear from the world. It is only possible when you have mastered all six types of magic and combined them together. It took the two of you two to pull it off. What a horrible piece of magic you are teaching your children... I''ve taught you, but I''ve never had any success in my life. It was the first time the two of them had succeeded at the last minute. Some say it was a fool''s errand, but such things are not rare. This is the kind of thing that draws out the potential in a real battle. That''s what I wanted. By the way, I use it on a regular basis. "By the way, I use it on a regular basis when I throw out bulky garbage and when I clean out stubborn dirt. It''s handy. I think we should have a talk with you when I get home! And with his body completely annihilated, it seems that even the true ancestor of vampires, as expected, can''t revive him. ''''........defeated?'''' Yeah, maybe. Yay! Ark and Leila exchange high fives in victory. ''Well done to both of you,'' Dad!Ehehe! Leila ran up to me and offered me her head in praise and compliments. I stroked her tousled hair. That night, I was allowed to stay at Kite''s house again. In the middle of the night, Kite and Koofa were still sleeping properly in their room and there was no sign of an attack. Checking out the city, the only people walking outside are a stray cat and a staggered drunkard. ''''Looks like we''re back in town,'''' Thus, unbeknownst to us, we had successfully saved the city from the vampire''s control. ''''But the city of swords, I didn''t know the Demon King''s hand had spread so far. We hear that the countries and cities of the West have now been completely conquered. We can''t just let this happen. I''ve made my decision. ''''........Okay, let''s go to the Demon King''s place to train the two of us. "Your Majesty I have an unfortunate report to tell you. The heroes who traveled to Haldolla to save the city of Razel, occupied by the Demon King''s army, have not returned, even though it has been days. What the hell... ''''We have information that there was a demon clan of the Demon King''s military leaders in Razel.... Perhaps they are..... Well.... A heavy air filled the throne room. It was expected to be a tough battle from the beginning. Here in the Holy Kingdom was one of the oldest countries on the continent, hence there were many records of the former heroes. According to them, the seven heroes had been summoned from another world by the Goddess. If the Demon King was resurrected, then the Goddess would summon the heroes again. Many of the scholars in this country thought so. But the heroes never appeared. Therefore, the Holy Kingdom decided to gather enough heroic beings. An artificial hero, so to speak. But of course they were going to certify seven people as heroes, but there were several problems, and in the end there were only five of them, so there was already a dark cloud in the air before they left. Of course, there was no chance of victory at all. The ability of those five men was solid, and the long history of the country''s treasury had several legendary-grade armor, which they had generously transferred. Some of them were even said to have been used by heroes in the past. ''''But even so, we still couldn''t defeat the demon race...'''' There is no way to do anything now. There is no choice but to sit and wait for the invasion by the Demon King''s army. Here in the territory of the Holy Kingdom, several cities have already been dropped. ''''However, I don''t know if I can call it good news or not...'''' ''Whatever it is, say it. I feel like clinging to a little hope right now. ''''I''m awestruck. ........In fact, there is a rumor that a certain family member saved a city occupied by the Demon King''s army leaders.... "...What?Family? Perhaps it was because it was too outlandish, but the King of the Holy Kingdom couldn''t help but ask back. 172-Episode 44: Mitai floating in the sky After leaving the magical city, we proceeded to the west, saving the city that was occupied by the demon tribe on the way. And we arrived at a vast valley area. We found the stronghold of the demon king''s army there, where there are countless dangerous cliffs, which if you step off your foot, you''ll end up at the bottom of the valley. I see, so that''s the Demon King''s castle. Wow, it looks like I''m floating in the sky. Leila says happily. We are covered by a fog that erupts from the bottom of the valley, making it look like a disastrous giant castle is floating above the clouds. As we proceeded to get closer on the rocks, we saw a group of people standing in front of us. It was made up of demons and monsters, about two hundred in total. ''''Hey! I was expecting to see what kind of people they were, and now they''re one man and a woman and a child! Well, I see you''ve put on a big show. Hey, stop talking!I hear that in many places our military leaders are suffering one mysterious defeat after another!Don''t underestimate the human race! But that doesn''t mean it''s these guys for all intents and purposes. Yeah. Apparently, in order to get into the Demon King''s Castle, they have to defeat this group first. However, although the commander is the one raising his voice to urge caution, most of the demons are not tense at all. ''''Let your guard down and give them a shot, a big one. Okay!I''ll do it, Ark! Yes. Leila and Ark unleash their magic together. ''Cyclone.'' "Permafrost. A huge tornado of absolute zero swallowed up the demon race and the swarm of demons. ''''Bah, idiot! A human sentiment could do this kind of higher magic...? "Soon, as soon as the red magic-- The demons couldn''t take it as a countermeasure or escape, and they were frozen one after another. Before I knew it, there were only countless ice sculptures scattered about, and there was nothing left to move. ''''Well, let''s move on,'''' The innermost part of the Demon King''s Castle. A demon tribe sitting on a mischievous designed throne asked a subordinate demon tribe who was beside him. ''''It seems like it''s a little noisy outside the castle. ''''Haha, Demon King Veerbeem-sama. We have been informed that a group of humans have approached the castle, and the castle''s outer guard is currently taking care of them. There are only a few of them, and we should be able to deal with them without any problems. Oh, I see. "You''re not a hero, are you? "If he is the hero the humans claim he is, he suffered a crushing defeat against Lady Luciel the other day. I know that, of course. I know that, of course, but aren''t they the real ones? There may be others, summoned by the goddess. ''''Yes. But no matter what we''re up against, there will never be anyone who can stand against our newborn Demon Lord''s Army. .... At that time, the information from outside must have arrived by some means, and the demon race under my command raised their eyebrows. ''''Just now, we have received a new report. A group of humans have defeated the guard outside the castle and are continuing to approach our castle. What did you say? But there is nothing to worry about, Your Majesty. The gates are guarded by Ganerja. He stands guard over the gates because of his intelligence, but in terms of fighting ability alone, he is one of the best in our army. It would be absolutely impossible for him to enter the castle. .... They reached the entrance to the Demon King''s Castle. ''''The gate is open. The huge gate was wide open, as if to welcome our intrusion. However, as I was about to pass through the gate, something was falling from above. Zudo-O-O-On! The one who landed with a loud earth shaking was a huge beastly man with an elephant''s head. ''I''m Ganerja. I am the guardian of this gate. I won''t let anyone through without a permit. An elephant beastman who declares as he raises his long nose lazily. He is over five meters tall, and combined with the thickness of his width, he stands in a way that completely blocks the gate. Well, compared to Befi, it''s cute. ''''Ark, let''s go!'''' Yes. The twins sprinted from my side. Without fear, they rushed into the giant man. ''''I''m going to twist and crush that winged bug! The elephant beastman swung his long end around to try to fight it off. The two used their small bodies to duck under it and slash at it with their swords when they got close to the flesh. However. It''s not working!I have very hard skin! The blade barely got through, just a thin scratch on the surface. ''It''s tight!'' But not as much as Befi. Then the two of them relentlessly aimed at the elephant beastman''s right leg. The beastman, who had been taking it easy at first, seemed to be starting to feel pain as expected after being wounded in the same area over and over again. ''''Ow, that hurts!We''re not going to be in the same place all the time! They appeal with tears in their eyes, but of course they don''t let up in their attack. ''Don''t twitch! I dexterously maneuvered my long nose to target them, but I couldn''t quite catch their agility. ''How about this one!'' Boo-hoo-hoo! What? Ark! Ark''s body floated in the air. Then it was drawn all at once to the elephant''s nose. It''s a tremendous suction force, as if it were pulling the entire space around it. Ark was caught in the tip of the nose. The elephant''s nose is designed to hold things like a hand. That''s it! Ark''s small body is raised wide, as if he''s trying to hit the ground. ''Explosions.'' But before he could do that, he stuck his hand in his nose and Ark blasted out his magic. ''''Pa-ooh-ooh-ooh-ooh! The elephant beastman let out a scream as a powerful explosion erupted behind his nose. His eyes flipped around and his huge body slumped to the ground. ''''You''re dead.'''' When I got closer to check it out, I saw that the elephant beastman was doomed, probably because his nose was his weak point. ...that Ganerja has been breached and allowed to enter the castle. What? But the Dark Elf King Gerlord and his men are already in action. I believe their march will be short-lived. .... 173-Episode 45: Why Disperse Forces ''I''m sorry, Lady Baerbaem. It appears that the Gerlord was defeated and killed by the intruders. But rest assured. He is the weakest of our military leaders. I''m sure that Drakul, the King of the Dragon Race and his men who will follow him into battle, will surely be able to hold his breath. .... "Demon King Veilbehm, the Dracul seems to have been killed in action. However, the fallen angel Luciferet is working to eliminate them. Luciferet is the strongest in name and substance among the leaders. It''s not an exaggeration to say that if that one is present, there is no need for other executives. I suppose that''s the end of the intruders'' luck. .... After a fierce battle, Luciferet appears to have been defeated and fled. But there are still three officers left in our army. .... There is also a secret weapon. That man is more powerful than the leaders, but due to the danger he poses, he has been locked away in the dungeons. When the need arises, we will release him and smash him. .... But first, one of the remaining officers, an undead-- ''Yes!Come on! The Demon King, who had been quietly listening to the reports of his subordinates all that time, suddenly roared in an angry voice. ''''Why bother dispersing your forces! ''That''s probably why they''ve allowed each one to be destroyed and penetrated so far!All-out assault, all-out assault!Bring in all remaining forces at once! But my Demon King this is not just a human being and my army has a right to be proud of itself. ''You''ve been beaten to death and now you can''t be proud of yourself!Tell the whole army now!All hands on deck, crush the intruder! Ha, awe......... Hm?There''s a lot of them here all of a sudden. After raiding the Demon King''s Castle, the demons and demons attacked us several times, but we defeated them smoothly and proceeded to the back. However, when we came here, the number of enemies increased at once. The front and back, right and left are all filled with demons and monsters. Until a while ago, they had been throwing in small amounts of force, but they may have changed their policy. ''''Hey, what are we going to do?Ark and Leila are getting tired from the fight so far. It''s dangerous if they get swallowed up by this many. As Laina said, Ark and Layla seemed to be quite tired after the series of battles up to this point. Basically, the reason why Leila, who was always very excited, was so quiet was probably because she was sleepy. It''s a good thing we''ve been working so hard. But if you hold on here, you''ll be stronger. I''m sure you''re not the only one. And so... That''s not the point. You''re an ogre. They''re only eight years old. Totally. You''re still overprotective of Laina, as usual. I still think I should have a talk with you and I should have a talk with you... The experience of being able to fight such a large group of people is invaluable, but if Laina says so much, it can''t be helped. ''Samon--Befi, Livy, Fenny, Pullle, and Matty. I used my summoning technique to summon my followers. I told them, who were confused by being summoned to a strange place all of a sudden. ''Those are all enemies, you can crush them with all your might. Doooooooooooooong! Zgaaaaaan! Crunch! What?What''s going on here? With a tremendous roar, the entire Demon King''s Castle was shaking greatly. The tremor had reached the innermost part of the Demon King''s Castle, and even the Demon King who was sitting on his throne involuntarily stood up in front of this strange phenomenon. Then one of his subordinates reported to him in a panic. ''''Well, Demon King-sama!Suddenly, a mythical monster appears in the Demon King''s Castle!They have attacked our troops and are now in a state of panic........And even the most fearsome gluttony slime in the demon world and a demon that seems to hold a title.......! What the...? He was busy dealing with the mysterious human intruder for free. The demon king often stopped in time, exclaimed, and then slowly let out the obvious question. ''''I, where in the world did it come from?'''' ''Wow, I don''t know. But there are reports that the human was seen summoning... What?.... well, wait. You''re saying that humans have a mythical demon or a demon with a demonic title?What''s the joke?I mean, is that guy really human? There were demon wielders among the heroes of the past, but at most, they were only legendary grade demons. It''s impossible to tame not only humans but also demons. That is the mythical grade demons. ''''No, it''s possible to just call them out........'''' It may be impossible to obey, but it''s not impossible if all you have to do is summon it. That''s not easy by any means, but that still makes sense, the Demon King reconsiders. ''''However, they seem to have chosen only our army to attack us...'''' ''Yes....'' And that''s when it happened. Another subordinate rushed in with a different look of blood. ''''Well, Demon King-sama!The intruders are closing in on us........We are currently putting up a last stand, but probably won''t last another five minutes........! You''re here. In this situation, there''s no other way but to intercept them yourself. As the pride of a demon king, I can''t just run away. There''s no point in being in a hurry. When I sat back down on my throne, I decided to welcome the enemy with the ease of a demon king. But it''s hard to calm my mind. On the contrary, an inexplicable anxiety is filling me from earlier. (..........This magic power.......I feel like I''ve felt it somewhere before...... The souls were separated for resurrection, but because they were one in the first place, they shared a little bit of each other''s records. Tracing back those faint memories, the figure of a certain human emerges. (As I recall........a man with black hair........ If it wasn''t for him, I would have been resurrected much sooner....) Soon, a group of them appeared in this room at the innermost part of the Demon King''s Castle. ''''Hmm, looks like this is the boss''s room. The moment he saw one of them, the Demon King couldn''t help but shout in his mind. (Ah, it''s him!) 174-Episode 46: Give You Half of the World I am the Demon King. I was defeated by the warriors whom the humans called "heroes", but I was able to avoid annihilation because I separated my body and part of my soul in advance. After an eternity, their alter egos began to move to resurrect the warriors. Eating the creatures around us, we gained strength. While many died before they could grow, some began to steadily grow in strength. Deep in the dungeon. In the deep woods. Or in the human cities where the wastrels live. Everywhere we go, we regain our former strength, but then that abominable human man appears. Although we had grown to overwhelm the creatures around us, they were annihilated one by one by that man. There were thirteen of them. And each of them should have been hundreds or thousands of kilometers away from me. Thanks to this, my resurrection was delayed for many years. Even so, I finally obtained my former strength, or even more, and I was resurrected as the Demon King. Driven away by the humans to a barren land, I gathered the demon tribe that had been living in poverty and formed a demon king''s army. However, I didn''t attack the human countries immediately. They concentrated on building up their strength first. After building an army that surpassed that of those days, I was ready to invade. This world belongs to us demons. To make this longed-for goal a reality. But-- What stood in front of me again was that abominable human man. (Ah, it''s him! The group that rode into the Demon King''s Castle, our stronghold, defeated all the elites in my army and finally reached my throne. My eyes were glued to one of them. There''s no doubt about it. That''s the guy. "Hmm, looks like this is the boss''s room. Even though he looked at me, the Demon King, he was nodding his head without a hint of hesitation. In fact, it''s me who is upset. My cheeks are twitching and my body is trembling, and I''m desperately trying to control it. I tell myself that I''m in a state of panic. Don''t worry, I say to myself. I''m not the same. I am more powerful than ever. I can''t lose. In those days, there were seven heroes who challenged me. But look at them! There were only four of them. Aside from the mythical demons, there were only four of them. Fortunately, it seems that they are still rampaging inside the Demon King''s Castle, and the earth shaking and screaming can be heard. I did my best to open my mouth in a dignified manner. I am the Demon King, Veerbeem. You have done well to get here, human warriors. Okay, I managed to say it without a quiver in my voice. The man stared at my face and said, "You are the Demon King? "So you''re the Demon King. So you''re the Demon King, but have we met? No, it can''t be! I ask, while trying to keep myself from being caught up in this, "How could you show such power against my Demon King''s army? You''ve shown so much power against my Demon King''s army. She''s too good to be killed. What do you think?Why don''t you come work for me?If you come under my command, I''ll give you half the world. ...I''m not suggesting this because you never want to fight? No, I don''t want the world. d*mn, that was quick! If he showed any signs of hesitation, he would take advantage of the gap and guffaw at the attack. "I see. In that case, you will die here! I guess we will have to fight, after all. I''ve made up my mind. . With Befi''s help, we broke through the hordes of demons that stood in our way. Finally, we arrived at the deepest part of the demon king''s castle. "Hmm, it looks like this is the boss''s room. A vast space. The one sitting comfortably on a chair in the back that looks like a throne is the master of this castle, the Demon King. I am the king of demons," he said. You have done well to get here, human warriors. It is called the so-called demon race, and is probably the type of demon race that is not that different from humans in appearance. It''s a slightly large human physique, and if the skin isn''t red, it might be hard to distinguish it from a human. However, the body is clothed in an unconcealable amount of evil magic power, and it is understandable just by looking at it that it has a power that is incomparable to any other demon race that I have ever encountered. But still........somehow, is it just my imagination that I don''t feel like we''ve met for the first time? Have we met? No, it can''t be! Hmm, I was wrong after all. "I had no idea that you have shown such strength against my Demon King''s army. She''s too good to kill. What do you think?Why don''t you come work for me?If you come under my command, I''ll give you half the world. No, I don''t want the world. I don''t want to be an underling, and it''s a hassle to rule where I got it in the first place. ''I see. Then you will die here! An intense killing atmosphere emanates from the Demon Lord''s entire body. ''''Wha........'''' After getting a decent dose of it, Laina and the twins retreated. Hm, as expected, it''s too early to let Ark and the others deal with this guy. I was scolded by Laina earlier, so I''ll take care of it here. It''s also important to watch the way the strong man fights, and that''s what training is all about. ''''You two, watch closely. "...and...? It''s your father''s way of showing you how serious he is. Huh! And this is my chance. I''ll show you the best I''ve got right now. With a weak opponent, it''s over in an instant and won''t be very helpful, but with this guy, it should hold up a bit. alter ego x 20 175-Episode 47: Im not normally sane alter ego x 20 I''ve created a total of twenty alter egos, the maximum number I''ve been able to create so far. Unlike the skill''s alter egos, creating one of them requires a different personality. In other words, if there are twenty bodies, there are twenty separate personalities. This is the result of having trained the Personality Separation Method well. ''''....Huh?'''' With the Demon Lord stunned in our wake, twenty of us used our divine feet to move in. In the blink of an eye, we surrounded the Demon King. ''''An afterimage!But it''s just a trick. Then, all of them fired a series of "kamikaze slashes" at the same time. Countless slashes attacked the Demon King. "Gaaaaaaaah!What a fool!Why is the afterimage unleashing the Sky Slayer? Because it''s not an afterimage. Don''t tell me you''re an alter ego.But what are these numbers!That''s impossible!To begin with, the Afterimage should be the skill of the God of Slaying, and the God of Swordsmanship should be the skill of the God of Slaying! You know your stuff. Well, they''re both my style. Hmm, that''s still a great defense. It seems to have taken damage, but each blow is not fatal. We then decided to put magic on the slash. Six attributes: red, blue, yellow, green, white and black. Each of the twenty used a different magic and gave it to the slash. They attacked the demon king from all directions. ''''Noooooooooooooo!How can you even use magic?What blessing have you received from the human gods? ''Goddess blessing?A profession. I say. "Unemployed. No, no, no, no, no! What the hell is this thing? It''s too strong! In the past, one of the heroes who defeated me was a man who was known as the "Slayer". He also used the alter ego skill, but he could only create a maximum of three at a time. But what about this guy? Twenty? And they are exactly the same strength as the mainframe. Even though the main body alone was prepared to challenge me to the death, there were twenty, no, twenty-one of them. No matter how you look at it, there''s no way they can win. In fact, they even use the Sword God''s skill, the Divine Sky Slayer! And that''s without the sword!Not even the God of Swords could pull off such a feat! But then, she even used her magic this time! Six different kinds!They''re giving it to the slash! Is this the God of Magic? But if there''s anyone who can handle sword and magic at the same time, it''s the Sorcerer God! Is this man the one who summoned the mythical demons that still rage in the Demon King''s Castle? Of course, even the God of Training can''t do that! What''s this guy really all about? Just one man is enough for seven former heroes, no, far more than that! What blessing have you received from the human gods? ''Goddess blessing?A profession. I was asking myself with my last ounce of strength, and he said to me, "I am unemployed. "I''m unemployed. .........what? There''s no way. That was the end of me. Huh?I''ll be back? No, no, no, no, no. I am tired. Let''s get some sleep.... . After defeating the Demon King, I returned to the town of Feynot, where my home is located, while defeating the demons and demons that were rampaging in various places. Then I saw two familiar figures at the entrance of the town. ''''It''s Jiji and Grandma! Layla raised her voice. When I looked closely, I saw that my father and mother were confronting a group of demon clans. ''''Kutu.......I didn''t expect to find people of such strength in such a rural area.......! ''''But beating us means nothing. Sooner or later, the Demon King will rule over all humans. That''s right. You''re no better than babies before the Demon King. Hmm, it seems that the Demon King''s army has reached this rural town. But maybe it''s because it''s in the countryside, but no news of the Demon King''s defeat has been heard. ''''The Demon King is dead. ''What?What are you people? "The Demon King is dead?Ha, bullshit. I told them about it, but they just snickered. ''Oh my goodness, Arelle, welcome back,'' Oh, you''re back. Grandma, Grandpa, I''m home! Mom and Dad notice us. Leila runs up to me happily. "I swear. I think we''d better go back now. Shut up. I don''t know who you are, but I will not allow you to taunt our demon king. No forgiveness. The place is falling apart. The demons were barely able to stand up. ''''Well, I''ll kill you even if I have to stab you in the back to defend myself as a demon tribe!Let''s go! "Oh! The demon clans all leapt at once. "''Divine Sky Slayer''. ""What?" After killing the demon tribe in the blink of an eye, I went to my parents'' house for a while. After Ark and the others were born, there''s a new house built very close by, but since I haven''t been back in a while, I didn''t have anything to eat. So we decided to eat my mother''s cooking at my parents'' house for the time being. As I prepared the meal, my mother said. ''''I was worried because I heard that the Demon King had resurrected. I''m glad he''s safe.'''' "I didn''t think you''d beat me, Arel. No, I had a sneaking suspicion that you could have done it, but... My dad gives me a dumbfounded look. ''''I didn''t expect you to ride into the Demon King''s Castle. I questioned your sanity when you said that. Well, in your case, you''re usually not in your right mind. ''Laina, didn''t I just say something pretty terrible?'' Layla raised her hand cheerfully, not feeling tired from the long journey. ''''Leila and Ark also fought against Mr. Demon Tribe! Oh, my goodness, you''re doing great, guys. ''Yes!I''m stronger!Baba, I''ll show you later! Hmmm, that''ll be fun. Jeez, Jeez, I want to see it! And the next day. As promised, they showed their growing strength. ''I don''t get it... you''re only eight years old...?Arel, dude, do you know the word ''dead weight''? "...Arrell?We''ll have to talk about their education for a moment, won''t we? For some reason I had to be pissed off. Why, really? 176-Episode 1 You dont cry at all My name is King Tanaka. ........unfortunately, that''s my real name. It''s what''s called a "shiny name", and it seems to be the result of thinking that since my last name is too common, I should at least make my name stand out. In case you''re wondering, the name was given to me in the hope that I''d become a person who stands above others, not because of a cesarean section. Well, I don''t think that wish is going to come true either. I''m lying in a hospital bed right now. ........but for some reason, I was looking down at my figure from the air. Around me are my parents, my two older sisters, and the doctors and nurses who have been taking care of me for years. The doctor checked my pulse and said, "It''s the end of the line. ''It''s the end of the line. It seems that I have died. Looking down at my bed like this, I wonder if I am a spirit or something. I''m a first year junior high school student. I''m sure the world will think my death was untimely, but I''ve lived a long time. I had a congenital disease. Because of this, when I was born, I was told that I would only live about five years. But I was able to live more than twice that long, until I was in junior high school. I think that''s enough. I could hardly go to school. I spent most of my time at home or in a hospital bed, not being able to play outside. If I could be reborn, I would like to be born again, this time with a strong enough body to play to the fullest. And by the way, I would like to be given a more normal name. As I was thinking about this, a gentle light fell from the sky. It seemed that we were being welcomed. Eventually, my consciousness began to fade away and-- .... hmm? The next thing I knew I was sleeping in a strange room. Where am I? It''s not my home, and it''s not a hospital. It''s a room I''ve never seen before at all. ''Oh!Oh!Oh! I heard crying from next to me and tried to turn around to face it. I tried to turn around, but I couldn''t put any strength into my neck. I struggled to turn my head, but the baby was there, crying. He may have just been born or he doesn''t have much hair. Why am I sleeping with a baby? And my body isn''t moving well.... And then someone comes into the room. What''s the matter?What''s going on?! It was a very beautiful sister who ran up to the girl in a hurry. She had a half-formed face and somehow her hair was bright red. ''''Oh!Oh!Oh! Doh-doh-doh! The older sister picks up the girl and soothes her, but she''s not used to it or she''s rattling around. I mean, "dodo dodo" is probably what they use for horses and such. When the girl finally stopped crying and fell asleep, she let out a sigh with a tired look on her face. Then she looked at me. But then again, you don''t cry at all, do you? No, no, no, I''m already in middle school. There''s no way I''m going to cry. Just as I was thinking that, my sister stretched out her arms and lifted me up. Fah! I was sick in bed for a long time, so I''m petite compared to my peers, and of course I''m light in weight, but I still weighed more than forty kilos. The older sister lifted it lightly. Could it be that she was an arm wrestling champion? It doesn''t look like it. I was hugged by my sister''s chest. I mean, they''re so big! My breasts, which are half-full of my body...wait, wait, wait. It''s not that. It''s not that your sister has big breasts. Well, I mean, maybe they are big, but that doesn''t matter now. I''m getting smaller. Puffy little hands. It''s a baby''s hands. I''m not going to be able to get out of it. --I''m not going to be able to get it right. I''ve been thinking about this for a while now. It''s the reincarnation of another world. A few days passed and I was convinced of that. I''m sure it''s because I used to read a lot of comics, games and novels instead of playing with my friends. The red-haired lady wasn''t my sister, she looked like my mother. The color of her hair, which would be inconceivable on Earth, makes sense when you consider that this is a different world. It''s not that she''s dyeing her hair, it''s her natural hair. In fact, both me and the girl sleeping next to me had red-colored hair. The girl seemed to be my twin sister. She''s not a reincarnated person unlike me because she cries a lot, like a baby. She is not a reincarnated person unlike me, because she is crying frequently like a baby. Of course, I was a junior high school student in a previous life, so I couldn''t do something so embarrassing. ''''Uh-oh.'''' He still can''t speak properly, so he insists with a grunt. ''Are you in the bathroom?'' Ah. ''It''s amazing how much you understand toilets for a newborn. My sister and my mother carry me to the bathroom with admiration. As expected, I can''t do it on my own, so I have no choice but to ask her to help me. You can see the lower half of my body exposed, but.......well, I had to put up with that. It''s a baby, of course, but the food is breast milk. It can''t be helped! If you don''t drink it, you won''t grow up, and most importantly, if you don''t want to drink it, they''ll look at you like you''re very sad! Fortunately, being a baby seems to have made her lose her s*x drive and she doesn''t get excited. I''m glad I didn''t get into that awful state of lusting after my mother''s breasts. 177-Episode 2 Ill cry if Im not A lot of people lived in the house where I was born. A stern-looking uncle, a petite, baby-faced uncle, and an older sister in her mid-30s. An older sister in her mid-thirties, an older sister about twenty years old, a girl about ten years old, and someone who looked like my mother. ........I have no idea what the relationship is. At first I thought the small man was my father, but apparently not. ''''Uh-oh?'''' It''s Jeezy. From the way he asserts himself, he looks like my grandfather. Ayu? Yeah, I''m an old woman. The person I thought was my sister, about mid-thirty, was my grandmother. Not young?They are usually old enough to be mothers. Incidentally, they seem to be my paternal grandparents. The red-haired man who sometimes comes to the house is my mother''s father. And my father is not home at the moment. Is he away on his own or something?I don''t know the circumstances, but it seems to happen all the time. So who the hell are the other three? They''re completely at home, but all three of them look disparate and don''t feel like they''re related to each other at all. Is one of them a human being in the first place?And he''s so tall that you''d think he''d be taller. Well, I''ll find out sooner or later. By the way, neither I nor my twin sister have a name yet. I think they are going to give it to me after their father comes home. I want you to use a normal name this time. When I woke up in the morning one day, I found myself being held by an unknown girl. "Aue? He really is your brother. What is your age, middle school? She is a very beautiful girl, and I''m sure she would be very popular at school. She looks down at me and smiles kindly at me. But who is she talking about, brother? What... what are you doing? The mother seemed to have woken up and shouted at the girl. ''I''m holding her in my arms. It''s your brother''s child, isn''t it? If "brother" comes from a blood relationship, then this girl, my father''s sister, is she my father''s sister? Come to think of it, she looks a lot like my grandmother. When the hell did you come back?What''s wrong with Arrell! Your mother chokes out in a strong tone. Maybe they don''t get along very well. ''''Uhhhhhh!'''' Mom''s voice was so loud that her twin sister started to cry. ''Wow, I''m sorry for being so loud!Alright, alright, alright! ''It''s going to be hard to take care of both of you at the same time. I''ll leave this one to Mira. Oh, hey... A girl, apparently named Mira, leaves the room with me in her arms. ''''Uh-uh.'''' Hmmm ... she''s a very pretty girl. Wow? Aunt Mila was lovingly stroking my head. My dad came back. I thought he would be small like his grandfather, but he''s normally tall. My mom is also tall, and apparently I''m going to be big. ''Um ... where are you from?'' Your kids, of course! What? They didn''t even know we were born, and they are surprised. ''I guess there''s no way to communicate long distance in this world. ''Utterly unfit to be a father, to not even be present at the birth. This is your father! My mom tries to give me away. "Can I hold her? ''You''re a father, of course it''s good. But you must be nice to him. Oh, yeah. Dad took me in. It stinks! This guy smells so bad that his nose is almost bent! Uh-oh. You stink. You should''ve given her a bath before you let me hold her. I turned back to my mom. Oh, it smelled.... The smell is horrible. I''d be crying if it weren''t for me. Afterwards, my sister and I were given names. Please. Please, please use normal names. "What about Kiki and Lara? ''I don''t know why, but I have a feeling that''s an absolute no-no...'' My mom was right. I screamed. "Nuh-uh-uh. You see, she doesn''t like it either. It''s true. Apparently, he got my message. How about Mario and Peaches then? Nuh-uh-uh. He didn''t want that either. Well then how about Osugi and Pico? Nuh-uh-uh. She hates it more. He''s not doing this on purpose, is he! Then it went through several terrible subversions. Eventually Dad said as he twisted it out. ''Hmmm ... how about Ark and Layla or something?'' It''s good for you, isn''t it?See, she''s nodding her head. I shook my head as hard as I could at the not-so-bad name that finally came out. ''Alright then, from today you''re Ark. "Mutual. And you''re Layla. Woo? This is how I ended up living my new life under the name Ark. ''''Fufu........Ark is really cute, isn''t he? Lately I''ve been walking around outside my house a lot, with my Aunt Mila in my arms. It''s a small town in the countryside where there''s nothing to see, but it''s refreshing for me, as I wasn''t able to go out much in my previous life. By the way, Aunt Mila has been taking care of me at all hours of the day and night. She''s always by my side when I go to bed, take a bath, or eat. Isn''t it a bit strange, don''t you think? Moreover, I''m the only one who takes care of him, and he doesn''t even look at Leila. ''''Mila''s grown up, taking the initiative to take care of my nephew. Right, Grandpa? Of course. Grandma and Grandpa are mildly amused, but Mom is looking at Aunt Mira with a scowl. ''Can I have Leila look at you once in a while? ''The boy is shy. So I think it''s better for his mother. Well, okay. I decided not to worry too much about it. 178-Episode 3 First is to build physical strength Ark, Leila. I''m going to start training you guys today. Kunlei? One day, Dad said abruptly. ''Yeah, training.'' Kunlei, Kunlei. My twin sister was giggling and laughing innocently. On the other hand, I was also very excited about it. After all, in my past life, I was never able to do any exercise or sports. I had a longing to work out. I was one year old. I was already able to walk around. Fortunately, my body in this world is in perfect health and I never got sick at all, even though I am an infant. However, I''ve heard that this world has a very low mortality rate for infants. It''s because of the goddess''s blessing. If it''s just a small illness or injury, it can be easily cured by this mysterious power. In fact, I have witnessed Leila''s cut, which she grabbed with a fruit knife, disappear in an instant. When I fell off the bed by mistake, the pain faded away in an instant. Perhaps it is because of this blessing that adults are able to leave toddlers alone unless they are in great danger. Leila, in particular, who was so curious, was always running around the house doing whatever she wanted, which made me feel more on edge than I was. Off to the side. Let''s get back to your father''s training. First we need to build up our strength. Tarry. Yeah, yeah, it''s definitely important to build physical fitness. Without a doubt, I nodded in my mind. ''Let''s run up this hill first,'' Dad said, pointing to a slope with an incline of about forty-five degrees. No, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no, no. We''re only one year old! Yippee! In contrast to my astonished me, Leila boldly plunges in. ''''Wow!'''' A one-year-old runs up a steep hill, screaming with joy. Huh?We''re going up...? As expected of an infant in another world. It seems that they have different physical abilities from the humans on earth. I followed Leila and ran up the hill. I''m going to be able to make it up........But it''s tight! Eeeeeeeeee.... I somehow made it to the top of the hill and flipped over on the spot. Leila, who had reached the top of the hill before me, was also lying on the ground. Then all of a sudden my body floated in the air. I was picked up by my father. I looked at her and saw that she was being carried by the opposite arm. Let''s go back downstairs. It. What? Dad was running down the hill at breakneck speed with us in his arms. Geez! ''''Wow~! Leila was flapping her arms and legs happily, but I was too scared to open my eyes. I got a little pissed.... ........but he''s a one-year-old, so it''s okay, yes. My strength had already recovered. It was all thanks to my blessing. But that means......... ''Okay, second one in a minute. I knew it! Then we ran up about ten hills in a row. I was recovering physically, but mentally it was hard. What a way to train a one-year-old.... But now the blessings are finally gone. Drink this. Dad brings out a bottle of liquid. I''m certainly drenched in sweat, so I gulp it down, thinking that I should rehydrate properly. It''s like water, but it tastes a little strange. ? I looked at Leila. Somehow, the blessings that were supposed to be missing had been restored. Dad said. Your blessing is restored when you drink the holy water," my father said, "so you can run hundreds of times in a row. Now you will be able to run hundreds of times in a row and build up your strength efficiently. I understood. This is where the real hell was going on. I was five years old. In a previous life, I would have been snotty and innocently playing with toys. And yet, for some reason, me and Leila had swords in our hands. Of course it wasn''t a toy or a mock sword. It''s the real thing. ''''Boohoo!'''' And what we are facing is a huge body that is almost two meters tall. From a child''s perspective, it looks like a mountain. It is a standard fantasy pig-headed monster, an orc. It is breathing heavily and glaring at us with a tremendous sense of intimidation. Mu, you can''t do that! Because we''re only five years old! Fighting an orc is beyond reckless. Don''t worry. "Don''t worry, you can beat the orcs now. But, says Dad, he''s the one who went out of his way to get the wild oaks. He''s the one who went out of his way to catch wild orcs. The gifted education (?) started when he was one year old. The two of us have certainly become stronger due to the new technology. We''ve gained enough physical strength that we wouldn''t get tired even if we ran for an hour straight, we''ve become reasonably good with our swords, and we''ve become able to use some magic. But as expected of an orc, that''s impossible! At least start with the goblins! Hey! Buhhhh? "Whoa, whoa, whoa, whoa! ''Pgaaaaah! -- I thought, but I was able to defeat it normally. ''''Did you...?'''' I couldn''t help but say the flag line with Leila, but the charred orc didn''t get up. ''We did it. So I told you.He said he could take down an orc already. ''Yes!Daddy was right! I know. Her father loves Leila very much. If only Leila had said "I don''t want to train," then maybe we wouldn''t have to train so hard. Thanks to this, her father also imposes even tougher tasks on her, just to make his daughter happy. ''Leila, I want to be better! Well said. So you''re going to be the next Wyvern. Look, like this........wait a minute!Wyvern! 179-Episode 4 Say Im sorry Of course we don''t train all the time. Sometimes the two of us even play a childish game together. Right now, we are playing tag. This time, Ark is playing tag!Catch me. I chase after Leila, who is running around in the forest at about fifty kilometers per hour in every direction. Every once in a while, Leila will release an attack magic, so I have to avoid it. ''''Garruah!'''' Get out of my way! Gah! Naturally, since this is a forest, there are times when demons come out. ''Hey, hey Befi!Grow up~! Sometimes it''s our housemate (?). She also plays with the following characters. Leila''s favorite is Befi. Hm. In the square away from the town, Befi shows her true form. It was a huge behemoth, a behemoth that was over three hundred meters long. It seems that they are not human beings, but followers of their father. Moreover, they are said to be mythical grade demons. ''''Wow!'''' Leila climbs up the behemoth''s body like a rock climber, running around at the top of a hill higher than a little hill. The behemoth''s elastic skin makes it bounce like a trampoline, which is apparently a lot of fun. ''Libby get big too!'' I don''t blame you. Libby is also a mythical grade demon. Normally Leviathan is supposed to live in the sea, but it seems to be able to live on land without any problems. ''''Waaaaaahhh! Leila is sliding down Libby''s long body at breakneck speed like a giant slide. She''s no longer treating the mythical grade demon as a complete park plaything....... ''''Wow, I am........'''' Fenny''s hot, so it''s good! Boom! Because it''s a Phoenix that''s always on fire all over, and if you ride it, you''ll get burned. Once before, Leila had tried to fly on Fenny''s back instead of listening to me, even though I had told her not to, but her blessing was soon totaled and she was in a lot of trouble. We lived those days, and before I knew it, we were eight years old. We were already strong enough to take down a wyvern, and even if we were left deep in the forest for training, the two of us were able to come back on our own. At his age, he already has a lot of experience in survival. ''''Hey, dude,'''' ...? One day. Me and Leila had been playing outside of town and as we were about to head home together, there was a group of people who called out to us. It was the boys of this town. However, they are probably older than I am now. ''Me?'' Yeah, it''s you, man. The boy who seems to be the leader among them looks at me with a mocking expression. You''re always playing with women, aren''t you!The effeminate one! I was suddenly dismissed. It''s true that I''m with Leila all the time, even when I''m not in training. It''s partly because we''re twins and we''re close, but it''s also because I don''t know what I''ll get up to if I leave Leila alone. But maybe that''s why I don''t have any friends of the same age. Well, I''m a junior high school student inside, and it wouldn''t be fun to play with boys my age anyway. Even so, I''m still feminine.... I don''t have any of those elements when I play with Leila, though. The playground is outside of town, so I''ve never seen us playing there. I''m sure you''re just imagining things. Do you know what they say? Did you know that their father is unemployed! ''Seriously?I didn''t know that profession existed! Maybe it was because I wasn''t moved at all, but they turned the brunt of it on our dad. They say it''s good if you can make fun of him, whatever you want. If you ignore such childish - but childish - slander, you can just ignore it.... ''Mmm!My dad''s awesome! It was. Leila was also a child. Her physical abilities were already in a different dimension, but her mental age was a straightforward eight-year-old. Moreover, she has a fatherly temperament, so there was no way she would stay silent after being disgraced by her father. ''''Of course you can''t do anything with an ''unemployed''. In this world, profession is everything. Just like this! The leader boy draws his sword from his waist. Then he makes a bare swing. ''''How''s that!During the recent blessing ceremony, I was given the profession of the Swordsman! After showing me a full range of sword skills, the boy said proudly. I was immensely disappointed. ........eh?What''s the big deal at all? Is this the Swordsman?Because it''s still right after the blessing? But the boy seemed to take my reaction as "scared". Ha, your father would kill you all in a heartbeat if he saw me! I don''t think that''s possible, do you? Oh, Leila! I noticed that Leila had shrunk to the ground and was moving in front of the boy. "Huh? The boy wasn''t able to react at all to Leila, who suddenly appeared in front of him. ''''Oh, you, when did you........'''' Hey, I don''t think you can beat Leila with a sword like that. ...Oh, my God! The boy slashed Leila. But the sword easily cuts through the sky. ''''This way? Uh, back!Don''t lick it! The boy flips his body around and releases a slash. Snap. Leila grabbed the tip of the sword with her bare hands. ''''Nah, nah........'''' The boy backed away with a bright blue face. But Leila smiled - but her eyes weren''t smiling - as she closed the distance between them, not wanting to let him get away, and said. ''Can you tell your dad you''re sorry?'' Huh. Can you tell my dad you''re sorry? ''I''m sorry!I''m sorry!Please forgive me! The boy yells frantically through tears. ''Don''t you ever say that again, okay?'' I understand!I won''t say anymore!Oh, you guys don''t say that either! Bum bum, his cronies also shook their heads in a hurry. Then they ran away like a de-rabbit. .........Yeah, let''s not say bad words about your father in front of Leila. 180-Episode 5 came out One day, his father said. Hmm, you two have worked so hard. You''re a lot stronger now than you were when your father was your age. Really!Yes! Well, that''s what you get for all that. We were eight years old. I started training when I was one year old, and it has been seven years now. Now we could even slay a dragon. But there''s one thing the two of you still lack: experience. That''s experience. Therefore, I''m going to embark on a practical training journey now. Journey!Yes! Oh, So far the only world I know of is this town and its environs. I''ve rarely been outside of town. That''s why I''ve always wanted to go to more places. Unlike in my previous life, I would have unlimited physical strength now. ''Going to dungeons, going to the demon world, and probably training harder than ever before. Yay! Up. Yeah, I knew that. It wasn''t really for fun. Still, I was excited to be able to go far away for the first time. The first place we came to was the City of Swords. It seems to be a city where skilled swordsmen from all over the world gather, and it seems that my father and mother had studied here when they were young. Since they are both from the same city, you might think they came here together, but your mother was here before you. Dad didn''t know that his mother was in the Sword City to begin with, and they just happened to reunite in the same swordsmen''s guild. Dad says. ''That''s where I first learned that Laina was a woman. What is that, a romantic comedy? I almost tsked. This was the land of our memories, but when we arrived there, we found that something terrible had happened. The City of Swords had been taken over by demonic tribes. ''''Oh no!'''' Don''t tell me that the City of Swords was dropped by the Demon King...? So where are we going to run to? These are the refugees who were saved from being attacked by demons on their way to the city. These are the people who heard the rumor of the resurrection of the demon king and wanted to flee to the city of swords, but if the city had already fallen, they were bone tired of losing their bones. I sent them into the nearby forest and we went to check out the city. Wait a minute. You''re not taking two of us? Of course you do, though? Then take me with you. No, Laina can''t do "covert", can she?As expected, they''re not going to do something like that to suddenly get in front of you. You can use Ark and Leila, right? I can use it, Dad! Ugh.... "Concealment" is already ingrained in my body. When your father left you deep in the forest of the magical world and you and Leila were the only two people who had to survive, you learned to avoid fighting demons as much as possible by learning the art of hiding. I ended up leaving my mom behind. I clapped my mom on the back as she slumped her shoulders. Well, well, we''ll need an escort for the refugees, so... ''Ugh, Ark, you''re so sweet...'' Hey, don''t cry, Mom! Demons and demons were strolling through the city. Leila and I were trying to stay "under the radar" to avoid detection as we followed our father. .... but many times I lost track of my father. It''s because I''m too good at killing the signs. Now I can''t detect him again and I stop. ''Huh?Which way? Well? Leila''s at a loss for words and she''s checking with me, but I have no idea either. This way. I heard a voice to my right. If they didn''t call out to us like this from time to time, we would have gotten separated from them a long time ago. We eventually arrived at a fortress-like building where a fierce battle was taking place. A fierce battle was taking place there. Is this really a human warrior?Too vulnerable!It''s too sad that such a creature rules the earth with its own face!After all, it is our demon race that deserves to be the ruler of this world! ...This is the demon race.... Incredible strength... The human side is overwhelmed by the gorilla beastmen. It seems that they are outnumbered. But........wasn''t it said that the City of Swords is full of talented people? Leila said on behalf of my doubts. Hey, Dad," she said, "are they holding back? Are they taking it easy on you?I don''t think that gorilla is that strong.... They had the same impression as me. ''''Oh, there''s no way we can beat a monster like that... at least if we had a guild leader...'''' "Don''t give up!We have a bunch of A-level swordsmen over here!And then there''s Mistress Lilia...Where is Mistress Lilia? ''Really?Before you know it, Mistress Lilia will be gone! Then I felt a presence behind me and I turned around. Dad and Leila also turned around. Zuzu Zuzu..... The stone at my feet moved and I thought a hole had been made, and then a hand came out of it. ''''Huh, it''s a good thing I prepared a loophole for this to happen. I don''t have time to fight a monster like that. Something came out. It''s a blonde woman. She''s probably a little older than your mother, right? But she''s young looking. The skirt you''re wearing, and it''s so short it feels a little painful. "...what are you doing, Lilia? ''What the hell?And Mr. Arrell!Don''t let me scare you!I thought a demon had found you! I think I knew your father. Leila asks. ''Dad, who is this aunt of yours?'' I''m not your aunt! Nah, you can''t do that, Leila, you can''t call her auntie... 181-Episode 6 Do I Have a Vision? Oh, hey, hey, hey! ''Mr. Gorilla, Mr. Gorilla, are you sure it''s all Leila?'' What did you say? That means I''m here too. What? The gorilla beastman fighting Leila didn''t seem to notice my movements at all. I called out to her and she finally seemed to notice, but it was too late. Bshhhhhh! A gorilla beastman collapses headfirst onto the ground. ''''Well, he defeated the demon race........'''' It''s really just two kids... I can''t believe... Hmmm, is it really that surprising? Daddy, I beat you! I saw that. Good job. But I thought the demons were a little bit stronger than that. Yeah, that was weak! Then an aunt who seemed to be called Lilia - an older sister - came up to me, smiling. ''''You''re indeed Arrell and Laina''s child!By the way, that boy, Ark, is his name again?How about an older sister or something? ''Put your hand on your chest and remember your age. Then we went to the city''s central square. Then the demons were gathering and many swordsmen were being held captive. One uncle was about to be eaten by a lion beastman. ''''Father!'''' It looks like your sister''s father. I''m going to go help him. After saying that, Dad flew to the square. It seems that the lion beastman was an officer of the Demon King''s army, but his father couldn''t do anything about it. This will be settled sooner or later. It''s easy for me to alter myself, but it''s really difficult to do so.... And then I realized something. It''s tough... What''s going on, Ark? Look at that. Perhaps in response to the loud roar raised by the lion beastman, the demons scattered all over the land could be seen heading here at once. If this was the case, the people in the square would be swallowed up and overrun by that wave of demons. ''''Leila, let''s break the restraints on those people. Yeah! You''ll have to help me-- Whoa, is that you?... well, never mind. I show up with Leila and we go to the square. We need to at least get them moving, or else we''re not going to be able to help them. "Hey, kid? ''How did you get here?We need to get out of here fast because it''s dangerous! We slashed the ropes that bound them, while they worried about us. It was hard for the two of us to break everyone''s bindings, but the pace picked up quickly in the second half as the freed person helped the others. In the meantime, my father was defeating the master of the demon race and making something with yellow magic. Is that........a sword? I need you to use this. A sword? ''And so much of it... where the hell did you get it from? Look, it''s coming out of the middle of nowhere, isn''t it? I can at least make a sword with yellow magic too, but as expected, it''s impossible to mass produce it that fast. It''s really haphazard, isn''t it, this guy....... Anyway, now everyone has a weapon in their hand and can fight. ''''Oh, oh, oh, oh, oh!'''' A horde of demons rushed into the square. ''Monks, stay behind me!We''ll protect you for sure! "Don''t you dare let a demon get near you two!The kids risked their lives to save us, as adults we have to pay them back! ""Hey!" Hmm? It sounded like a voice from behind... well, never mind. She''s not here!Where did he go?! Oh, there it is! ""Isn''t that dangerous?" Me and Leila took the lead and rushed into the approaching demon. ''''Explosions.'''' Both of them simultaneously unleashed their magic and blew the demons that were in the lead group together and blew them away. ''''........What?'''' Did you just use magic...? Oh, what''s impossible?There''s no way you can use magic on an unblessed child! Yeah? Magic is something you can learn to use normally if you train it, right? Gruffy? Surprised by the sudden explosion, we and Leila jumped into the crowd, taking advantage of the momentum of the demons that had decreased. ''''What are those children...?You''re moving so fast, it''s all I can do to follow you with my eyes...? ''An ogre with a single sword...?Oh, am I seeing a vision...? Well, I don''t think this is the time to be watching us fight but that demon we didn''t get to kill is on its way to you. I mean, you know, I just watched you fight. We don''t deserve to be compared to that. Wait a minute!Are those kids over there, too! It''s not possible to say that. ''They weren''t twins, they were quadruplets! ''No, look!They''re over there!s*xtuplets?! No, of course not. They''re alter egos, alter egos. Unlike my father, we can only create two of each of our own at the same time. And that can only last for a few minutes at the most. If it''s too long... well, it''s going to be okay. I noticed that the number of demons was greatly reduced. Leila and I also did our best, but most of the credit goes to my father. The total number of demons defeated by the others is only a fraction of your father''s total. Even though this is the city of swords, I heard there are ordinary people living in it, and many of them probably held swords in their hands for the first time. Eventually, we succeeded in clearing out all the demons. We saved the Sword City from the Demon King''s Army. 182-Episode 7: This is not a childrens playground I can see it. That''s the magic city. ''Wow!It''s in the middle of the lake!That''s neat, Ark! Yeah, I guess so. After saying goodbye to the City of Swords, we came to the City of Magic. It is said that excellent wizards from all over the world gather here and spend their days studying magic. It''s not just a matter of time before you get to know them. Six? ''''Ah. I''m specializing in red magic, blue magic, yellow magic, green magic, black magic, and white magic. ''Huh?Why don''t you do it with me?I wish I could learn everything at once! ''''Well Leila, your mother doesn''t know much about magic, but you shouldn''t say that in town too much. Mom, why? It seems that this is the first time a mother has come here who can''t use magic. Being able to use magic would come in handy in many ways, and it would be nice if mom could practice it. Apparently, unlike the City of Swords, this place didn''t seem to be occupied by demonic tribes or demons. The streets are lively and people seem to be going about their daily lives as usual. We came to the Red Academy. I heard that my father used to go there, but when I went to the office, he was treated as a suspicious person. When we were about to be kicked out of the premises at this rate, an older man in his mid-20s approached us. ''''Master!Aren''t you the master! "...who?I don''t remember taking an apprentice. Hey, it was me!I''m a kite!Have you forgotten?! It seems that he was an acquaintance, or rather a pupil, of my father. Through the arrangement of this brother, who seems to be Kite, we were able to get a tour of the academy. ''''That''s right!There''s a training facility that just opened recently. Would you like to take a look at it? Hmm, that should be interesting. I was taken to a newly built training facility. They had a field there that was designed for real-life combat. There are three types of fields. The first is the city. Then there are the forests and the rivers. And the last one is the palace. I felt like I was in a game. I was pulled back with a nip and a tug. When I turned around, I saw Leila''s eyes were shining. Oh, that''s an annoying pattern. From the characteristics of my twin sister, who has been with me since she was born and now knows it all too well, I instantly guessed that. "Ark, let''s play Mogisen over there, too! Okay, but do we have permission? The next thing I knew, Leila was pulling me by the arm and I was floating in the air. I had become like a koi-nobori (carp streamer) and was helplessly jumping into the field of the city with Leila. There are no people in the city, but the buildings and roads are exactly like the city itself. There are things like overturned carriages on the ground. I wonder what they''re made of? I was curious, and when I touched the carriage, I found that it was quite hard. Normally it would be wood, but it seems to be made of metal. Probably to prevent it from breaking even if it''s exposed to magic. ''''Where did you guys come from!'''' Suddenly, I heard shouting. I looked over and saw a group of high school-aged men and women with annoyed looks on their faces. ''This isn''t a children''s playground!It''s dangerous and we need to get out of here fast! Probably the students of this school. It seems that they were about to use the field and we got into it. I''m sorry. I''ll be out in a minute and-- Are you guys going to be in trouble?Then mix us in! Hey, Leila. Leila calls out to them, interrupting my words. ''Haha!It''s still a few years early!If you''re blessed and lucky enough to be a wizard-type profession, you''ll be back! ''That''s right, sweetheart. This is a field for magical warfare. It''s only available to those who can use magic. I can do magic.Look, look. No, no, no, you can''t do magic on an unblessed child-- "Firelance. D''oh! The spear-shaped flames struck a nearby building. ''''........What?'''' ''Wow!Wow!I''m not broken! While her brothers are stunned, Leila is delighted that the building is almost intact. It looks like it''s built pretty solidly after all. ''''Why don''t you make it stronger?Explosions. Doggone it! A furious explosion hit the building. This time the walls have melted away. But the building itself was still intact. Wow, that''s not broken! Leila is surprised. Her brothers, on the other hand, look at her in disbelief. Oh, my God...?It''s supposed to be made of a special building material with a magical barrier attached to it... I mean, didn''t you just use the Explosions...? Leila smiled and said to her brothers. ''Hey, you can do magic!Can we play mogisaeng with you? ".......... For some reason, the brothers backed away, their faces twitching. ''Yo, we just remembered our business!Sorry, guys!I''ll see you tomorrow! Oh, come on!Wait for me! ''I''m not feeling well today either, so I''m going to take the day off... but take care of the rest...'' You were fine just now! Somehow, one by one, one by one, they leave as if they were running away. Eventually, the last one, too. ''Oh, yeah, I forgot to study for the test. So I''m going to go home right now, but you guys are free to use it as you see fit. Okay then! He said that and returned. ''You''re all busy!'' ''Hmmm, I don''t think it was like that but...'' We ended up having a mock battle, just the two of us. 183-Episode 8: Eramination It was decided that I would be staying at the home of Kite, who said he was his father''s apprentice. ''Please come and stay at my house,'' Kite invited me to join him. ''I live with my wife now. You''re married? Yes. A year ago. When I went to the house, I found the woman I met at the academy earlier, Koofa-san, who was there. Apparently she was Kaito-san''s wife. Kaito-san is a professor at the red academy and Koofa-san is a professor at the blue academy. There was also a woman named Colette who was a childhood friend of both of them at home. That night, Leila and I were resting in the same room. Suddenly I felt an unpleasant feeling and woke up. "......... My eyes met with Leila''s. Apparently, Leila sensed it too. We had come to naturally wake up whenever danger approached, no matter how much we had fallen asleep. It''s a feeling that we absolutely had to acquire in order to survive in the dangerous forest, where demons abounded. Otherwise, we would be attacked in our sleep and die. Anyway, the fact that we were all awake at the same time means that we are definitely in some kind of danger. Just then, the door to our room opened, and something jumped at us. ''Yo!'' "Ei. The two of them ducked it and quickly decided to joint and seize it. ''''Woah!'''' A slender woman flails about, emitting an animal-like voice. And yet, with considerable force, she tries to force her way out of the joint despite the fact that it''s a determined joint. If this is the case, my body will break. Me and Leila simultaneously used white magic to force the intruder to sleep. Then we saw their faces and we gasped for breath. ''''This sister........'''' It''s Mr. Kufa. The cause seemed to be vampires. The seemingly peaceful magical city had been ruled by vampires without anyone knowing it. ''We will defeat the vampires. I''ve tracked down their whereabouts last night.'''' We decided to raid the vampires'' stronghold in the daytime, following our father''s lead. They didn''t like the sun, so they hid in the basement of the building during the day. And since most of them were sleeping soundly, we succeeded in taking them by surprise. ''''Huh?Two, human...? Holy Ray. Giaaaaahhhh! And so we steadily wiped out the vampires in our base. ''Okay, that''s all of them.'' It''s over. When we finally finished crushing all the bases, a vampire with a powerful magical power that set us apart from those we had fought before appeared in front of us. ''''You two try it together.'''' ''Yes!I''ll do my best! ''What?Are we going to do that? Her mother raised her voice. ''Hey, wait a minute!This guy''s not just any guy!Probably the head of the Demon King''s army!I don''t care how dangerous it is! Don''t worry. You''ve got a good match. Well, I''m used to my dad''s recklessness. ''''Kukuk........hahahahahaha!The kid?You know who I am?Human parents are terrible with themselves for being the first to sacrifice their children. All right, son, let''s not be so careless. It''s already started. What? As his father had said, Leila was slashing at the vampire in flesh and blood. She slashed her neck with a zap. I''ll be fine! The wound disappeared in an instant. It seems to be on a different level than the previous guys, after all. But how about this one? I used white magic and put a purifying light on my sword. With it, I slashed the vampire''s back. ''''Kukuku, I''m a true ancestor, right?Whether it''s cleansing magic or sunshine, it''s not valid before me here. A vampire with a slight twitch in his cheeks, perhaps a little irritated after being attacked by two children, laughs at the vampire with a slight twitch in his cheeks. ''''Ark.'''' Yes. That exchange alone was enough to get through to me and Leila. It''s not like we''re playing twins on the date. I''m not going to be able to say that I''m not going to be able to get it right. Though only slightly, Leila is good at red, yellow and white, while I am good at blue, green and black. It''s a good idea to be able to have a good time with them. As I expected, Leila''s magic power separated into three types: red, yellow and white. For me, it''s blue, green and black. The six types of magic power are mixed together by our connected hands. ........In practice, I''ve never succeeded in this before. But I think it''s possible to do it now. Ready, go! "Illumination! My voice and Layla''s voices overlapped perfectly, and at the same time, the strongest magic that could annihilate all forms of matter was unleashed. The vampire that until a moment ago had been completely ineffective no matter how much me and Layla had attacked it, disappeared without even being able to raise a decapitated voice. Probably, it was impossible for him to even realize his own death. ''''........Defeated it?'''' Yeah, maybe. Yay! I exchanged high fives with Leila. This is how the magical city was also freed from the control of the Demon King''s army. ''''Okay, let''s go to the Demon King''s place to train the two of us. What? The western part of the continent was the first region to be threatened by the Demon King''s army. Most of the countries and cities had already been occupied, and the cities that were still resisting were being driven to the brink of falling. The Edelheid Kingdom. This country located in the western part of the continent had also been attacked by the Demon King''s army. The major cities were destroyed one by one, and only the royal capital was left. However, the capital was also attacked by the Demon King''s vicious army, and although brave soldiers are still somehow preventing it from falling at the water''s edge, it is only a matter of time before it falls. ''''O~a~........'''' It''s me, Leanne!Please stop this!I don''t want to hurt you! Don''t think it''s one of us, idiot!There''s no reason to be rational now that you''re undead!For that man''s sake, make sure you kill him right here! Shit I''m sorry, Leanne!Whoa, whoa, whoa! The warriors were tormented by those who were supposed to have been their friends just a few moments ago. I''m sure you''ll find a lot of people who have been killed by the demons, but they have turned into undead and are attacking you. Perhaps there is a necromancer on the side of the Demon King''s army. Thanks to this, the more troops on our side were lost, the more enemy forces were lost, which was a nightmarish situation. Eventually, that demon''s hand was closing in on the royal castle located in the center of the royal capital. 184-Episode 9: Living humans are not crap ''....Father.......brother....... The basement of the royal castle. In the basement of the castle, built as a refuge for emergencies, there was a girl cowering on the ground and trembling. She must be only about ten years old. She is a pretty girl with beautiful silver hair, but right now her face is pale from fear. ''''And there is no need to worry, Your Highness. Your Majesty and Your Highness will be safe...'''' It was her personal maid who tried to encourage the girl by saying so. However, the fact that her voice had fallen to the bottom of the barrel indicated that she herself had strong misgivings. The girl was a princess of this country. While her father, the king, and her brother are fighting to protect the royal city, the young girl is hiding in the basement of the castle. She doesn''t know what''s going on outside at the moment, but she is told to take shelter here. But the girl could tell from the soldiers who had told her to take shelter here that the war situation was not good. Thump, thump, thump! " " " The sound and vibration of something punching in the air that I heard made me tense in the basement. Zudo-On! The sound of something being destroyed followed. Everyone understood that the door to the entrance to the basement here had been broken down. Of course, it was not a door that could be easily destroyed. Thump, thump, thump! This time it was the door right there. If this was breached, it would no longer allow the enemy to enter the crypt. The few female soldiers escorting the princess prepared for the worst of what was approaching, with their weapons at the ready. With a loud crash, half the door was blown off. The one who appeared from the other side of the destroyed door was a huge man nearly two meters tall. ''''Hah!'''' The soldiers stifled their fears and pounced with a spirited yell. Their first strike succeeded, and their swords wounded the giant man''s body one after another. ''''Nah........'''' That''s when they finally realized what the huge man was and gasped. It was a bizarre creature. The head was probably a lizard, and the muscular torso was that of a minotaur. One of the arms was that of a giant race, and the other was a mantis-like scythe. Its legs are completely birdlike, with what looks like fish tail fins sprouting from its buttocks. In addition, a giant snake writhing between its legs. It is a chimera. However, it is different from a mere chimera in that it does not seem to have any life force. If you look closely, you can see that there are parts of its bones and organs sticking out, and it smells like a rotten nose. It was an undead monster chimera. The face of the lizard glowered at the soldiers. There was no emotion in its eyes. Because it was undead, it seemed that the earlier attack had no effect at all. ''''Hee........'''' A giant mantis scythe is waved at the soldiers with a throaty sound. ''''~~~!'''' With that, their bodies were cut in two, and their crying upper and lower bodies rolled on the ground as they were separated from each other. Only the helpless princess and her maid were left behind. They slumped to the ground with bloodless faces. Then something happened to catch up with them. The soldiers who were supposed to be dead after being mutilated have started to move. --They became undead. And just when you think they''re getting close to the chimera that killed them, it''s taken into their bodies and fused with them. The princess and her maids are no longer able to speak because the scene is so fearless. ''Ho-ho-ho, how do you like it, ladies?It''s not often that you get to see my wonderful show, is it? At that moment, an out-of-place fluent voice could be heard. Beside the undead chimera, an ugly looking old man had been standing beside it for some time. He was only as tall as a child, but he gave off a strange vibe. ''''Huh........'''' Hmmm. I''m asking for your thoughts?I''m so moved that I''m at a loss for words, right?Ho ho ho! The old man clapped his hands there as if he noticed something. That''s right. I must introduce myself. I am Necro, one of the leaders of the Demon King''s army, and the world''s greatest necromancer. However, I am about to take on a new title. A land of the undead by the undead, for the undead - that''s right, the new king of this land! That''s right, this old man is the commander of the demon king''s army that attacks this country. However, even though he was the commander, the subordinates he brought with him were only a few dozen demons at most. The rest of them continued to expand their forces by turning the corpses they procured locally into undead. With just one person, he could control hundreds, or even thousands of undead. His self-proclaimed title as the world''s best necromancer was not an egoistic one. ''''Why would you do such a thing........?Are you not a human...? When the girl realized that the old man in front of her was the culprit, her anger outweighed her fear, and she shouted out. There was a time when I was human, but now I am undead. There was a time when you were human, but now you are undead. The old man was not a demon race. He was originally a human. ''''They were the same human, so why...?'''' Ho-ho-ho, of course. The old man smiled cheerfully and approached the female soldier, who had fused into a chimera, and hugged her head lovingly. I like the undead. I like the undead," she said, "they''re not very good at what they do. They look down on people, despise them, and try to ostracize them. But the undead are always my friend. And they will do what I want them to do. Good boy. ......... The girl couldn''t help but exclaim at the old man''s thoughts, which were so twisted. ''Ho-ho-ho, you can rest assured. The little girl will soon be joining you. No, no... The girl retreats with the maid. But it''s a small basement. Soon her back hits the wall and there is no escape route any longer. And that''s when it happened. ''''Well I see, you''re the necromancer who controls the undead. A boy walked into the basement. 185-Episode 10: Its faster to hit the genius It seems that the Demon King''s Castle is located in the west. Based on such rough information, we headed westward to the west. On the way, we saved a number of towns, villages and cities from the Demon King''s army. It seems that the further west you go, the worse the situation becomes. It seems that we really need to defeat the Demon King as soon as possible. It''s said that heroes once defeated him, but I wonder if he''s gone now? Are you really trying to get to the Demon King? Hmm?Yes, but? You might be alone, but you''ve got kids to take care of. That''s why. It just seems like good training. Training... Your mother gives you a dumbfounded look. It''s true that what your father says is messed up, but if we can defeat the Demon King, it''s certainly better to do so. If left unchecked, the damage will continue to increase. I''m looking forward to it!Hey, Ark! Uh-huh. It''s usually Leila who''s ready to do it. It doesn''t matter what your mother and I say anymore. In the meantime, we stopped at a city. I''m not sure if I should call it a city or not. It''s a good thing that the city is protected by a fine wall and has a reasonable amount of troops, as it seems to be the royal capital of the country that governs this area. Still, when we arrived, the city was on the verge of falling. The city gates were breached and the demons were allowed to enter, and they continued their desperate resistance. We watched the scene from the top of the city walls. ''''Hey, Dad, are the soldiers fighting each other?'''' ''Hmm, looks like you''re dead and turned into the undead. It was a horrible scene. I had been a friend of mine earlier, but now I had to fight my opponent as an enemy. Moreover, every time an ally dies, the enemy''s strength increases. The battlefield is spread out..... Let''s split up. Are you two alright?'''' Yeah! Yes. ''Okay, then me and Laina will head out of the castle gates to that castle in the center. Ark, take the right and Leila, take the left to the castle. The fiercest battle is on the main street, which stretches straight from the breached gates. Nevertheless, the battlefield extends from there to the left and right. Leila and I jumped down from the ramparts, telling my mother, who seemed concerned about whether I was going to be okay on my own, that I would be fine. Leila and I parted ways, and I headed for the castle from the route on the right. ''O~a~'' Immediately, the undead attacked us. By the looks of it, it was a civilian. He was probably killed by a demon and turned into an undead person after he failed to escape. ''''Holy Ray.'''' Ahhhh? Purifying magic works on the undead. The undead bathed in the light crumbled to the spot and became quiet. After that, the undead continued to approach one after another, and I sent the purifying light to them. ''''What, what...?The undead have stopped working...? A child?Hey, look out! No, look closely!That kid is using purification magic on the undead! The soldiers are surprised to see me. ''''Gruaaaah!'''' Oh, look out! A large bear demon with four arms jumped at me, probably thinking my presence of purifying the undead was a threat. Well, it''s useless. Zang! ''''~~~~~~~~~?'''' The slash I fired cuts the bear''s body in half. ''''Eh.........?'''' What the hell just happened...? The soldiers are rolling their eyes. Yeah, I guess the undead around here have been taken care of for the most part. I decided to leave the rest to the soldiers and continue on. ''''O~a~'''' Uh-oh. ''Wow, that''s a lot ... let''s take them all down together. Holy Cross. The city is really full of undead. It seems that people who have been killed by demons have become undead without exception. There should be a necromancer in there.......but I can''t feel any sign of him nearby. Is he controlling them from a distance? ''What is it.......I can feel a faint flow of magic.......? I concentrated and tried to sharpen my senses. Then I gradually understood the flow of magic power. ''''It''s coming from.......the castle. It was just the direction I was heading. ''The sooner we hit the source, the sooner we hit the source, right? Having decided that, I ignored the undead and sprinted to the castle. The closer I got to it, the more clearly I could see it. The main culprit controlling all the undead in the city is inside the castle. Moreover, he is probably controlling this many undead by himself. Moreover, if he is remote, he must be a master of necromancy. Increasingly wary, I jumped over the wall and entered the castle. A fierce battle was raging in the courtyard. ''''Ooohhhhhh!'''' While roaring a roar, the one that cleaves the soldiers is a monster that seems to be a fusion of various demons. I think it''s a chimera or something. I wasn''t sure if I should join them, but I walked past their side in "stealth". The undead are already wandering around the castle. A woman, who was probably originally a maid of honor working in the castle, attacked me while shaking her hair. ''''Holy Ray.'''' While purifying the undead, I ran around the castle, but the maze made it difficult. But thanks to the maze, I had a hard time finding my way around. And finally, I arrived at it. "...here... There was a solid door that had been destroyed. At the end of it was a staircase that led to the basement. I killed the signs and went down the stairs and found the basement. I finally found it. The threads of magical power stretching throughout the city are converging in one place-- So you''re the necromancer who controls the undead. 186-Episode 11: Ill beat you The first thing I saw when I entered the basement was a fearless monster. The head of a lizard and a huge, hairy body. Its legs look like a bird, it has a vanguard-like sickle, and it has something like a fish''s caudal fin, so it can''t be considered an existing creature by any means. Moreover, faces, arms and legs that seem to belong to humans are sprouting here and there. Maybe it''s a chimera. However, it can''t be alive with this kind of fusion; it''s probably in the form of an undead creature that was forcibly attached to the body. And the one controlling this undead chimera is........that guy? He''s a wrinkled old man. It''s partly because his waist is bent, but I''m sure he''d be shorter than me even without it. He''s ugly looking like a goblin. There was a creature like this in a science fiction movie I saw in a previous life. ''Ho ho ho, look who it is, it''s a child. The guy turns to me and laughs. "So, you''re the necromancer with the undead. ''....Huh?How do you know that?No, it''s just a child. But still, he''s a very interesting kid who didn''t run away when he saw this one. Then a screaming voice came from the back of the room. ''Hey! It''s not safe here!Run..........! I couldn''t help but feel a sense of shock. There was a girl with silver hair. She was probably only ten years old or so. In a past life, she would have been around sixth grade or first grade. You may have been attacked by this necromancer, or your face is pale with fear, but she''s still a pretty, pretty girl that won''t fade away. If she were at school, she would be a captive audience for all the boys. And in this dangerous situation, she''s worried about others, screaming and shaking her voice. He must be a kind-hearted boy. ''What are you doing!Ha, run away quickly.........! Oh. I couldn''t help but fawn over her. I was about to waste all the justice she had given me. Of course I''m not going to escape. ''Don''t worry, I''ll take him down.'' "Ho-ho-ho, that''s interesting. This is one of my masterpieces. A boy like you is just one twist. The undead chimera leapt at the necromancer''s command. The vanguard scythe is unleashed. I ducked and ducked as I lowered my body to duck it, and then I delivered a counterattack sword. I cut deeply into the body of the undead chimera, but it doesn''t seem to be working at all. On the contrary, it wields a stiff arm like a giant race and strikes at me. ''''Huh!'''' I jumped back and tried to avoid it, and before I knew it, there was a snake wrapped around my leg. It''s a snake extending from the crotch of an undead chimera. It''s disgusting. An oncoming fist. I forced the snake to pull() a thousand() cut() back and avoided it. Perhaps because of the poor balance of my body, the undead chimera that struck out was greatly displaced. Taking advantage of the gap, I slammed in a series of blows. ''''You, you''re a swordsman!No, you shouldn''t have received the blessing yet to begin with... Even if you don''t have a profession, though, you can at least use a sword. Even though his entire body was slashed to pieces, the undead chimera stood there as if nothing had happened. It seems that physical attacks don''t seem to be very effective after all. Moreover, the wounds are being sealed by the flesh that has been raised from within. ''''Ho ho ho!It''s no use. It''s no use. No matter how many times you try to attack it, you cannot defeat it. I suppose there''s nothing I couldn''t do, but I''d have to do you sooner. What? I used my Divine Legs to get behind the necromancer. If we defeat this thing, the undead chimera will lose its power. No, don''t-- Thud! The necromancer''s head flew off. It spun around and fell to the ground. ''''Ki, you........ Apparently, it doesn''t die from being beheaded. Perhaps this guy himself has turned into an undead person. ''''Wait, wait, wait........! He was staring at me with grudge-laden eyes, but when I approached him to finish him off, he suddenly began to get upset. Wah, I am a human being by nature!I didn''t really want to do this!But I was ordered by the dreaded Devil King to... Oh, please!I will never have anything to do with the Demon King''s Army!So just save my life! He gets teary-eyed and pleads with me. Just for your life, you''re already undead anyway. And that''s when. The undead chimera from earlier jumped at me. I ducked the wielded scythe as quickly as I could. Then, while the distance was open, one of the arms that grew out of the undead chimera''s body grabbed the necromancer''s hair. Holding his head as it was, the undead chimera escaped. ''''Ho ho ho!Let''s just retreat for today! Of course, there''s no way I''m going to allow that. ''Holy Cross.'' ''''~~~~~~~~~?'''' The light of purification burns the undead chimera. ''''What the hell?How can you use cleansing magic?And the power of that........! The undead chimera flipped over as he lost his balance by aiming for a bird''s foot. With that beat, the necromancer''s head rolled on the ground again. ''''Well, wait--Gyaaaaah! This time he stomped on it, bathed in the light of purification before he could utter a plea. The body of the undead chimera disintegrated. Apparently it had been forcibly magically fused together, and with the death of the necromancer, it was probably impossible to maintain it. Now there should be no more new undead born. 187-Episode 12: That famous dialogue After defeating the necromancer, I was able to meet up with my dad and the others right away. It seems that they had already reached the castle and were just purifying the undead in the castle. ''So it was Ark who defeated the necromancer? Yes. Good job. Leila did a great job! Good, good, good, Leila. Apparently, his father had sensed the presence of the source of the problem too. Or rather, did he know it all along? Maybe that''s why I told him to keep going for the castle. ''What''s outside the castle?'' We''re almost done. Looking from the castle''s balcony, it seemed that the battle was indeed all but over. The dead were no longer turning into new undead, and the soldiers would take care of the rest. The undead chimera in the courtyard has been defeated as well. I don''t know if it was my dad or if he destroyed himself because I defeated the necromancer. The undead that were inside the castle were also swept away, and as I was about to leave the castle, the soldiers came running up to me. They blocked our path, so we stopped in our tracks. ''''Hm?'''' A belatedly, a richly armed man came forward. "Thanks for the help earlier. If it hadn''t been for that, that chimera would have wiped us out. What about you? My name is Rahardt. I''m Rahardt, King of Edelheid. He was the king. Dad, I just said "you" or something like that. I see. The necromancer who controlled the undead is defeated. I don''t think there will be any more undead born in this world. Oh, really? Yeah. Even though it turns out he''s a king, his father''s attitude hasn''t changed at all. Well, it''s just like him. ''Your Majesty, I have a report!Most of the troops have succeeded in subduing the enemy!If you ask, you''ll be joined by a mysterious young man and a woman with red hair... oh. Hmm, I''m not old enough to be a young man. You''re not...? Then the king insisted on thanking him, but his father was adamant about it. ''I didn''t do it for a reward, you know. Besides, I have to get to the Demon King''s Castle as soon as possible. What... are you trying to defeat the Demon King? ''Yeah. If there''s someone else to beat me, that''s fine. The king seemed impressed. ''What a wonderful young man.... To be willing to risk everything to fight for humanity........ The main thing is training these two, though. No, let''s shut up about that........ ''You''re going to take a bunch of kids who aren''t even that old! Don''t worry about it. Both of them are strong enough to take out the leaders of the Demon King''s army. But you haven''t even given your blessing yet... Don''t worry about it, Grandpa!Leila, you''re so strong! Hey, Leila! How can you call the king an uncle? The people under my command only smiled bitterly and did not seem to blame me. And so we left the country, receiving a grand sendoff from them. ........Speaking of which, is that girl ok? After that, he left right away, leaving it to a woman nearby.... I should have worried about him a little more like a man... or maybe I''m just embarrassed when a younger boy does it to me. I wish I could have at least seen his face one last time. ''What''s wrong, Ark?Just zoned out? Hey, it''s nothing. ? We''ve finally arrived at the Demon King''s Castle. ........Normally, the defeat of the Demon King would be a challenge for the brave men and women to take on together with their friends who have overcome many ordeals together, right? We''re just one of those families that''s in an awful lot of trouble. Besides, me and Leila are only eight years old. No, there''s a Drue 5.... We''re just twins, so I guess I should think of it like that.... Anyway, we rushed into the Demon King''s Castle. On the way, when we were surrounded by a horde of demons and monsters, my father summoned his followers. Yes, it''s really like Drue 5. The lineup of those demons are Behemoth, Leviathan, Phoenix, Advanced Demon, Gratney Slime, and the demons that you can join at the end of the story, all raised to level 99. They alone kicked off the horde, and we easily made it to the Demon King. They are called demons, and are not that different from humans in appearance. It''s a bit like a large human body, and if your skin isn''t red, you might not be able to distinguish it from a human. Have we met somewhere? No, it can''t be! When his father asked, the Demon King did his best to deny it, as if he was impatient for some reason. ''''More importantly, I never thought you would show such power against my Demon King''s army. You are too good to kill. What do you think?Why don''t you come work for me?If you come under my command, I''ll give you half the world. Ooh, that famous line is out! No, I don''t want the world. Dad''s answer was immediate. Wouldn''t he normally be a little more worried...? Oh, right. Then you will die here! The Demon King shouted and released his power. Normally, the Demon King isn''t something you can defeat on your own, right? Well, is there something wrong with the father who "altered" himself into twenty men? It''s not like Tenpyo, where the battle power is not split. Anyway, this is how we succeeded in defeating the Demon King. 188-Episode 13: That line is probably the third time After I returned home after defeating the Demon King, the rigor of my training softened from before. This was because my grandfather and grandmother were angry at me. They said it wasn''t the kind of thing they would impose on an eight year old child, after all. However, the "play" with Leila that has increased in its place is as hard as it gets after all, so to be honest, not much has changed. Today, Leila took me to a dungeon about a hundred kilometers away from the town, and I got into all sorts of terrible trouble. Just like that, the months passed by and before I knew it, we were ten years old. That''s right, we are at the age to receive the Blessing Ceremony. And the day of the Blessing Ceremony arrived in the blink of an eye. ''As I was thinking about what profession Ark and Leila would be given, Grandpa, I was so nervous I couldn''t sleep at all yesterday! Well, so is your grandmother. You both know that''s probably the third time you''ve said that.I''m old enough to have to get a good night''s sleep. It seems that the whole family will be participating in the blessing ceremony, and even Grandpa and Grandma were all up in the morning. My dad is the same as usual, though. By the way, our house is a two-family house. It''s like a new addition to an old house that originally existed, and there are eight family members and four squires living together. Initially, we were going to build a new house on a piece of land some distance away and move in, but grandpa said, "I knew we''d miss you! and made it possible for me to live with them. I had only just been born, but I remember that moment because I was a reincarnation. Huh, hmmm, you two don''t have to be so nervous!It''s just what''s going to happen, so just be willing to take it all in! You''re the most nervous person I''ve ever met! Yeah, yeah, no way! Mother, your voice is rising. "Oh? ''Now your brothers are going to get their blessing. Fear will be staying at home with mommy. Uh-oh. In her mother''s arms was my little sister, born just a month ago. Yes, the eighth in the family. She was named Fear, and she was growing up fine, but as expected, I couldn''t take her with me. I don''t know if she understands her mother''s words or not, but she''s staring at me with round eyes. No, you don''t understand, as expected. Even though it can''t be helped because of the baby, the mother looks anxious. ''''Let Mira take care of Ark. ''Why just Ark......... You''d better take care of Leila too, okay? ''We''ll think about it. Ark, no matter what profession you give me, your sister is on your side. "?Umm, yeah, thanks, Mira sister. I''m confused, but I thank Auntie Mila--sis, who is looking at me with loving eyes--for her help. You''re always favoring me, aren''t you, Auntie Mila? I don''t know why. I call her big sister - some say she calls me big sister - but she''s actually my dad''s little sister, or aunt. She''s just ten years older than him, so she must be twenty years old now. She''s beautiful like her grandmother and has a good figure, so she seems to be very popular with the young men in the neighborhood, but I''ve never heard anything frivolous about her. Sometimes she wanders off, but usually she stays home all the time. .........maybe he doesn''t work? Unlike your father, though, it seems to be a [senior position]. I''m sure there are two types of jobs: Basic and Senior positions, and senior positions are rare. It''s because it''s only by mastering the "basic" position that you can become a senior position. However, I''ve heard that your father''s "unemployed" can''t become more than "unemployed" no matter how hard he tries. We came to the temple. Children of the same age and their families are gathered in the chapel. ''Then I would like to begin the blessing ceremony. The priest told him. The priest in charge of the previous priest retired due to his age, so he seems to be a new person this year. He''s still young, maybe in his mid-twenties. He was a stocky, slender, slightly nervous-looking brother. One by one, we stepped forward and prayed with the priest. Soon it was our turn. ''You can start with Leila,'' Thanks! Leila prays in front of the altar. ''This is.........'' The priest''s brother opened his eyes. ''''Well, Magic Sword Princess...?is a profession I''ve never heard of.... The chapel buzzed. ''Is that great?'' ''''I don''t know... but from the name, it''s probably higher than the Magic Swordsman, which is the [Highest Position]... in other words, it could be the [Highest Position]...'''' More chapels spring up. ''Wow, what a new profession...'' And it''s the [highest level]... ''Leon''s grandson.......that family is special after all.......'' Leila came back. It''s the "Magical Sword Princess"! Hmm. I suppose it''s a job that combines the "Magic King" and the "Sword Princess"? I''m sure it''s a common occupation anyway. ''Good for you, Leila.'' ''Yes!I hope you get a good ARC too! I then walk to the front of the altar. Leila and I are twins. It seems that our professions are strongly influenced by our bloodlines, and if we''re twins, it wouldn''t be strange to have the same profession. Maybe that''s why I could sense the strong gazes from the surroundings without having to look at them. No no, I have to focus on my prayers right now. And so while I was praying to the Goddess, a letter appeared in my mind. --Unemployed. 189-Episode 14: Its the same as Dad Gee, cheer up, Ark!No matter what profession you are given, you are my little boy! Uhhh? I went home and reported to my mom and she was desperate to comfort me. Fear gave me a strange look. ''Don''t worry about it, Mom. Because it doesn''t make much difference whether you have a job or not, does it? Dad said. ''It''s just that your father is crazy... no, but should we just let it be that way...?'' Mom snorted with a difficult look on her face. ''It''s a good thing I''ve drilled a lot of stuff into you since you were a little girl, as these things happen. I guess I wasn''t wrong after all. It''s his dad who nods with a look of pride on his face. ''Ark is matching your dad...'' Leila said with a bit of envy. It is said to be an outlier in the middle of the [unemployed], but to be honest, it didn''t bother me at all. The same "unemployed" father is like this..... Anyway, a father and son being "unemployed", it''s a completely useless family lineage if you only look at the characters. The only thing I don''t like about it is that the reputation of the people around me is troublesome. Seemingly having heard the rumors, the grandmother of an item shop in the neighborhood came to our house with concern. She''s almost 80 years old and is totally bent over, and when she grabbed my wrinkled hand, she said with tears in her eyes, "Oh, you poor thing. She said with tears in her eyes, "Oh, poor old lady.......I can''t believe we''re all going to suffer the same fate.... Uh-huh. ''Stay strong ... stay strong ... don''t run away from your family without telling them like your father did ...'' I''ll be fine. It''s not like he ran away from home, Dad. He used to go to a lot of places to train and he thought he was a runaway and he still believes that. The rest of the kids in the neighborhood made fun of me. Well, if they see Leila''s face, they turn tail and run away. It seems that not only my "unemployed" but also Leila''s "Magical Sword Princess" has become a rumor. So, I easily accepted my "unemployed" status... but after a while, I was faced with a problem. Up until now, Leila and I were almost evenly matched in power, or perhaps I was slightly ahead of her in terms of age, but after receiving the Blessing, Leila surpassed me, and in fact, she began to put a gap between us. While I was impressed by the difference between the professions, I was also a bit puzzled by the fact that I had to follow in the footsteps of my twin sister, who had also been my rival. I was indeed depressed when Leila looked a bit bored with the fact that she had come to win a series of games against me. But well, it can''t be helped. Layla is Layla, I am me, let''s not worry about it. And then one day my dad said The Ark. ...Dad? From now on, you''re the only one who can train in secret. Ew... You''re usually so insensitive, but this is the only time you can be so perceptive! Thanks to that, I was the only one who had to do my father''s special training menu from hell every day. Two years passed. I''ve turned 12 years old. I don''t like it! ........I was exhausted from the secret training. Because every morning, he woke up at three in the morning and lasted until the time the sun came up. After that, there''s normal training, and there''s no rest for all three hundred and sixty-five days. Even a black company would have a few more days off. I don''t know how you put up with it for two years. I''m going on a trip for a while, mother. Oh, Ark! My mom looked away at my sudden declaration. Then the family meeting began. Naturally, my dad received a barrage of accusations from everyone. ''That''s not fair!Leila wanted to do some secret training too! Leila was the only one who spoke up like that, but I really don''t want it to stop. Why do you think I''ve gone through hell? ''Hmm, maybe I went a little overboard as expected. Not a little! He''s not remorseful at all, is he? Anyway, with everyone''s persuasion, there was no more secret training. When I was relieved, my grandfather showed me something. "Recruiting students...? It looks like a brochure for a school. Apparently they are recruiting students from all over the world for next year''s school year. Edelheid Kingdom?I''ve never heard of that. It''s a country in the western part of the continent. That means you might have stopped by there on your journey to defeat the Demon King. ''''What brings you to this country?'''' Mr. Petera, who was in the city a while ago, saw it by chance and brought it home with him. At first she wanted to give it to her grandson, but then she realized she didn''t have that kind of money, so she gave it to me. What do you think, Ark, do you want to go? I don''t think we have that much money either...? I mean, no one has a regular job to begin with, so how do they keep the family finances going.........................it''s a mystery now. ''Hmmm, grandma agrees!I think it''s important not only to train, but also to acquire knowledge through study. The grandmother says something very advanced and encouraging, considering the level of civilization in this world. ''And it sounds like a big school, and you might even make some friends! It''s true that I don''t have a single friend at my age........ You were worried about me.......... School.........yeah, not bad. I was compulsory in a previous life and I was too weak to go to school, but I was too weak to count. Thank you, Grandpa and Grandma. ...I''m going to go to this school. Leila! What, Leila too? 190-Episode 15: I Wanted to Improve the Comfort Mom said, "If you want to study, you could go to a nearby school...? But my grandfather and grandmother suggested that we should go to a school in Edelheide Kingdom to meet more people. However, it''s really far away, so there''s no way we can go there from home. I heard there is a dormitory, so we are going to live there. This is how Leila and I decided to leave the town where we were born and raised. This is the second time we''ve taken a long trip, but the first time we''ve been alone. I''m sure it sounds dangerous for a twelve year old child to travel alone, but my mother left for the sword city by herself when she was eleven, so it''s not so unusual in this world. Well, that mother was the most worried about her........ ''''Well, I''ll go off then.'''' Brush your teeth, okay?I bathe every day... and I wash my clothes... I''m fine, Mom. We''re leaving! We say goodbye to our families and we''re off. "Ick! Hey! That was way too fast! They would travel by boat. It was a land ship that my father had built in the past, and it could run on magical power. As I panicked at Leila''s rapid acceleration, I quickly lost sight of the city in the blink of an eye. Isn''t this faster than the last time we rode? "Daddy made it better!More magical efficiency and more speed! I wish they''d improved the ride, too! The vibrations are so great, my butt hurts. I feel like I''m going to get drunk soon. ''Since it''s just us this time to begin with, wouldn''t it be faster to fly? Oh. I decided to fly. I made it to the Kingdom of Edelheid. It took me roughly two whole days to fly through the sky. In my previous life, it feels like it took me a long time to get there, but in this world where traffic is not developed, it''s only two days. With a carriage, it would probably take more than half a month to get there. ''Huh?Ark, you''ve never been here before? Yeah, that''s what I thought. We nodded to each other as we gazed from the sky at the royal capital, where the school was apparently located. The streets were familiar to me. It wasn''t just that we were passing through. It''s not so much that Leila, who doesn''t have much of a memory (or rather, she easily forgets things that don''t interest her), even remembers them. ''This place is... yeah!As I recall, the city was attacked by the undead. Was it? Leila''s head is tilted, but I''m sure of it. I was the first to find and defeat a necromancer who controlled the undead. Four years have passed since then, and the city has been beautifully restored. The people on the street are vibrant and look completely different from the impression they had back then. We landed on the ground and entered the city. Yes, I knew it. At the end of the long avenue, there was a castle that hadn''t changed since four years ago. But I don''t know where the institute is. Shall I ask someone? Hey, hey, sis!Where is the academy? Leila approached a sister who was passing close by. Unlike me, she''s not shy, so she''s good at this kind of thing. She''s a girl whose innocence exudes from her face, and those who are approached out of the blue are usually kind enough to tell me what to do. As a result, the older sister stopped. ''''The academy.......Edelheid Royal Academy, right? Are you here to take the exam? Test? Leila tilts her head at her smiling sister''s words. I say, dumbfounded. ''You have to pass an exam to get into the Royal Academy. It was in the brochure, right?'''' Huh?Was it?I mean, what is a test anyway? From there..... The exam is a test to see if you are suitable for admission. If you are judged to be suitable, you pass the test and are cleared to become a student. What happens if you fall? Maybe next year. Huh. I don''t know how hard it is, but it''s probably not an easy test. Grandpa said we could definitely pass it on the first try. The Royal Academy is in the northwest part of town. You have to go straight down this road. This way!Thanks, sis! You''re welcome. Have you guys come a long way?Just the two of you? ''Yes!From a town called Fainot! ''Feinotto...?I''ve never heard of that. Anyway, good luck on your exams. After thanking the sister, we walked in the direction she told us to go. We arrived earlier than we expected, so the exam is in a few days, but we wanted to make sure we knew where the academy was beforehand. Oh, is that it? I guess so. Soon, a building that looked like it came into view. Wow. It looks very spacious. Yes. It''s surrounded by a high wall, and that wall goes on forever. It seems to have a pretty big site. I went up to the main gate, but it seems to be off limits to outsiders, so I couldn''t get in. Maybe we will be able to enter during the examinations. While I was looking at the grounds from outside, I saw a group of what I assumed were students passing by. It was a group of girls. ''''Ah........'''' I think I just saw A(n)''s(n) and K(n)''s(n) children.... Unfortunately, I can''t check it out as it has already been hidden behind the building. ''''What''s wrong, Ark?'''' ...Nah, it''s nothing. I just need to find a place to stay. 191-Episode 16 I can be either Wow, that''s a lot of people. Yes. The day of the entrance exam. When I went to the academy, it was packed with people. ''Are they all taking the exam?'' ''No, I think half of them are parents. They''re obviously older. There''s an age limit for admission, ten to eighteen years old. But there''s no family register in this world, and how do they check the age? And then you think. You will first be asked to take an appraisal. It''s to find out your age and occupation. I see, so you can find out your age from the appraisal. After the Blessing Ceremony, I took the appraisal and got a certificate, but as expected, I didn''t remember that it had my age written on it. We stood in line as we were told. There were a lot of "appraiser" people there, and they were appraising each one of the candidates one by one. Soon it was our turn. Leila was the first to go. ''''Eh.........?Well, [Magical Sword Princess].........? I guess it''s really no good, but the appraiser was so surprised that she shouted Leila''s profession out loud. Hearing that, the people around her made a noise. ''''Magic Sword Princess........?Never heard of that? But no matter how you look at it, it''s the upper-tier equivalent of the [Magical Swordsman]...? ''''In other words, [Highest Position].......?A kid like that...? Shouldn''t you have been blessed not long ago...? When Layla received the results of the evaluation, it was my turn to follow. ''''Is it the girl''s sibling now...?'''' If that''s the case, isn''t that guy a great job...? Hey, I''m being expected to do something........ The appraiser also has a somewhat nervous look on her face. But unfortunately, I''m not a [top-level position] like Leila, you know. While everyone around me became quiet and listened attentively, I''m sure the appraiser was bracing herself to not make the same mistake as before this time. ''''Huh...?Mu, Unemployed...? This time it was a muttered voice, but it seemed to be heard clearly because of the thinning of the surroundings. There was a sudden burst of laughter. "Hey, hey, it''s "unemployed"! ''Seriously?I''ve never heard of that before! I''m surprised you even thought about taking it. There''s no way you''re going to get in, unless you fail. The appraiser hurriedly pressed his mouth, but it was no longer the case later. ''''I''m sorry too........'''' No, don''t worry about it. I interceded and joined Leila, who was waiting for me. ''''Ugh, Ark is awesome! For some reason, Leila was more indignant at the ridiculous stares from those around her. Then as we were heading towards the exam room, there was a group of people rushing towards us. ''''Whoa.'''' I get pushed away by them. Apparently the only person they want is Leila. ''You, of course you''re going to join the martial arts department! I''d love to join the martial arts department! No, no, no, it has to be witchcraft! ''Yes!The martial arts department needs to back off! It seems to be the faculty and staff of this institute. They seem to know that there are excellent candidates, and they want them to choose their own department, no matter what. Of course, no one pays attention to me as an "unemployed" person. ........no, there are people who point at me who were left behind and laugh at me. ''''Huh?No? Where did he go? They had been arguing around Layla, and suddenly they started to panic. When I looked, Leila was gone. As it should be, she was right behind me. ''''Whew, that was hot and stuffy! Ark, let''s go! Apparently, she used cloak and dagger to get out. Leila disappeared and headed to the exam room with me. Then I saw a new line of people waiting in line. Apparently, I''ll have to wait in line again. After a while, my turn comes around. ''You will be asked to select the department you wish to attend here. ''What?I have to pick one of them! ''''Of course. We can only enroll in one of the general, martial arts or magic departments. This was new to me. The pamphlet did indeed state that there were three departments, but it didn''t say that I could only enter one of them. ........Well, it''s obvious when you think about it. It''s probably because it''s obvious, that''s why they didn''t bother writing it down. ''Eh, why?My dad was in six schools at the same time! Six...? ''Leila, that''s probably too special an example...'' The lady at the reception desk says, a little puzzled. ''Naturally, we thought it would be best for you to join a department with a high degree of occupation and aptitude. It was up to the candidate to decide which department to take. But it was normal to take the department for the given profession. ''''However, it''s true that with this profession...'''' The receptionist''s sister gets a difficult look on her face as she looks at Layla''s appraisal form. ''''However, due to the overlapping of classes, it''s practically impossible for you to enter more than one department. I''m sorry, but we have no choice but to ask you to choose one of them. Then Leila came up with something and clapped her hands with a pop. ''Then Leila will be in the magic department!ARC is a martial arts department! Uh, yeah I don''t mind either way, but are you sure? I''ll be fine! Yeah? It was so easy for Layla to pull back. I have a bad feeling about this.......from past experience, Leila''s words of okay are rather unsettling. Anyway, this is how it came to pass the martial arts exam for me and the magic exam for Leila. 192-Episode 17: Its hard to say First of all, they say there is a written test. It seems to be the same regardless of the department, and it''s mainly about general knowledge. I haven''t studied for it, but will it be OK? I''d rather worry about Leila than myself. She''s not a very smart girl.... That was easier than I thought it would be. I exhale after the written exam. Compared to the exam in my previous life, it was all basic and easy to solve. Even if it wasn''t a perfect score, I think I got a decent score. ''How was Leila?'' I''m fine!I buried it all right! "That''s what bad people say... You don''t get a point for just filling in the blanks, do you? Well, as long as you make up for it in the next practical exam, you''ll be fine. Since the content of the practical test is different for each department, I parted ways with Leila there for a while. I''m heading to the martial arts course. I''ve been told that the chances of getting into the martial arts department are about three times greater. I''m sure you''ll be able to find out more about this. You know, the guy from earlier. Pfft, there''s no way an "unemployed" could get into the martial arts department. There were people who pointed at me and laughed at me, perhaps they were the ones who were there at the time of the appraisal. It''s best to ignore them. When all the candidates had gathered, the teacher explained the content of the test. You will take a practical test, in which you will defeat a demon. In this test, you will go to a predetermined hunting ground, where you will be evaluated on the number and quality of monsters you defeat within the time limit. For your safety and to keep a record of your achievements, you will be accompanied by one student per student. Then an examiner arrived at my place. She was an older sister of about 17 or 18. "Are you Mr. Ark? Yes, I do. "I''m Melena, I''m in charge of the exam, I''m a third year martial arts student. It''s a pleasure to meet you. Nice to meet you. So is it true that you are unemployed? I nodded. ''Well umm, it''s very hard to say, but...'' Melena-san said with an apologetic look on her face. ''''With you as an unemployed, even dealing with goblins is dangerous. Besides, even if you were able to defeat them by any chance, it''s impossible for you to pass. I won''t say anything bad about you, so I think it would be better to decline.'''' No, I''m not going to turn it down. I answer immediately. ''Well it says you''re from a town called Fainot, which is probably pretty far away, right?I know you came all the way to take the exam and you can''t bring yourself to decline. But, you know, you only have one life, right? It wasn''t like he was making fun of me, he simply seemed to be worried about me. ''Thank you. But you don''t need to worry about me. "...if you''re going to go that far... Merena-san felt that my intentions were firm, and she let out a sigh but nodded at the end. There were three designated hunting grounds, apparently assigned in advance so that the candidates wouldn''t be concentrated in them. The one I headed to with Melena-san was a forest in the west of the city. It seems to be mainly inhabited by goblins, so it''s a beginner-friendly hunting ground. The examinations have already begun, and the candidates are rushing into the forest ahead of me. I have to hurry too. The trees in the shallow part of the forest are sparse and the outlook is not bad. However, the number of goblins seemed to be small. Moreover, a large number of examiners are searching for goblins at once, so they are fighting over them. There are several signs of goblins, but all of them seem to have signs of people nearby and are already being targeted. As expected, I don''t want to intercept them. The way things are going, it looks like we need to go deeper. ''''It''s best not to go too deep. There''s a goblin''s nest, too - from the side where I said it!Wait a minute! I could feel Melena yelling something from behind me, but I couldn''t take it too long. I walked deeper and deeper into the forest. ''''Ha, fast........?I can''t believe we''re going through the woods so easily... In the meantime, it''s not a good idea to pull Melena-san away, so I set a pace that allows her to follow me properly. She''s a current student in the martial arts department, so she can afford to do this, right? Yeah, but wait... I found it. I sensed a sign of a goblin and changed my direction to the right. Beyond the grass, there was indeed a goblin. ''''Gugeh?'''' He was surprised to notice me. I unleash a thrust, piercing its heart. The goblin falls to the spot without screaming. ''''Zeez, zeez....ya, I finally caught up with it................what is this? Melena is surprised to see the fallen goblin. ''I took them down. That''s one at last. Yeah, yeah ... this ... this ... this ... this ... this ... stab to the heart ...?I''ve never seen such a beautiful.......... We''ll go next. Oh...wait...wait...what? I looked for the next goblin and continued on deeper into the forest. I took out two, three, four, and so on. Eventually, when I had killed the fifteenth one, I stopped. Merena-san, who was breathing hard a little later, caught up with me. ''''Zeehaha.......How is it that you can find the goblins so easily.......? "...?You can tell by the signs, can''t you? There''s a hint of...? Look at that. There''s probably a goblin den over there. ......... I stopped for a moment because I found a cave that looked like a goblin''s nest. I can feel countless goblins moving inside. ''''Are you in danger?I''m going to turn around right now. ''What?Why?Of course you''ll be there?It''s a great opportunity for me. What?Oh, wait a minute...?I''m already well within the passing range........! I thought Melena shouted something to me, but I jumped into the goblin''s lair, hoping to pass the exam. 193-Episode 18: Will You Accept If You Defeat This? Geez! "Swoosh! "Geez! As we proceeded through the nest, we quickly encountered a group of goblins. They attacked us while emitting an incomprehensible voice. ''''Gah!'''' A single flash of the sword, collectively cutting off both sides. What did you just do? I cut with my sword. ''I couldn''t see the sword streak at all! Melena-san''s voice reverberated through the cave. I didn''t mean to slash so fast, but........well, it was probably too dimly lit to see much. After that, while defeating the goblins that kept springing up one after another, I continued to go deeper and deeper into the cave. Oh, be careful there. There seems to be a trap set up for you. ''What?Yo, you know what I''m talking about... It''s a very primitive trap, sir. Then there was a shadow leaping from the depths of the darkness. Whack! He catches the sword swung down. ''''Ha!Goblin Swordsman!You''re not a superior species!It''s still dangerous!We should pull out right now! ''What?I''ve already beaten him. ...What? At my feet lay a goblin swordsman whose body had been cut into rings. It''s a goblin with a body one size larger than a normal goblin and uses a sword. ''''When did it happen...'''' I was already slashing when I caught the sword. Humph! This time an arrow flew in. I flicked it off with my sword. ''What the hell was that?Arrows! ''It looks like there''s a goblin archer in the back. There are six of them. Hey, they''re going to get a shot at you! Oh, it''s okay. I''ve already beaten him. ''What?'' He was hiding behind a rock as he tried to shoot an arrow, but I used my "shrinkage" to get close enough to cut both of them off. As I continued on, I found myself in a slightly larger space. There is a group of goblins with magic wands in their hands at the back. ''''Oh, those are goblin mages!Those pesky goblins that use magic! Melena-san shouted, but it was too early, or the goblin mages unleashed their magic all at once. Multiple fireballs flew in. ''''Ha!Run, run! It''s just a fireball, right? Boom, boom, boom, boom! I drowned out all the fireballs with just the wind pressure from my sword swing. ''''Nah, nah........'''' With a stunned Melena-san behind me, I close the distance between me and the surprised and shivering goblin mage and cut them all down collectively. ''''Err ... let''s move on.'''' Melena had been freezing for a while, so I called out to her. Then she huffed and then. Well, I''m still going!I mean, the number of these higher species of goblins!This isn''t a normal sized nest by any stretch of the imagination!Maybe there''s a goblin lord in there! The Goblin Lord, as his name suggests, is the king of goblins. He leads a large goblin horde, and it is in danger of becoming even bigger due to its unusual fertility. ''''I''m sure they''re there. How do you know? There''s clearly a different feel to it than the rest of the world. I don''t know what that means! Huh? Don''t they practice sensing the presence of demons in school? You can learn to recognize an enemy when they''re approaching, but if you learn the sense of presence skill, you''ll learn to recognize them... ''We''re just going to broaden that range, okay?I can find out about three hundred meters away if I try hard enough. Three hundred meters...? You''re not even close to your father, though. Who is your father? Eventually we came to the end of the nest. What was waiting for us there were nearly a hundred goblins. While there were hobgoblins and other high-ranking goblins, there was one goblin in particular that gave off a strong aura. You are the intruder! "You are an intruder," said the Goblin, "and you''ve killed a lot of children. ''The goblin spoke!I don''t think he.... Yes, a goblin lord, I think. The goblins, which appeared to be goblin lords, were not as large as hobgoblins. However, although slender, they are covered in well-developed muscular armor and look very agile. ''''Brethren, you shall be rewarded by him! ""Gah!" The goblins responded to the Goblin Lord''s command with a dirty yell, and they all leapt at once. ''''Hiiiiii!'''' Melena-san screams. Yeah, it''s true, it''s a bit scary when so many goblins come rushing in. After all, goblins are ugly in appearance. If I say that a large number of G''s are coming at me, I might be able to feel their fearlessness. However, even if you have a sense of disgust, they''re not someone you should fear. Because it''s just a goblin. Merena-san''s tearful eyes and the fact that she''s on the verge of running away is probably due to her physiological disgust. I don''t want to be surrounded by goblins either. So let''s deal with them before they get too close. "Sky Slayer. ""~~~~~~~~?" The torso of the lead group cried out collectively as the slashes flew off. Even so, the goblins continued to move. The goblins come rushing in like a raging storm, and I perform a series of "kazora-slashes" on them. The corpses of the goblins pile up like a mountain. "Die neeeeeeeee! Hiding behind the sacrifices of these compatriots, the Goblin Lord, who had been secretly closing the distance between us, raised his sword from my blind spot and jumped at me. Zang! Ba-na-na-na-na... Of course, I had noticed this from the beginning, so I ducked the Goblin Lord''s sword and slashed his head off. Then, as if that prestige was broken, the goblins who had been attacking without fear of death suddenly began to be frightened. '''' ''''Gugugagya! The goblins flee like spiders scattering spiderlings. Their numbers are dwindling quickly as they jump into narrow holes and such. It''s going to be very difficult indeed to chase them all down. I looked back at Melena-san and asked. ''How''s it going?Do you think you''ll be accepted if you take down this much? ''I had enough before I entered the nest! ....Huh? 194-Episode 19: Writing was perfect That "Magical Sword Princess" girl was taken by the magic department... Yes I''m sorry. The faculty room of the martial arts department. The teachers who were in charge of the entrance examinations were sullen that they had missed out on a great talent. It''s a good thing that he chose the magic department. It can''t be helped. ''Well...'' Anyway, have the exams been graded yet? Yes. The successful candidates have been roughly determined. It''s just..... What''s going on? ...and look at this. Unemployed? A certain candidate''s score sheet handed to him. The teacher looked at the occupation column first and raised his eyebrows. There''s no way I''m going to pass the "no job" test. ''That''s ... look at the grades. "?You got an A on the written exam.... well, the written scores are just for reference. An A is the highest grade that can be given to someone who has scored more than 90 points. But this alone does not overturn the fact that I am "unemployed". ''''........the problem is the practical test. Practical?Nah, with an S rating...? Rating S. That is the highest possible rating, which may occur only once every few years. In the history of the martial arts department, there had been only a few students who had received this rating on the entrance examination. What surprised the instructor even more was the reason for the S rating. ''''Entering a goblin den and defeating nearly a hundred goblins, including the top species, single-handedly...?And you even killed the Goblin Lord...? If this is true, then he''s not even close to an S. This is the first genius since the beginning of the academy. There must be some kind of mistake. Who was the examiner? ''I''m Melena, a junior. I''m a serious student with excellent grades. She is not the type of person to lie. In fact, I''ve checked with her and she says she''s sure of that. ''Then this is a fact ... no, wait, wait, wait!This candidate is not unemployed? He had forgotten about it because the content of the report for the practical exam was so blown out of proportion. ''''Of course, it''s possible that it was a mistake on the part of the appraiser...'''' If you do, you''re in big trouble, okay? Yes. But in that case, he should be able to point out his mistakes... ''Well that''s...'' The teachers got their heads around it. ''So what shall we do...?'' Even if you are "unemployed", I gave you this evaluation in the exam. I can''t afford not to let him pass. If possible, I''d like to re-test him, but the announcement of his acceptance is tomorrow. There won''t be time to find the person who doesn''t know where he is and have him take the practical test again. ...Okay. So let''s call it a pass, then. ''So, please. In any case, every year, some of the successful candidates are dropped from the academy after they are admitted. If this boy is just an ''unemployed'', he''ll be leaving the school immediately. Meanwhile, at the same time, in the faculty room of the magic department, the staff in charge of the entrance examinations were also talking about the same thing. ''''The child of the Magic Sword Princess has successfully passed the entrance exam to our magic department!And look at this! ''Rated S!I knew you were as good as I expected! ''No, it''s more than I expected!According to the student who served as the examiner, to my surprise, he was using multiple attributes of magic! ''What?How is that even possible? The staff is excited about the amazing new students. But then they see an inconvenient fact - their grades on the written exam. The lowest grade of E..........Are you okay?It''s just a common sense question...?Normally, no matter how good your practical skills are, that''s a grade that would be dropped, but... Well, that will take care of itself after you get in! Yeah, that''s right! Apparently, they decided to meditate on the inconvenient facts. Thus, Ark and Leila had successfully passed the martial arts department and the magic department, respectively. Ark, how''d it go? I''m in. Oh, congratulations!I passed, too! Today is the day of the acceptance announcement. Me and Leila had both passed. And it was Tokutaisei! Tokutaisei? I hear you don''t have to pay for tuition! Oh, you''re a scholarship student. That''s great. Oh, geez. You did a great job with your handwriting! You said you were confident, but that was true. That''s why they gave me this! What is this?...Problems? Yeah, you''re supposed to make it to Commencement! ''Homework, huh. It wasn''t in the martial arts department, but.... I flipped through it. It''s the same level of common sense questions as the entrance exam. Do all magicians have to do this? They didn''t all get it, and I think it''s just Tokutaisei. .... It''s not that, this is definitely because Leila''s grades on the written exam were terrible....... It must be a plan to let her catch up with the people around her as much as possible before she enters the school. .........But since Leila is motivated, let''s not say anything unnecessary. ''''Well then, I''ll have to do my best to live up to your expectations. Good luck! 195-Episode 20: This E class is at the bottom I passed the entrance exam without a hitch and was admitted to the martial arts department of the Royal Academy. ''''Well, I''m in E class, right? In my previous life, I was never able to go to school properly, so school life is something I long for. I stepped into the E class room with a great deal of anticipation. The atmosphere in the classroom was divided into two parts. One was people who were just as happy as I was to have been admitted to the school, and the other was people who said, "I''m really glad I was accepted. They were saying things like, "I''m really glad I was accepted," and "I''m a student at the Royal Academy from today," in a very happy manner. On the other hand, there were people sitting on their chairs without speaking at all. The air was like a funeral. Looking at their grief-stricken faces, it was hard to believe they were freshmen. I wonder if something happened...? If it''s just one or two people, there are a number of them. It''s not like it was just a coincidence of bad luck. I sat down in an empty seat. It''s not long before a man who looks like a teacher comes into the classroom. Is he our homeroom teacher? He looked around the classroom and opened his mouth. ''They''re all here, aren''t they?So we will now begin our guidance. If you have any questions, I''ll ask you to put them together at the end. All right? A few people said yes. So, deciding there was no objection, he continued. ''Let me be clear at the outset. Of course, as many of you know, the martial arts department divides students into six classes, S to E, according to their grades in the entrance examinations and other factors; S is for those who have the best grades, then A, B, C... and so on. They are assigned from the first to the second. That means this E class is at the bottom. Okay, so part of it was like a funeral in the air.... Those whose goal was simply to pass were honestly happy to have been admitted. On the other hand, those who were aiming for a higher class are regretting the fact that they got into E class. It''s funny though. I should have done well enough in the practical test. Was the current student who gave me the examiner wrong? But even if it''s the bottom of the barrel, it''s still a student of the Royal Academy. Therefore, I''m not going to lower the level of my classes at all. ........even if it results in some people not being able to follow them. In fact, every year there are a large number of students who drop out. If you are satisfied with just being admitted to the school, you might be one of them. At those words, the pleasure group - unrelated to a certain group of people in their previous lives, of course - straightened up. ''And then the classes aren''t fixed. If you are judged to have reasonable strength, you can be promoted to a higher class, even if it is in the middle of the semester. Of course it could be the other way around... but you guys at the bottom of the pile don''t have to worry about being demoted for now, so you can relax. This time, the grief group has a determined look on their face. They seemed to be aiming for promotion. After that, there was a detailed explanation of school life, and we dismissed for today. Classes will start the day after tomorrow. After the guidance, I went to the dormitory. It seems that I''ve been assigned a room. The dormitory supervisor gave me my room number, and I went to look for the room I''d be living in. It was a room in the northeast corner. ''Is it here?'' I opened the door and walked in. It was smaller than I thought it would be. A bunk bed was placed on either side of the room, which made it feel oppressive. Passing between the beds, I went to the back, where there were four desks in a U-shape. It was a room for four. Of course, there was no individual space. "Oh, are you a freshman? I was putting my stuff on an empty desk for now, when someone walked in. ''Yeah. You too? Yeah. I''m Ranta. It''s a pleasure to meet you. Nice to meet you. I''m Ark. We shake each other''s hands as we introduce ourselves to each other. He''s a friendly boy. His age seems to be one year older than me, 13 years old. It seems that he is from the Edelheid Kingdom. It''s a good thing that you''re not a member of this group.Never heard of it?Where the hell is that? It''s a long way east of here. Is it near the City of Swords? It''s further east. Oh, man, that''s a long way from home. It''ll take you days to get there. It''s about two days. What class is Lanta in? I''m a C-class. How about you? I''m E. ''Well..... But, well, considering his age, it''s probably enough for him to have passed. I heard there are geniuses who are able to enter the S class at the age of twelve. Do you know?I heard that the Department of Magic got a new [most senior position] student this year. Oh, yeah. You know it well. No, there''s quite a bit of talk about it. Apparently, Ranta is a well-informed person. I''m not sure how many people I know from this country, unlike me. And from what I''ve heard, she''s quite cute. It''s a girl. ''Well, unfortunately, we''re in different departments and it''s going to be hard to make a connection. The dorms don''t have anything to do with the department, but if you''re a girl, you''re in the girls'' dormitory. Of course Leila would be in that one, too. That''s when a pair of guys walked into the room. A large boy and a boy of medium build with a somewhat insidious smile on his face. So you''re the freshmen. I''m the Gaon of the fourth year A class, and I''m the bozo in this room. The big boy said his name, then lifted his lips and announced. ''I mean, my orders are absolute. 196-Episode 21: It seems to be a hierarchical relationship of club activities In the morning, the bell rings in the student dormitory and everyone is forced to get up at once. I wake up at the bottom of the bunk bed and quickly change my clothes on the spot. I look to the side and see that Ranta is also rubbing his eyes and trying to get up. Both of us new students are under the bed. The two upperclassmen are using the top. It''s time to clean up before breakfast. We have been assigned to clean our rooms. We are assigned to our room and the hallway in front of our room. I heard that we had to do it right or else the dorm manager would be angry with us. Uh, it''s cleaning time. When the upperclassmen didn''t get out of bed at all, I called out to them. ''Oh?''Shut up. Cleaning up is your job for the year. The one who spat that out was Gaon, a fourth year student. The other senior, third year Isart-san, smirked and sneered. ''''Make sure it''s properly cleaned up,'''' After saying that, they left the room. ''''Well what the hell was that?'''' It''s all right. Let''s do it together. But hey, it''s a lot of work for two people to do in a small room.There''s a hallway, too. And then, for some reason, Gaon and the others came back. Ranta hurriedly straightened up. ''Hey, was that Ranta?You''re coming with us. What? Ha, no. Didn''t you hear me? But cleaning up... Why don''t you just let him do it? So get your ass out here! Okay, okay. Ranta glanced at me and then hurriedly followed Gaon-san. I, who was left behind, was left to clean up alone. ''''What is it........'''' I thought. "It''s like a fraternity hierarchy! Yes, that''s it, that''s it! In a previous life, many people in junior high school would join a club and then suffer their first hierarchical relationships. Of course it was hard for them, but I was too sickly to join a club, so I secretly longed for that to happen to me. I never thought I''d be able to experience that in person...! I cleaned up hard, happy to see that the floor was dust-free and cleaned the dirt that was stuck to it. I cleaned the floor to the point where there wasn''t even a speck of dust and cleaned off the dirt that had stuck to it. "I mean, if you look closely, the walls and floor are pretty torn up... It''s a building that''s showing its age, so it can''t be helped, but........ ''''Oh, yeah, we can make it anew with earth magic. I clap my hands as I come up with a good idea. ''Good, now we''re all set.'' I wiped the sweat off my face, satisfied with the results. Before I knew it, the room was as shiny as new. Oh, I guess it''s time for breakfast. Let''s go eat. Then, just as I was about to leave the room, Gaon and the others came back. Ranta is with them. ''Hey, I hope you''ve finished cleaning up properly? Yes, I''m done. Are you sure?Let me see. Mr. Gaon walks into the room. Then he stood there as if stunned. ''''........What?Wait a minute. This is our room, right? He rushes outside to check the room number. ''Uh, you''re sure you didn''t make a mistake?'' Oh, come on.I mean, sure, that''s my stuff... Now that I''ve done my work, I''m hungry. I urged Ranta, who was rolling his eyes, to head to the dining room with me. ''''Hey, hey, Ark, what the hell did you do?'''' What do you mean, I just cleaned up? ''No, it''s clearly beyond the level of cleaning! Yeah, that''s why I put new floors and walls on. I got you a new one! Ranta is surprised to see him on his back big time. I think you''re exaggerating a bit too much. In our house, Leila would punch holes in the walls every so often, and her dad would repair them with earth magic. What did you do with Ranta''s side of the house, anyway? ''No, nothing. Just a morning walk. Yeah, you''re having fun. You''re imagining some sort of mild-mannered thing, aren''t you?It''s not like that at all. What do you mean? He''d find some underclassman and start flirting with him about something he didn''t care about. I was like a prefect following him. Ooh, what a gymnasium! The education...? It was just like a school. Anyway, it looks like we''re rooming with a bunch of senior citizens. It''s going to be tough. ''Yes. We''ll work together. "...why do you look so happy? There was an entrance ceremony that day. The whole school gathered in the main auditorium to listen to the congratulations of the greats. Of course, Leila attended the ceremony. She''s a girl who can''t sit still and listen to what people are saying, so she''s probably asleep. Then, the representative of the current students will speak. Fourth year S class, Celestia-Lisela-Edelheid-sama, thank you for your support. The new students buzzed for some reason. ''''It''s Your Highness........'''' "His Highness greets you.... I''m glad I got in.... Apparently she''s a princess in this country. It''s a royal school, and it wouldn''t be strange for royalty to be attending. ''''Eh....?'''' The moment I saw the student who came to the stage amidst everyone''s attention, I froze in place. He had a gallant yet cute face and shining silver hair. She is a little more mature than she was back then, but there''s no way I could mistake her for someone else. The girl who appeared on the stage is the same girl who rescued you four years ago when you were being attacked by a necromancer. 197-Episode 22: Get what I say from now on ֱϤDZŮΤԒΤWϤޤäҙƤʤ ǰ_ˤʤäŮҊ㱤ƤޤäƤ 쥹ƥ󡢤 ιŮäʤơ ޤƤߤ顢ΤȤäϤǤ ͨŮӤʤ͡ ` 󥿣ɤΣ ݤŤ󥿤eƤ ɤΡͤ衣äǤΤˤǰäϤοդ衣ѧʽKä ԤܤҊؤƤߤȡWϤǤϯväƤȤƤȤä YߺϤäƤ롣 ˤƤŮ_äʤξxǒҊΤϳƤ ޤͬȤͨʤƤ衣ޥܤäƤ褫äħƤʤΤɤʡ ɤŮħƤ餷 gƤȤУh`ŮӤʤΤǵȻ弤` 䡢⤽弤ˤʤäƤʤ ˤƤͬѧУͨȤϤӤCʤƤʤ 褦䤯߾ߺϤƤΤǡWϤä ˤƤƤڤؤ򤫤 ɡ쥤ɐۤäʤ 󣿡쥤飿 󥿤οڤʤ˫ӤäǰƤơWʳä ǰ٤ƤӤ衹 ԤС Τǥ쥤餬Ϥˤȡܤ꿼褦ӛ롣 񤵤ʤ顢ȤǤΤ ӤħƤʤħƤϡ 󥿤wޤ˅ۤ Ƥǰ쥤ƤƤʣ 󡣤äƨDD 褪礦ɤȤˤ뤸ͤ väȤǡԒ˸z褦򤫤Ƥ郎 󤵤 ĤΤ褦˥`Ȥ⤯øƤ롣 󥿤䤹С󤵤󤬃WηҊԤä ǰ񤫤饪줬ԤΤIäƤ äƤ⤷ơ ѥ꤭ã ݅݅ԤХѥꡣ ѥԤ݅݅ ZФǤ֪ʤäഺһĤ򡢬FgY뤳ȤǤʤơ ֤ޤ ݤ뤸ͤ Wη¤ˡ󤵤󤬤ʤ餻 ɤ˿ڤζˤؐơ ääĩ`ѥݤΥåѥȤѥζ åѥζ͡ ǰȶäɡäǤϳ„ݤ롣 ˤ⤢ä ΥåѥIäФǤͣ ޤޤǕrg뤬Сդޤäʡ ֤ޤФäƤޤ Wk褦Ȥȡ󥿤ŤƤơ ǰäɤˤ뤫֪äƤΤ ֪ʤ֪äƤ룿 ֪äƤ롣ʥѥݤʡɡФ淴ͤɤ줰餤˼äƤ Ф淴 B֤餤Ǥ뤫ʡ Wϥ󥿤Ԕ̤Ƥä 㡢ФäƤ롹 B衹 ʤz褦Ŀ򤹤󥿡 󤵤󤿤ϥ˥˥ЦäƤ ᡣ WĿĤΥåѥo¤֤졢ѧԺؤȑäƤ 󤵤󤿤Ϥɤˤ väǰˤϤǤˤʤäΤǡ̽ʤȤʤ ΚҙƤ뤷yȤʤ Ϥ 󤵤󤿤ΤgƤУhϤä ʤʤ˼ä顢󤵤ȥ`Ȥ~äƤ ͽ~ΤϽֹƤ롣 ϤLäƤΤ ѧУäݤ 󥿡ǰäƤߤ衹 䡢ϡ 줬äԤäƤ衹 ֤ޤ 󥿤~ҪƤ ⤦äꥬ󤵤ӷ֤ IäƤޤ ϣ Ԫݤ褯򤫤ȡ󤵤󤬆sȻȤǤäҊƤ롣 ~ڤݤ Ĥ󤸤ͤ裡ʤ礯ä櫓ͤ IäƤޤ裿 WIäФΥåѥɤ ֤󥤥`Ȥȥ󥿤ʳ٤˼äơ˷֤ ʤߤ˃WϤ⤦ʳ٤ʤʤζä ܤȡä󤵤Ŀ ޡޥǥåѥۡԪäΤʤã Ǥ衹 _ˡˤӤäƤʤѥ⡢¤ȡ \褯PƤ֤äΤǡ¤ʤ֤äƎäƤ һζ״Bʳ٤뤳ȤǤϤ 󤵤󤬥åѥmĤȡꡢQä ᤧ Τޤޥ󤵤һݤʳپ˼ȡĿĿȡһˤǤ٤ʳ٤Ƥޤä `Ȥȥ󥿤η֤äɡޤä 198-Episode 23 To be honest, I have no recollection of what she said on the stage. It''s because I was in love with her, who had become even more beautiful than four years ago. Celestia-san, huh........ I didn''t know she was the princess of this country. Well, if you think about it, the place I met her then was a castle. This isn''t a normal girl, is it? ''''Hey, Ark! "...Ranta?What''s going on? The next thing I knew, Ranta was rocking me back and forth. What''s the matter with you? I''ve been calling you for a while and you''ve been distracted. The entrance ceremony is over, okay? I looked around as I was told, and found that all the new students, except us, had already left their seats and were leaving the main auditorium. It was quite crowded. You are still beautiful, Princess. It''s the first time I''ve ever seen her from this distance. Uh-huh. I never thought I''d be able to go to school at the same time. I''m so glad you''re in. It''s just a shame it''s magic school. Apparently she''s in the magic department. The school building is different from the martial arts department, and since she''s a girl, naturally the dormitory is different as well. No, she doesn''t have a dormitory in the first place.... In any case, even though they go to the same school, it seems that they will never have the opportunity to come into contact with each other. The crowding has finally cleared up, so we stood up. We headed for the entrance where people were beginning to arrive. ''But Leila-chan was cute too. Hmm?Leila? For some reason the name of my twin sister came out of Ranta''s mouth and I was amused. ''She''s the girl I was greeting as the freshman representative. Speaking of which. I seem to remember wondering vaguely why Leila was on the stage. After all this time, did I get it right...? ''But she''s a magician too.......it''s nice to have a magician.......'' Ranta muttered enviously. ''I mean, you look like Leila, don''t you? Yeah. Because-- Hey, you''re in a better place. As we left the main auditorium, a person approached us to interrupt the conversation. It''s Gaon-san. As usual, Izart-san was attached to him as well. I''m not going to be the only one who has a problem with that. ''You, now go buy what I tell you to buy. ''What?Could that be...? Pasiri came! Speaking of seniors and juniors, he is a pastry. Pasiri is my senior and junior. To be able to experience one of those adolescents I only knew in stories, in reality. ''''I get it!'''' Oh, hey... you''re a fighter. For some reason, Gaon-san''s face twitched in response to my reply. But soon, though, the corners of his mouth twisted in a nasty way. There''s a bakery called The Weather Channel, and their croquette bread is delicious. Croquette bread, it''s delicious. It was a staple in my previous life, but I don''t think I''ve ever heard of it in this world before. They had them in the other world too. ''''I should just go get that croquette bread, right? Yeah, yeah. There''s still time for lunch, but I''m getting hungry. Okay. I''ll be right there. I was just about to leave when Lanta got upset. Hey, hey, do you know where the weather room is? Oh, I don''t know. You know? Of course I know. It''s a famous bakery. But it''s the opposite of the city, you know?How long do you think it would take to get there and back? Right opposite of the city. I can get there in five minutes if I work hard. Ranta gave me the exact location. All right, I''m out of here. Good luck with that. For some reason, Ranta looked at me with pity. The Gaon''s were smirking. Five minutes later. I got the croquette bread safely and returned to the academy. Where do you think Gaon-san and the others are? They weren''t already in front of the main auditorium, so I had to look for them. I remember most of the signs, and it shouldn''t be so difficult to find them. ''There they are. Rooftop, huh? Gaon-san and the others were on the roof of the martial arts department building. I thought it smelled kind of bad, but Gaon-san and Izart-san were smoking cigars. Students are not allowed to smoke cigars. That''s probably why they are hiding and smoking on the roof. Very school-like! You should try it, Ranta. No, no, I''m not... ''Oh?I told you to smoke it. Okay, I understand. Ranta was forced to take a cigar. He''s already a complete Gaon''s henchman. ''I bought them! ...What? When I called out cheerfully, Gaon-san looked at me with a stunned face. A cigar fell out of his mouth. ''''Ugh, don''t lie to me!There''s no way they''re coming back this fast! No, I got it all right. I give them the croquette bread I just bought. I thought maybe Izart and Ranta would eat it too, so it''s for three people. By the way, I already ate it. By the way, I''ve already eaten mine, and it was quite good. When Gaon received the bread, his eyes widened. I''m not going to be able to say that I''m not going to be able to do that. Yes, It''s true that they only sell bread there... And it''s warm...? I was lucky enough to get some freshly fried, so I brought them home while keeping them warm. They should be at their best. As Gaon-san bit into the croquette bread, it made a good sound, a crispy, good sound. ''''Ummm........'''' As it was, Gaon-san ate all of it at once, I thought, but then he ate the second one, then the third one, all by himself. It was for Izart-san and Ranta.......but oh well. 199-Episode 24 Of course, its a girls toilet What...? Miss Leila? She tilts her head in disbelief at my stunned state of mind. Even though she woke up in her sleep, her beauty is not at all compromised, and her silver hair is lustrous. ''Nah, it''s nothing! I shouted hurriedly while hiding my face with the blanket. I tried to sound like Leila, but will it be okay...? Yeah?If you''re not feeling well, just tell me, okay? Princess Celestia said so softly and began to take off her clothes. Thank goodness she didn''t seem to notice.......! ''''~~~~! I quickly turn my head away. Apparently, they plan to change into their uniforms right away. Boys clean up in their loungewear and go to the cafeteria, but not the girls. I just buried my face in the blanket as I heard the sound of clothes scraping. But still, I didn''t expect to be in the same room as Celestia-san.... ''''Are you okay?You look a little red in the face, but... Hey, do you have a fever? ''That''s a lot of work. You don''t have to clean up, just rest. Gentle. It''s a far cry from Mr. Gaon. But she misunderstood me, and it helped in the end. I pretended to catch a cold and waited for the girls to leave the room. ''Do you think you''ll be able to eat breakfast? Almost there! Then I''ll ask the diner to leave one for me. Then the residents leave the room. I was relieved to hear that they hadn''t found out. I managed to avoid being found out, but my heart is racing. ''You''re Ark?'' What? Suddenly, I almost jumped up when a voice called out from behind me. I didn''t feel a sign at all! I thought they all left the room just fine........ But what bothered me more was the fact that my name was called "Ark". When I turned around fearfully, it was a petite girl with bobbed hair who was there. She should have been there, but she was somehow very uninspiring. That''s probably why even I didn''t notice her. Looking down at me with emotionless eyes, she said in a voice with zero intonation: "Don''t worry," she said. ''Don''t worry. I''ve heard about you from Leila. It''s hard on you too.'' Good. Good. At any rate, he seems to be an ally who knows what''s going on. ''''Even so, they look a lot alike. The parts are a little different when you look closely, but thanks to that prominent red hair, I don''t mind. Maybe you won''t be able to tell unless you look very carefully. Well, I don''t know... If it was his brother, he wouldn''t be too happy to be told that he was indistinguishable from his sister. At the moment, they were almost identical in height and shape. As a twelve-year-old girl, it''s about time for her breasts to swell up, but maybe she didn''t look like her mother, and Leila is flat. It''s a good idea to be able to have a good idea of what you''re looking for. I''m not going to be able to get it right. I''m not going to be able to say that I''m a good friend of yours. Nice to meet you... but I don''t have any interest in coming here. Anyway, I need to protest to Leila and get her to give up. Do you think you can convince the girl? "Uh. We''ve only met for a short time, but I don''t think it''s possible. Well, you''ll have to tell the school... Will it work?She''s a promising newcomer. You are an "unemployed" E class. Worst-case scenario, they might just let you go. .... And by the way, I''m going to tell him he''s a pervert who broke into the girls'' dormitory. Who? I did. Why? Why?Of course it sounds interesting. Slightly lifting the corners of her mouth, Rikka smiled for the first time. No, this girl wasn''t on her side! In the end, I had no choice but to take this situation in stride. ''You''d better change into your uniform quickly. Class is about to start. Uh-oh. I have no choice but to try to change into Leila''s uniform. ''''Uh ... can you please turn around?'''' Why? Forget it... I''m a man, and I''m not ashamed to be seen. Rather, it is more embarrassing to be seen after changing clothes. After all, the girls'' uniform is a skirt. It looks great on you. By all accounts, it''s a girl. I''m not happy at all! For the first time in my life, I yelped in shame at being in girl''s clothes for the first time in my life. Then we''ll go to class together. I''m in S class with you. Yeah, Oh, do you need to go to the bathroom? I''m fine. The women''s room, of course. ! Maybe that means I''m going to have to use the women''s room now! No, I''m not okay at all. Hang in there, le-la-la-la. Oh, my God, it''s Leila! Lovely.... ''You''re pretty today...'' "Oh, Leila... Hey, he''s coming at me now! d*mn it! Little Leila saw me! On my way to class. I was getting a crazy amount of attention. And all I got was good looks. ''Huh?''Could it be that Leila is this popular? Yes. You''re so different from me.... You could say the exact opposite. It''s still better if you''re indifferent, and you''re often met with pity and contempt. ''Good morning, Leila-san, good morning. ''Oh?Don''t you look a little pale? And don''t worry! ''Good morning, Leila. Did you get your hair done by any chance? Well, I didn''t change it!Isn''t it just my imagination! When I walked into the classroom, I was greeted one by one. I was asked a lot of questions to see if I felt a little different, but fortunately they didn''t seem to notice. The students in this class are very sociable, unlike my class, where we don''t have many conversations. For that reason, I have to do my best so that I don''t get ripped off.... It seems to be more difficult than I thought it would be. 200-Episode 25: Brothers and sisters who dont really make sense It seems that in the first year of magic department, students learn all six types of magic in full. I''ve heard that it used to be divided into each attribute from the beginning, but it seems to have changed to the current method about a few years ago. It''s a new teaching method that was learned in the magic city, which is said to be the most advanced in magic. This has led to an improvement in the lack of understanding and conflicts between the attributes and has had a positive impact on the practice. Rikka told me. ''As an advanced student, you have to focus on one magic,'' ''What?Why? ''''Well Leila had the same reaction. It''s not normal to learn more than one magic. Really? ''Different colors of magic have different magic letters and grammar. I can''t remember them that well. Sure, it was tough at first, but... As I said it, I started a fire with red magic and put it out with blue magic water. I also created a small golem with earth magic and blew it away with the wind of green magic. If I use white magic on the grass at my feet that I withered with black magic, the leaves will regain their fresh appearance. Now he was able to use all six colors normally. It''s not so difficult once you get used to it. ''''........She really is using magic. Leila told me about it. Rikka looked at the magic I was handling intently as if surprised. ''''Really, really [unemployed]?'''' Yes. How can you do magic?And six colors. I''m working on it. ''I don''t think it''s something that can be done by training...'' Even Leila could have used it before she got her blessing, right? I really don''t know what that means, siblings. It was lunchtime now that the morning classes were over. Me and Rikka bought some bread from the concession stand and ate it on a bench in the courtyard. Apparently, when Leila goes to the cafeteria, it gets noisy and crowded, so she''s been trying to avoid that lately. The first magic class I took was, to be honest, a low level one for me. I thought they were going to do something more advanced since it''s an S class, but.... Is it possible that the class wasn''t as interesting as you thought it would be, so you decided to switch places with me? That''s not impossible for Leila. ''Oh, are you two dining? I turned around when I was approached from behind and found Princess Celestia there. ''''Se-Her Highness Celestia! When I uttered the name in an upturned voice, Celestia-san looked a little sad for some reason. ''''You''re not going to call me big sister today, are you?'''' Sis! I was puzzled, but Ricca poked me in the side and whispered in my ear. "Leila calls her ''Celestial Sister''. Isn''t that guy too familiar with the princess? But if that''s what the princess herself wants, then she has to call it that...? Hey, Celessee! As if it didn''t matter, I imitated Leila and said. ''''Hmmm, I''m kind of glad I have a little sister. Hey, are you happy...? Your Highness, I still don''t agree with you. The one who suddenly interrupted was the girl who was waiting behind Celestia-san. She was a beautiful woman with a crisp nose and a serious impression of seriousness due to the fact that she wore glasses. ''''........Third year Alisa-san. She shares a room in the dormitory. As you can see, she has an inflexible personality. Rikka tells me in a whisper. Come to think of it, I may have seen her in my dorm room this morning in a glimpse. ''''Leila-san, even if Your Highness approves of it, how would you feel about calling Your Highness the Princess in such a familiar manner?'''' Alisa closes in on me. ''It''s okay, Alisa. I''m the one asking you to do this. But, but.... if someone asks me... ''Yes. I understand your concern. So how about limiting it to when no one else is around? Well, in that case... When Alisa-san nodded in a reluctant sort of way, Celestia-san turned her satisfied smile to me. Of course she thinks it''s Leila, not me. ''''Then Leila-san. Since that''s the case, I''ll ask you to continue to be Celestia-san in private places, won''t you? ''Uh-huh!Ceres sister! Thank you. ''''~~~~! Celestia patted me on the head. I''ve said it many times, but it''s because she thinks it''s Leila. If I were to be found out..... I have to keep playing Leila no matter what. Perhaps because Rikka knows my situation, she is shaking her shoulders as if to hold back a laugh. ''''Speaking of which, are you feeling well?'''' Yeah, don''t worry! ''That''s good to hear. May I join you if you''d like? Saying that, Celestia-san held up a loaf of bread that she seemed to have bought from the stall. The princess also eats bread from the stall........ ''''Of course!'''' Thank you. Smiling, Celestia-san came to sit right next to me. She smells so good and I get a thump in my throat. ''Have you two adjusted to school?'' Yes, I''m used to it. No, Ricca is a respectful term! What about Leila? ''Hmmm, maybe the class was easier than I thought it would be. I replied, pretending to be Leila. It''s not like we''ve been together for twelve years. I think I was able to trace the person quite well, even if I did, but.......it''s so different from my original character that it''s almost embarrassing. ''''That''s great. I''d definitely like to see Leila-san''s magic one of these days. Leila wants to see her sister Celes'' magic too! Rikka was still shaking her shoulders. 201-Episode 26 Anyway, Im Tsurupeta I''m tired. I had a lot of fun. Rikka is smiling a nasty smile while watching me let out a sigh. This guy really has a bad personality. My nerves were worn out from doing my twin sister''s impersonation all day long. Finally, class was over and I was able to return to my true self. ''Brilliant performance. I don''t think anyone will be able to tell it''s a fake with this one. ''I''m not happy. I mean, how long do I have to keep doing this...? Until you graduate? I''m not kidding! You''ll be fine once you get used to it. I''ll pretend this happened to me... We were returning to the girls'' dorm room. The upperclassmen, Celestia-san and Alisa-san, would be back a little later. ''''Le(i)llah, I think you should go to the bath while you''re at it.'''' What? It''s almost empty at this hour. The dorms have a large bathroom, and I''ve used the men''s dorm a few times, but it was definitely much later in the day to use it. It''s quite spacious, but it still gets crowded at certain times of the day. ''''No, it''s indeed not a good idea to use it,'''' I don''t think you need to worry about it. I care! Or do you prefer later?You''re the kind of guy who gets off on hot water after the girls get in. It''s not! After all, I had come to the girls'' dormitory''s main bathroom. After that, I was persuaded, or rather blackmailed, by Rikka. Come to think of it, Rikka knows all about this switchover. If she gets a funny feeling, the last thing she might do is to expose the fact that I dressed as a woman and entered the girls'' dormitory. Of course, that would be something Celestia-san would know about. ........am I not completely vulnerable? You''re sure there''s no one else in here? Yeah. Now''s your chance. Ricca, who had been examining the inside, comes back and gives a thumbs up. Well, as long as no one is in there, it should be okay. Let''s get a quick body wash and a quick soak in the hot water while we''re at it and quickly get up there. I stepped into the large bathroom. I take off my clothes at the edge, just to be sure. ''''...Hey, why are you in there?'''' Don''t worry about it. Of course I care! I just want to make sure you''re really following me. I''m lucky! Let''s see it. That''s why I can''t show you how lucky you are! I don''t have time for this. We have to get in there, or else the other students might come in. "Why do you have to start taking off your clothes too? I thought I''d go in with you while I was at it. What do you think you''re doing? Don''t worry about it. I care more about it than you do! I ended up going in with Ricca. ''''........hide it a bit. While I''m hiding my important parts with a towel, Rikka is openly exposing herself. I''m used to seeing naked people with similar bodies (my sister''s, of course), but naturally I''m embarrassed when it''s a stranger''s naked body. ''''It doesn''t diminish when people see me,'''' You should be a little more embarrassed about your infantile body - or should I say, a little more embarrassed?Wait, why did you kick me?! I''m a vine. Surprisingly, he was concerned about his body shape. ''I mean, how old are you, anyway?'' ...14 What?Fourteen...?He was two years older than me? I thought they were at best the same or younger. It''s a good thing that you''re not the only one. ..........I''m flat anyway. I decided to quickly wash up with Rikka, who whispered again in a low voice, behind me. "Anna, have you gotten big again? Yeah, not really. You''re lying!Give me some of that! Wow, I think I''ve gained weight again. Ah, shucks. I think I''ll go on a diet. You''re pretty good at that. The high-pitched voice of a girl''s distinctive cappings echoed here and there, deafening me. How did this happen...? I told you that no one would be using the big bathroom at this time.... All of a sudden, the girls came in in droves. Even now, their numbers were increasing and the inside of the large bathhouse was now a full skin color. I glare at Rikka while hiding my appearance as much as possible by soaking up to my ears in the bathtub. ''''I forgot to tell you. Most of the senior students take a bath as soon as they finish their practical training. Rikka says it without taking offense. This guy is a sure thing, no matter what you think. Apparently, it seems that the only people coming in now are upperclassmen. Rikka asked, "How are we going to get out of this? He turns his face toward me. I''m still in the process of washing up, but I''m sure they''ll be rushing me into the hot tub now. I have to get out of here somehow before that happens. ''''Well I wouldn''t want you to lick me. Confident? I used covert. "What?Gone...? Even Ricca, who was supposed to be watching me, couldn''t recognize me anymore. Yes, it''s possible for me to act completely unaware of my presence if I get serious. I proudly get out of the bathtub and walk to the changing room. Ugh.........just as a group of girls entered the bathroom....... And they''re coming straight at me. Oh, don''t be in a hurry................just meditate on them. If you grasp the position of your opponent with just a hint of presence, there''s no need for vision. I avoid the group with my eyes closed. That''s how I finally arrived at the exit leading to the changing room. That''s when it happened. ''''Your highness'''' body is still beautiful no matter when I see it. Don''t flatter yourself, Alisa. Just as I entered the changing room, I ran into Celestia-san. 202-Episode 27: No, I cant understand Your body is as beautiful as ever, Your Highness. ''Please don''t flatter me, Alisa. This one is still troubling me, as I seem to be gaining some weight lately. Right after I left the changing room, there was a pair of people walking in front of me. It was Celestia-san and Alisa-san. I couldn''t help but open my eyes. ''''~~~! I''m about to take a bath, so it''s only natural that I''m going to take a bath now and I''m going to look like a complete stranger. ........like a goddess who jumped out of a painting. Although she is slim, she has feminine irregularities, and her arms and legs are long and well-proportioned to the golden ratio. The beautiful, translucent, fine-grained skin was drenched in sweat, perhaps because it was right after practical training. ''''........?Miss Leila? Oh, no! I was so upset that my cover was about to be broken. I hurriedly regained my presence of mind, killing it perfectly. "Your Highness?How can I help you? ''No, I think I just saw Leila here...'' Well there''s no one here but... ''Yes. Apparently it was my imagination. I patted my chest in relief. I suppressed my heart, which was about to jump out of my mouth, and hurriedly collected my clothes. I almost didn''t wipe myself off, but I put them on my body for now, and then I escaped from the large bathhouse. ''''It was a terrible experience...'''' Yeah?I enjoyed it. Hey, is it okay if I hit you now? When I came back to my dorm room, I was beginning to have a real desire to kill Ricca. ''Against violence,'' There are a million ways to hurt someone other than through violence, aren''t there? Oh, we''re not intimidated. Rikka backed away. ''Maybe it''s surprisingly timid that this one works. ''But inwardly you''re happy, aren''t you?Seeing the girls naked. I''m not happy! Really?Maybe you''re not familiar with it yet? ''Can you stop stepping into na?ve areas with impunity! Or are you going to pull it off tonight, princess? No, this guy, I can''t get through to him. It''s been a week since I replaced Leila and came to the Department of Magic. During that time, I continued to play Leila. Rikka still gives me a lot of trouble as usual, but no one sees through it, and I''m somehow getting used to my life. Most of all, Celestia is kind. Even though she''s a princess, she always speaks to me in a friendly manner, and I could tell that she''s not only beautiful on the outside, but she''s really beautiful on the inside as well. ........Although it''s painful to be deceiving such a person. ''''Ark!I''ll take your turn. It was midnight, just like last time. I don''t tell you why I felt a little disappointed when Leila, dressed as me, appeared to say that. ''''Huh ... are you finally satisfied?'''' ''Yes!Did you have a good time with ARC? I''ve been on edge for a long time before that, but... It wouldn''t be so much of a fuss if girls were caught disguised as boys, but it wouldn''t be so much of a fuss if it was the other way around. The world is so unfair. ''Leila hasn''t been found out, has she? That''s a problem. ''Don''t worry about it!Because I was making it look exactly like ARC! Saying that, Leila suddenly changed her face. She gave a somewhat nihilistic smile, and even changed her tone of voice. "...Huh, you''ll get hurt if you piss me off...? Who''s that? I''ve never uttered that line in my life! How''s that?Didn''t they look just like each other! Not at all! I put my head in my hands. I didn''t think I''d spent the past week in this kind of middle-aged character...? I furiously didn''t want to go back to the martial arts department. ''''Eh, I guess it''s similar...'''' Leila''s lips twitched. I was a fool for expecting this guy from the beginning........ Then we exchange uniforms and I go to the boys'' dormitory. It''s a heavy heart, but I have to give up. I go back to my room in the boys'' dormitory for the first time in a week. It seems that they are already asleep, so I stepped in through the window and tried to slip into my bed, but I stopped myself. Because there was someone there. It was Gaon. Huh? Why is he sleeping in my bed? And for some reason, the top bunk was open. Originally, Gaon was supposed to be sleeping on top. For all intents and purposes, it seems that the senior students are great, so they always take the upper bunk. ........If only the top bunk is empty, it can''t be helped, right? In the end, I decided to sleep on the top bunk. The next morning. The morning bell rang as usual, and I woke up. Well, it''s another energetic day of cleaning. In the girl''s dormitory, we were all working together, but here I have to do it all by myself. Well, it''s not much work, so it''s no big deal. Good morning, Ark-san! .... hmm? I think Gaon just called my name.... But it''s funny, right?You misheard me, didn''t you? There''s no way that Gaon-san would call me "Ark-san". Please leave the cleaning to us.......... I heard it again. When I looked in the direction of the fearful voice, I saw Gaon-san saluting me. What is this leopard! He''s a completely different person from the last time I saw him. What the hell has happened in the past week! It''s Leila''s fault no matter how you look at it. What did that guy do to Gaon-san........ 203-Episode 28: Still a Hero Hey, what happened in the past week? Don''t you remember? Ranta rolled his eyes, looking a bit frightened. The question was asked because I thought Ranta would know what Leila had gotten up to, but if I thought about it, it was strange for me to visit it myself. ''''No, of course I remember!I remember, but do I sometimes forget myself?Or something like that... so I thought I should hear from a third party, just in case... ........Yeah, I can''t understand what I''m saying. Sure enough, although Ranta looked at him like he was looking at a dangerous person. "Indeed, you''ve been acting a little strange lately.... You''re in a weird mood... and you''re having trouble communicating... and you''re kind of scary... Leila..... ''Oh, yeah?Ah, hahaha.... I tried to laugh and fool myself, but I didn''t think it was going to work. Perhaps I was afraid of such a person, but Ranta told me what happened while me and Leila were swapping places with a suspicious look in his eyes. Briefly, it seems that Gaon-san and I (Leila) had a fight. ''At first he said something like, "I''ll give you practice," or something like that. But Gaon-san clearly wanted to hurt you. Only, contrary to my expectations, you ended up knocking the two of us down... And Gaon-san and the others, apparently angry at losing to the first year, abused me badly. ''''Then you completely lost your temper...'''' I don''t know what he said, but........Leila is usually like that, but when she gets angry, she''s scary...... I remember when she made fun of my father before and I was furious. ''''Gaon-san and the others beat me up.......and somehow my injuries healed.......and they beat me up again......and they wouldn''t forgive me for crying and screaming........'''' Wow..... Since then, they have been afraid of me and their positions have been completely reversed. ''''Oh, well........yeah, that''s what I thought.......haha......'''' It''s not funny. He''s not doing anything else, is he? What, because I was making it look exactly like an ARC, you know! No, it''s okay. I wouldn''t do that to Ranta. Huh. Huh?I meant to reassure you, but it had the opposite effect...? Ranta is a good guy. He doesn''t care if I''m in E class or not, he hangs out with me. I''ve been told that people in other classes, when they find out I''m an E class person, are blatantly ridiculous to me. I didn''t want to feel awkward with Ranta like that. I decided to tell the truth. Ranta wouldn''t use me as a threatening material like Ritta did. ''Actually...I was swapped with my twin sister. ''What?Seriously?Do you have a twin sister? Yeah. My name''s Layla. You mean, Leila?No, I thought we looked alike for sure, but... Come to think of it, I think they were talking about that after the entrance ceremony. ''''So you were her until yesterday?'''' That''s what I mean. "Well I figured I''d smell a little better in reason. Hmm?What did you say? It''s nothing! Ranta hurriedly shook his head and then nodded as if Gainshin had said. ''''That''s why she was so strong.......Magic Sword Princess, right? Not only did you enter the magic department at the top of your class, but you were also able to overwhelm senior martial arts students with your sword. Ranta let out an exclamation of admiration. ''But it makes sense now. I''m relieved to hear that. I don''t think you''re going mad. I knew you felt that way... "But I didn''t know Leila-chan was so close... hahaha... For some reason, Ranta snorted. ''Huh?You''ve been a little Layla all this time, haven''t you? Well, well, yeah... You mean, he lived in a girl''s dormitory...? Uh-huh. I nodded fearfully at Ranta, who started to shake with a plop, and I nodded fearfully. To be honest, I didn''t expect this reaction. I was dreading the possibility that I might be denounced. I''m so f*cking jealous! ........I knew this guy was a guy too. Hey, hey, how was it?What''s going on with the girls'' dormitories! It''s pretty much the same as the boys'' dormitory. ''I''m not!Ya, I knew it smelled good! In some places... ''Whoa, whoa, really?I love it!I want to go to the flower garden too! I was in a state of panic, wondering when they would find out... "Have you been in the women''s room too...? It''s not... it''s the only thing I could do and... ''Seriously?You''re a hero! For some reason, I was treated like a hero. ''''That said, it''s properly divided into private rooms...'''' That''s heroic enough! I have no idea what the criteria for a hero are. ''Well, you''re not going to tell me that you even went to the bathroom...? That''s not what I''m talking about! Well that''s true, isn''t it? You''re already a big hero if you even take a bath. I really did go in.... But I''m glad I denied it. I was about to be made a great hero. Hey. Hmm? Ranta asked with a serious look in his eyes. ''Would I be allowed in the girls'' dormitory if I dressed as a woman too? I don''t think I can do it. 204-Episode 29: Weaknesses are completely held It had been a month since she had returned to the martial arts department. Fortunately, or should I say, the biggest thing that Leila had done was the one incident with Gaon-san. Although, because of my imitation of her, she was obviously looked at strangely by the people around her because she was too much of an imitator. The damage was small, partly because there was still no one in the class who could be called a friend. ........Well, even now, a month has passed, I still don''t have any friends in my class. To begin with, everyone in E class was crusty. The atmosphere was dark, and even during recess, I could only hear the minimum amount of conversation in the classroom. Perhaps it''s because the teacher had threatened at first that the level of difficulty of the class is so high that not a few students drop out of the class every year, but even the group that was so energetic right after entering the school has become completely quiet now. ''''It''s no good........I don''t think I can keep up with you anymore.......'''' "Me too.......I guess I wasn''t worthy of this school after all....... Recently, such voices have begun to be heard here and there. ''''...?I think we''ve only done the basics...? That night, I was awakened by a presence approaching from outside. The window in my room shook slightly, but it didn''t open. But the window didn''t open. "Ugh~ Why won''t it open? I can hear Jidanta from outside. I knew he was here. I chuckle as I lie back in bed. It''s Leila. I knew that she would come back to me with a suggestion to switch places again sooner or later. That''s why I''d set up the window in advance. To be specific, I put up a ward to make it impossible to open and close. Otherwise, it would be easy for Leila to open it, at least to lock it up. There are two places to enter this room: the entrance door and the window. The easiest way to get in is through this window. We''re on the first floor, you know. But it''s Leila. There is no way she would give up after this. Sure enough, this time I came around to the door of my room. The entrance to the dormitory is locked, but it''s easy enough for Leila to open it. ''''I can''t open this one either! The door was already taken care of, of course. I fell asleep again, feeling Leila leave. ''Hey, hey, Ark. I got a letter for you? Me? The next morning, Ranta brought a letter to me. The letter to the dormitory students would be delivered to the administration room, where it would be collected by the residents of each room. ''Don''t tell me it''s a love letter? No, I don''t think so. I deny it, but I''m a little nervous about it. After all, I''ve never received a love letter, including in a previous life. I open it and read the contents, wary of Ranta trying to steal a peek. ''I''ll be waiting for you on the roof of the school building this evening. ........If you just look at the wording of the letter, it''s exactly what it is, a letter of confession. But this is different. I know what it is. I can''t help but notice the writing. It''s Leila''s handwriting. After the failure of yesterday, he decided to call me directly. But if you call her out normally, she might be too cautious to come. That''s why he did not write his own name, but instead made it a love letter style. It might be Rikka''s idea. Is it possible to fall for such a trick? At the very least, you should write it in nicer handwriting. I decided to ignore it. Then the next morning, I received the letter again. "I''ll be waiting for you on the roof of the school building this evening. If you don''t show up, I''ll tell you all about the brutality in the girls'' dormitory, so brace yourself. ...I gave in to the threat. ''Why is this happening again...'' I had swapped places with Leila and stepped into the girls'' dormitory again. The common room set up in the dormitory. Most of the students were already asleep, and I was reunited with Rikka. It''s been a long time since I''ve seen you. We''ve missed you. I didn''t want to see you. You were the one who wrote the threatening words in that letter, weren''t you? Yes. Unlike Leila, you''ve got a good handwriting, don''t you? Rikka shows a smug look on her face. I don''t care about the mess. ''''He''s completely vulnerable........'''' But you''re really happy, aren''t you?Get close to Princess Celestia again. Maybe we''ll see her naked again, too? No, I don''t think so! Is that so? Rikka looks at me with a nasty look on her face. ''So, has anything changed since a month ago?'' Well I guess the big thing is that I joined an independent seminar. "Independent seminar? ''It''s a seminar that the students are voluntarily organizing. It''s led by the Princess, and they''re doing some practical exercises. Mr. Celestia? ''The requirements are so strict that only students in the lowest S class are allowed in. Leila is the only first-year student allowed to participate. They have been holding mock battles and defeating demons mainly after school, on holidays and long vacations. While only the best of the S class can participate, Leila was allowed to participate due to Celestia-san''s direct recommendation. ''''In other words, that means I''ll be participating in that instead of Leila....... You look happy, don''t you? Oh, yeah? It''s like a club activity, and I just thought it would be a little bit of fun. I don''t think it''s because I''m with Restia-san or anything like that. I don''t think it''s because I''m with Restia or anything like that. Oh, yeah. And one more thing. Ricca clapping her hands with a pop. She seems to have remembered something. "We have a test tomorrow. I have a test tomorrow, a midterm. Good luck. Leila''s, that''s why she replaced me again.... 205-Episode 29: Lend Note Because of Leila, I had to work my entire personality to full capacity and stay up all night studying for the test. I''ve only taken classes for a week since the last time I switched, so I''m studying almost from scratch. ''I would have had a day or two to spare if I''d complied in the first place. Shut up. Give me your notebook. Leila''s notebooks had dirty handwriting, so I decided to ask her to show me Ricca''s notes. ''I mean, why do I have to go to this extent for that guy...'' Despite such doubts, I managed to get through the midterm exam. I was confused by the suddenness of the test, but the content of the test was very simple and basic, so it was helpful. In fact, it''s a level where I can get full marks with ease. However, it''s not good for Leila if she gets full marks as a replacement. It''s more annoying than anything else. I decided to make a moderate mistake. --I did, but......... ''Leila-san, you''re very good. And topping the written examinations as well. It''s wonderful. The day after the test, right after the test, while looking at the names and scores of the top performers posted in the hallway, mouths go up in praise of me (Leila). Grading early......... 1st place, Leila, 450 points. Second place, Belzea, 439 points. Third place, Ricca, 428 points. Fourth place ..... It''s a perfect score of 500. I thought a score of about 90% would be enough, but people didn''t score as well as I expected. Thanks to that, Leila got first place. By the way, third place has Ricca''s name on it. That Rikka said as if she was impressed. ''''I didn''t expect to lose to an overnight martial arts student. Well, I do have one question for you. Do you guys study for the test?I purposely kept it down to 90%, but... Do you want to be killed? For some reason, the killing intent came from Rikka. Since the test was over, Celestia''s independent seminar was going to resume. I, who had been replaced by Leila, was going to participate as Leila. Five fourth-year students, led by Celestia, had gathered there. There were four third years, including Alisa-san, who shared a room in the dormitory. There were two sophomores and Leila was the only first year. Twelve students in all. Of course, the students were in the S class without exception. The male to female ratio was exactly 50/50. ........but because of me, there were many boys. ''''Today, as I told you last time, we will be conducting a real battle against demons outside the city. Please brace yourself even more than usual and join us. ""Yes!" To Celestia''s words, the participants straightened up and responded emphatically. ''''Sensei, it''s nice to meet you.'''' Yes, sir. It seems that one of the instructors will accompany me. She''s a woman in her mid-forties, just like a veteran. Apparently, they''ll be traveling by carriage. This is indeed an independent seminar hosted by the princess. I''m sure you''ll be able to find a great deal more to say about it. ''''This area is nice. We get out of the carriage we stopped in. Demons that live in the forest sometimes come out to this area, but we don''t encounter them as often as we do in the forest. That''s why it seems to be a good area for real-world training. ''''Then let''s move in the usual formation. ""Yes!" ...the usual formation? Of course, I don''t know that I''m being replaced by Leila. When I was confused, Alisa told me in a stern tone. ''What are you doing? You''re right next to me.'''' Uh-huh! I hurriedly lined up next to Alisa. We proceeded through the meadow. The first thing we encountered was a bull demon with sharp horns. It was about three meters long and its body was completely black. It would be easy to understand if you can imagine a muscular, rabid fighting bull. ''''Devil bison........! The accompanying teacher screamed. ''''I didn''t expect to suddenly encounter such a demon.......!Your Highness, before you even notice us-- No, no problem. First team, prepare your attack magic!Group 3, prepare for the demon''s rush with earth magic! Ms. Celestia interrupts the faculty member who is trying to urge her to avoid combat and gives her an order. ''''Ice Edge!'''' Waterlance! Several shots of attack magic, mainly blue magic, hit the Devil Bison''s huge body. ''''BMOOOH! But the damage is minimal, and Devil Bison excitedly rushes at us. ''''Groundwall!'''' The rush was stopped by a thick wall of earth that appeared on the verge of a collision. It slammed into it as hard as it could, and the Devil Bison''s huge body flipped over. ''''Second group, now! Now it''s red magic and green magic. The devil bison let out a cry of pain as they were bombarded with blades of fire and wind at close range. It seemed that each group had its own role, and they were divided into three groups: the first group was for blue magic, the second group for red and green magic, and the third group for yellow magic. The first group is for long-range attacks and checks, the second group is for close-range attacks, and the third group is probably specialized in defense. Alisa-san is in the second group, so probably Leila is in these two groups as well. I guess there are four groups left. Probably the users of white magic and black magic. Eventually, the Devil Bison died and stopped moving. But due to the use of red magic, his whole body is a wreck. Devil Bison''s meat is quite tasty, so you shouldn''t hurt it too much. The faculty members exclaimed in admiration. ''''Excellent!Her Royal Highness is indeed an independent seminar!I can''t believe that they took down the Devil Bison so easily. It was a splendid partnership. It''s the result of extensive training. 206-Episode 30: Dont Call Us Familiar After that, they encountered several more demons. The Devil Bison seemed to be classified as a strong enemy in this area, and they were defeated by the magic of the first group before any of the demons could get close enough to them. There was absolutely no chance for me, who was in Group 2, which was responsible for the close range attack, to take part in it. ........I''m bored. Hm? And then I detect a presence. A few dozen meters away. There was something hiding in the grass, slowly approaching us. It''s probably a demon. Maybe it''s because they''re a little better at disguising their presence, but no one other than me seems to have noticed it yet. ''''Um, Celese-sister.'''' I called out to Celestia. Then everyone looked surprised, and even Arisa-san stared at me with a horrible expression on her face. ''''Don''t call me that familiar name during an independent seminar........! Oh, I see. I wasn''t allowed to call her that in the presence of others. Well, it''s Leila, and I would normally call her that. ''''More importantly, Leila-san. What''s going on? Only Celestia-san doesn''t seem to mind at all, but rather is happy about it. ''''Ah, unh. The demon is-- No, it''s too late to explain now. As if it had noticed that we had become distracted, the demon was already leaping at us at breakneck speed. "Windcutter! Thump! The demon''s head flew off from the wind magic I released. Even though it lost its head, the momentum didn''t stop immediately, and the giant body slid on the ground for a while. ''''Na.........'''' Did you mean to tell me that we''re being targeted by a monster? It''s already an afterthought, but I''ll tell you with a smile like Leila. ''I didn''t notice that at all...'' Hey, look. Isn''t this the Assassin''s Panther? What?Seriously? Apparently, it was a demon that was skilled at eliminating signs, and even skilled warriors could be taken by surprise and killed. ........hmmm? A little bit of attention would have made it obvious. There were a lot of demons in the forest that my dad took me to when I was a kid, though, that were much better at hiding. ''And now magic...'' It''s just a wind cutter. But I''ve never seen a cut like this before... Everyone rolled their eyes and looked at me. Is it really that surprising? This is something Leila would do all the time, right? This is the Magical Sword Princess... ''I should have been called to this seminar in my first year...'' Of course, Her Highness couldn''t be wrong about that. Celestia-san says with a smirk. ''''No, Leila-san''s abilities aren''t like this. If I had to guess, it seems that it was just before the test that Leila decided to join this seminar. This was the first time for her to participate in practical training, and it was apparently the first time for anyone other than Celestia-san to see Leila''s magic. Even so, as expected, it''s too surprising. Wind cutter is a beginner''s magic, and its power is easy to adjust. Then we took a little rest and resumed our search. We succeeded in defeating the demons several times, and after a while ''Well then, gentlemen, it''s time to get back to the city. Thank you for your efforts. Apparently, this was the end of today''s training. I was about to return to the carriage. ''''Your Highness, there''s an orc-like demon approaching from over there. When I looked in the direction that one of the participants was pointing, I saw that it was indeed an orc. It may have already recognized us, but it ran over to us with its eyes bleeding. ''''Then let''s deal with that demon first. Orcs aren''t that strong of a demon. If there were a lot of them, but it was only one. In the midst of the relaxed air that it would be taken care of soon, I feel a sense of discomfort. .........Isn''t that guy''s presence strange? Aura" is a single word, but it is made up of many elements. For example, breathing, footsteps, heat, scent, movement of muscles and bones associated with movement, circulation of blood, movement of organs such as the heart, and the magical power emitted from them. Naturally, they are moving their bodies and approaching with a murderous atmosphere, so I can sense a strong presence, but... something is wrong. There''s still some distance between us, so if you get a little closer, I might be able to figure out what this strange feeling is. ''Fire Arrow. "Firelance. "Wind Arrow. The members of the first group released long-range magic. One orc was hit by several rounds of magic. ''''Did you get it?'''' What? Who? Did you just raise the flag? Sure enough, we didn''t do it. The orcs are coming towards us as if nothing happened. ''''Huh........That''s not a normal orc! Surely you''re one size too big... or are you a high orc? Yeah, that''s why it didn''t work so well. I''ll just have to pay him a visit with some close-range magic. High Orcs are a higher species of Orc. It is considered to have a larger body, which makes it more powerful and durable. Hmm, but there''s not that much difference between a high oak and an oak, is there? I have a feeling that that orc wasn''t on that level of difference in the first place....... ''''Boo-ohh! An orc rushed in with a yell. ''''Groundwall!'''' The orcs collided with the wall of dirt that suddenly appeared. There, the magic of the second group erupted in fire. ''''Bu-ooh-ooh! The Orcs let out a scream of dismay at the firepower that should have killed the Devil Bison earlier. The giant body fell to the ground. ''''........This size, it seems it was a high orc after all. Celestia-san approached the charred orc. ''''Ha!Watch out! I couldn''t help but scream. The orc wasn''t dead yet. Despite its condition, there was clearly still a sign of it. ''''Boo-oh!'''' What? Sure enough, the orc suddenly got up and pounced on Celestia, who was stunned by the suddenness of the situation. 207-Episode 31 Boo-oh! ""So, Your Highness!" The orc''s stiff arm swings down over Celestia''s head. Zang! That arm flew through the air. I was on the verge of interrupting it and slashing it off. Despite having its arm severed, the orc showed no signs of pain. On the contrary, it leapt its huge body and tried to rush forward. Zubang! This time I slashed his legs. The orc flipped over from its head to the ground. Almost no blood has come out of the severed area. It''s just as I thought. "This orc is turning into undead. Oh, undead...? A chain of gasps from behind me. ''Yeah. That''s why it''s hard to take them down with normal attacks.'' "Boo-hoo! Shut up. "Bougougou? I sent a heel drop to the head of the orc who was screaming angrily as he fell. Of course, such an attack would have no effect on the undead. ''''Holy Ray.'''' ''Aaaaaaah! The light magic belonging to the White Magic Law purifies it. When it was bathed in that light, the Orcs stopped moving as if their previous durability was a lie. ''''Are you okay?'''' After confirming that the undead orc was completely extinct this time, I call out to Celestia-san, who is poking her buttocks into the ground. ''''Ha, yes. I was saved........ Celestia-san nodded her head in agreement, but I could see that her voice was trembling a bit. Besides, she seemed to have buckled down and was having trouble getting up. I reached out my hand. ''''Oh, thank you.'''' Celestia grabbed my hand and managed to stand up with it. ''''Your Highness, are you alright?'''' Alisa-san rushes over to the side. ''''Yes ... thanks to Leila-san ...'''' Alisa, who doesn''t seem to think too much of me, or Leila for that matter, bows her head deeply. ''''Thank you so much, Your Highness. If you hadn''t stepped in to help us, Your Highness would have been....... And that''s just as well. I waved my hand in a buzzing motion. "But then again, a high orc undead... No way.... Hey, come on, man. There is no Demon King. Yeah, well, it''s a coincidence... Everyone is turning blue in the face. Four years ago, this royal capital had been attacked by a group of undead and was on the verge of falling. Maybe they are remembering the fear they felt at that time. Then we got into the carriage as planned and headed back to the city. A gloomy atmosphere fills the carriage, unlike the one we were going to, but Celestia opens her mouth in a cheerful way to dispel the gloom. ''Ladies and gentlemen, there''s no need to be so depressed. There were a few unforeseen circumstances, but all of us were able to finish the training safely. Let''s make the most of what we learned this time. After we returned to King''s Landing, the order to investigate was given to the knights. Since the princess''s life was threatened, it''s only natural. I heard that an investigation team entered the forest as well, but in the end, no undead monsters seemed to have been identified. There was no chance of a demon spontaneously becoming undead. They have concluded that it probably happened by accident. This was all told to me by Ricca. By the way, the appearance of undead monsters has been hushed up inside and outside of the academy because of the anxiety it causes people. ''''Rikka, you know it well. My dad''s a very important man in the court. ''What?Is Rikka actually a nobleman''s daughter? ''Yes. So you''d better watch your attitude, okay? Rikka jokingly threatens me. However, given her personality, she doesn''t seem to be able to rely on the house. The participants in the voluntary seminar seemed uneasy at first, but recently they are recovering from it. Celestia, the organizer of the seminar and the person who must have been in the most dangerous situation, is doing well. However, despite the cheerful atmosphere, is it my imagination that she has been looking a bit tired lately? That night, I woke up. For a moment I thought it was Leila again, but no. ''Huh, huh, huh...'' Rough breathing echoed in the quiet room. It was from the bed on the other side of the room. Celestia had raised her upper body and was hugging herself with both arms. She was trembling slightly. ''''.........Celestia-sister?'''' ...Leila. Are you okay? Yeah, don''t worry about it. I just had a little scary dream, that''s all. Mr. Celestia lay back down. ''I''m sorry to wake you up. ........Good night. Well, good night. Worrying, but deciding that any more would be unnecessary meddling, I tried to fall asleep again. But after a bit. Well, Miss Leila. What, Lisa? Well, you see... Miss Celestia stammered something. As I waited without hurrying, she said fearfully. ''''Well, can I sleep with you over there...?'''' FUH? I freeze my head for a moment at the shocking request. No, I''m going to sleep with you! Me and Mr. Celestia, in this small bed together! ''Jeez, actually I haven''t been sleeping much lately because I''ve been having a lot of scary dreams...'' "...Miss Celestia. Apparently, he was definitely under the impression that he was tired. The fact that he looked fine to the side was probably because he was acting like he didn''t want to show it to those around him. ''''Of course, of course, if you don''t want to, you can refuse...'''' I shook my head reflexively at the sound of his fading voice. ''Y-yeah, I don''t hate it!'' 208-Episode 32 is really similar Celestia-san comes into my - Leila''s, to be precise - bed. The soft skin swinging in her arms and the sweet scent of her skin makes me cringe. Nope, it''s not! It was never an ulterior motive to allow it! I''m just trying to help Celestia sleep in peace, with 100% good intentions! Celestia-san not only turned her head to this side and laid down, but she also leaned closer to me. Celestia chuckles. I knew it? Well, I''m glad you''re relieved, but I, on the other hand, can''t seem to sleep for other reasons. ''But usually it''s the other way around. I''m a pathetic big sister. Oh, yeah? Celestia''s face is right next to mine. If I turn my head to the side like this, it''s so close that our lips will be touching. But as expected, I don''t have the courage to do that. I''m still lying on my back. "Four years ago........ Suddenly, Celestia-san lowered her voice and muttered. ''''I don''t think Leila-san knows this, but.......this city was attacked by the Demon King''s army. I know. "....many residents have been killed........ Moreover, the people who died have been turned into undead by the enemy''s power and are attacking humans....... The undead were increasing one by one, and the King''s Landing was on the verge of falling....... Indeed, if we hadn''t stopped by, it would have been occupied by demons. I myself was attacked by the undead controlled by the enemy''s ringleader at that time.... ...I myself was attacked by the undead controlled by the ringleader of the enemy.......and through the shade of that man, I managed to get nine deaths......but since then, I''ve been afraid of the undead......and sometimes I wake up in my dreams. It''s gone. It''s been settled for a while now, but... He must have been attacked by a high orc undead the other day, and he must have returned again. ''''Sister Ceres,'''' ...Yes? ''You''ve been acting so stout in front of everyone. That''s not... ''Yes, I know. Because I''m a princess. She can''t show her weaknesses, can she? .... But you don''t have to be shy with Leila, okay? What? Leila is on the side of big sister Celes! I feel guilty for not being the person in question but I''m sure Leila would have said something like this. Celestia-san rolled her eyes for a while, but then suddenly Squeeze! ''''~~~~? He hugged me! ''Thank you, Leila... thank you...'' But, of course, this was unexpected! I didn''t say sweet nothings in anticipation of this happening! Naturally, I couldn''t shake it off, right? So I had to accept Celestia-san quietly. It can''t be helped, yes, it can''t be helped. (...really calming.) Celestia felt the fear she had felt earlier fade away as she hugged the first year, who was four years younger than her. When she opened her thin eyes, she could see her profile with her red hair. Despite her still young face, however, Celestia felt that she was more reliable than anyone else. (A different person, right?) What she remembers is the one boy who saved her from a desperate situation that day. An undead chimera controlled by a necromancer who was a member of the Demon King''s army. The boy easily defeated the undead chimera, which was controlled by a necromancer who was a member of the Demon King''s army. She never forgot that scene, not even for a day. But, unfortunately, she didn''t know who the boy was, or even his name. (But he really does look just like him.) Her eyes were the same as the girl in front of her, her red head of hair. Four years had passed since then, but the face was very similar. And the overwhelming strength........ That''s why, when I''m by her side like this, I forget the nightmare I saw earlier and feel a sense of security. When Celestia saw him for the first time at the entrance ceremony, she said, "It''s that boy! And I was glad to see her again. But I was greatly disappointed when I soon found out that it was a girl. (Does it look like a boy, but it''s actually a girl...?(But your reaction to what you said earlier.......you must be a different person. If it was the same person, I''m sure it would be, "Oh, that''s Leila! He would have said. To begin with, I remember that boy''s personality was completely different from Leila''s, even if it was only for a moment. (.........or could they be brother and sister.......?Speaking of which, I heard about your family-- Celestia got to the heart of the matter without a figure. However, perhaps due to the accumulation of recent fatigue, that''s where sleepiness prevailed and she slowly let go of her consciousness. The next morning I woke up struggling to breathe. It was because my face was buried in something soft. Well, this kind of thing is not uncommon. My sister has a habit of climbing into people''s beds without permission in the middle of the night and cuddling up to me. It''s her father''s bed when he''s around, so she''s probably making me her father''s substitute. I''m sure it''s been a long time since he''s been in bed with his father, but it''s still a long time. Hey, Leila. You''re in a lot of pain, get away from me. I forcefully try to push Leila away. Then the palm of my left hand, which I put a lot of effort into, felt something I had never felt before. .........Huh? What''s so soft? Did I ever see this on Leila''s body? No, Leila should be sleeping in another dormitory right now to begin with. ''''Huh?'''' Then I finally remembered what happened last night. Yes, as I recall, Celestia-san came into my bed. Then what is this feeling..... I looked at the tip of my left hand in fear, and what was there was a beautiful bulge. Nooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! What am I doing? 209-Episode 33: Ordering the entrustment is a proof of small fish ''You had fun last night, didn''t you? How do you know that? I was teased by Ricca. "Anyone would have noticed if she hit you that hard right downstairs. ''I didn''t do that!It''s just cuddling, cuddling. I think it''s too much of a power word to be described as just sleeping with a princess. Rikka prefaced it by saying, "I wonder what the princess''s followers would think if they knew. Are you glad it''s a girl? He laughs with a nasty look on his face, such as Fortunately, they don''t seem to have found out that I touched Celestia-san''s chest. Of course, that was a force majeure, and I''m not guilty of anything, but if Rikka were to find out, she would be even more vulnerable. Celestia-san herself hasn''t found out about it, I''m sure. After that, she woke up a while later, too, and her cheeks dyed to the Lord in a bit of embarrassment when she remembered that she had slept with him in his junior''s bed. She looked so cute, and even I couldn''t help but feel my face heat up. Even so, Celestia-san''s body was so soft........ She''s been hugged by Leila a lot, and I thought she was used to it, but it''s still completely different from being treated by her sister. ''''Layla?'''' .... ''Leila?Hey, come back. .... Don''t ignore me. I''ll scream your real name. Ouch. Rikka slaps me on the head and I come to myself. Every time I remember the feeling of last night, it''s been like this for a long time. Thanks to this, I haven''t been able to concentrate at all since this morning. Whenever I listen to a class, I go from right to left. I don''t really need to listen to it because I already understand it anyway. ''Hey, let''s duel!'' It looks like the martial arts students are going to duel with each other! ''Seriously?Sounds interesting, let''s go see it! And then we heard those voices and we turned around. A group of excited students ran off somewhere. ''They said a duel,'' Hmm. You don''t sound very interested. No. It''s all very cool, but isn''t the point of a fight? That being said, as a boy, I was a little concerned about it. ........though I''m pretending to be a girl now. ''''I heard that the third year of S class and the first year of E class are going to fight against each other, after all! No, it''s over in a flash. And she''s been out of work for a year. ''Oh, come on, you''ve already lost it completely before you''ve even done it, not for a second! Me and Rikka looked at each other. I had a bad feeling about this. It was the courtyard that stretched between the martial arts and magic school building. A large number of students had gathered there, and it was quite busy. In the midst of all this, there were two shadows confronting each other in the center of them. One of them was a boy who was probably three or four years older than me. He is looking down at his opponent with a sneer on his proud face. And the other, as expected, is Leila disguised as me. What the hell are you doing? Hmph, you don''t know what you''re doing by challenging me to a duel with an "unemployed" person. When the boy sniffed, Leila sneered back. For some reason, she covered her face halfway with her hands. No, who''s that? My roleplaying is too bad........! How much more of this do you think you can fool me... The boy drew his sword. ''Don''t cry with regret later! Onlookers sprang up as the duel finally began. ''Yes!Show your cocky year what you''ve got in your eyes! Well, the game will be instantaneous. One gold coin for every ten seconds it takes. ''Haha!This won''t take ten seconds!I''ll have two gold coins in five seconds! No, it''s Mr. Ark who will win! Oh, come on, man, are you f*cking crazy? Some of the students start placing bets. Most of them are confident that the boy will win overwhelmingly. But I - or rather, some of the voices predicted that Leila would win. Well, if you look closely, it''s Gaol-san. I''m being ridiculed by those around me for loudly declaring that I would win. ''''In the first place, can you defend against my sword even with a single blow?'''' It was the boy who set him up. He kicked the ground and closed the distance in one go. ''''Ha, fast!'''' That''s the Heavenly Sword, Kasem! .... hmmm? Fast, I guess...? Boom! Leila easily received the sword that the boy swung down. ''''Huh........my slash.......?Yes, but that was just a greeting! Just as the boy was about to leap, he suddenly changed his trajectory in the air. It''s called Tensho, a skill that allows you to jump in the air. What a move........? That''s the Heavenly Flying Skill?You can''t predict an attack if they fly around in three dimensions that fast! There was a groan from the onlookers. "Now, will you be able to block the next attack? Immediately after, the boy pounced on Leila. Whack! It was easily prevented again. ''Bah, stupid...?d*mn, it looks like I don''t need to go easy on you! The boy leapt again. Then, just before he was about to enter a pause, he used Tenshou to slightly shift his trajectory. Clang! Leila didn''t get it at all, though. ''Nah...'' I told you to stop talking like that! Not even a giggle like a villain! The next moment, Leila''s figure was scratched off. ''''What?'''' Not only did they seem to have completely lost sight of the onlookers, but even the boy who was dueling. ''Where are you........'' "Kuhu.........here........ What? Layla was behind the boy. ''Gahhhh!'' 210-Episode 34: Why Do You Suddenly Perform Joint Art? Leila didn''t use her sword, but slammed a kick into the boy''s back. ''''Gahhhh!'''' The boy was blown away and crashed to the ground. He fainted or stopped moving. ''''Na.........'''' The onlookers are stunned and quiet. ''''Ugh, no way...?'''' Mr. Kasem lost...? Is that guy really an Unemployed...? Then a voice cut through the silence. ''What are you guys doing there!Private dueling in the academy should be forbidden! When I turned around, it was Alisa who was there. I also saw a teacher coming towards us. ''Oh shit, run!'' Oh, we''re just visitors. The onlookers leave in a hurry. I wanted to get away from them too, but unfortunately, the person at the center of this case is my twin sister. And she is disguised as me. In other words, everyone thinks I''m the culprit. What are you really doing for me? Mr. Leila, what''s going on? ''Sis Ceres.........? Oh, no! If this continues, Celestia-san will think I''m a violent person who''s going to duel with her........! Since I entered the academy, I, the ARC''s person, hadn''t seen Celestia-san even once. It would be bad if this is how we meet again since that time when we first met four years ago. ''''Oh, sis!Well... I tried to distract Celestia-san in a hurry, but then Arisa-san interrupted me. ''''Your Highness, it''s a duel. It seems that the students of the martial arts department were having a private duel here.'''' Duel... Celestia-san''s gaze is turned towards the fallen boy. Wait, Alisa-san! And to Leila, who was right beside him, disguised as me-- ..........Oh, you are........ Celestia-san''s eyes widened. ''''No way, that time........'''' What? You remember me? Forgetting the situation for a moment, I am thrown into a daze by her mutterings. We only met briefly at that time four years ago. I thought I could remember being rescued by someone, but I was sure I wouldn''t remember her face. But this reaction. Four years have passed and you can''t recognize me right away. No, actually, it''s not me, it''s Leila over there....... Complicated.......... "Your Highness...? While Alisa-san is wondering, Celestia-san is just staring straight at me (Leila), her body trembling slightly. Then Leila turned toward us. ''''Oh, Celestial--it wasn''t.'''' Hey! Now, you almost made a mistake! .........Huh, what''s going on.......kitten......? I won''t tell!I would never say that! Stop impressing Mr. Celestia with your weird characters! ''Ah, um.......... But when I say Celestia-san, who was stared at by Leila, her usual dignified appearance was nowhere to be found, and for some reason she blushed and choked on her words repeatedly, as if she was impatient. See, you''re having trouble reacting! I''m pretty sure they already think I''m weird! Excuse me! So, Your Highness? Finally, he turned on his heel and ran off. I dropped my shoulders in disappointment. Then I was tapped on the shoulder. I turned around to see Rikka. "Don''t do it, Shut up! Rikka let out a sigh with a dumbfounded look on her face. ''''Well I don''t think there''s any need to grieve so much, do you?'''' It was that night. I had been called by Leila again. ''Ark!Another turn!Wait, what are you doing?WTF?Why are you suddenly coming at me with a joint technique? Ask your own heart! Today, today, as expected, I won''t let it go for free. I pounced on Leila, who was smiling her usual innocent smile, and I finessed her with a joint. ''''Ouch, ouch!'''' Are you sorry? Ouch! Are you sorry? I''m sorry! I let her go first. "Woo, what the hell are you doing? You''re not sorry, are you? I''m sorry. Perhaps my anger finally got through to her, and Leila became unusually honest. ''''Why did you do that duel on your own?I told you before to stop fighting, didn''t I? That''s why I''m calling it a duel! I''m with you! What. Because that guy made fun of Ark in the past. Leila puffs out her cheeks in a puffy way. I don''t know what on earth was said, but since it''s not about me, I''d like you to be a little more patient. .........and as a result, I am the one who suffers the disadvantage. ''Oh, and, as punishment for the duel, they said you''re going to help the teacher for a month. Let''s do it and then switch! It''s a pain in the ass. Well, I''m afraid to let Leila have me around any longer. I''ll just have to put up with being a teacher''s helper. I''m more worried about Celestia-san. We talked for a while after that, but she was distracted for a long time. I wonder if she was that shocked by the fact that I was in a duel.... Actually, it wasn''t me, it was Leila. I wish I could say that, but if I did, it would make it known that I had been replaced, which would make it worse. ''''Huh........'''' What do you think? ''Whose fault is it that you think it''s...'' 211-Episode 35: He helped me at that time Leila had returned to the magic department. ''Celes sister?What''s going on? What, man, it''s nothing? Celestia has been acting strangely since this morning. She is somewhat absent-minded, even though she is usually doing her best to clean the house. When Leila calls out to her, she begins to get flustered and for some reason refuses to make eye contact. ''''What?Sis? "~~~~ When I turn around and look into her face, she turns bright red and looks away. As expected, Celestia thought it was rude, but Celestia shook her head, "No, no, I''m not........ Oh, um....can I ask you one question...? What? ''''Well...Ki, the boy from the martial arts department who was in the duel yesterday...are you acquainted with Leila?'''' You mean Ark? Oh, Mr. Ark?........You say that, don''t you? Celestia recites in a whisper, "Ark-san........" while asking back that. ''''Yes!Leila and I are twins! Huh, twins....no wonder they''re so similar.... Celestia goes further to the core of the matter. ''''Can I ask you one more thing?'''' Okay! About four years ago, when the Demon King''s army was threatening humanity, had you ever been to this city? ''Yes?I was with my mom and dad and also Ark! Hearing those words, Celestia nodded deeply. ''''Well, there''s no doubt about it........then, he saved me at that time.......'''' When I returned to the martial arts department, I decided to talk to Ranta to find out what happened during this replacement period. ''What, you''re back already?'' What does that mean...? For some reason, Ranta is disappointed when he finds out I''m back. ''You didn''t do anything weird with Leila, did you?'' I''m not!....just in time. Just in time. I mean, what did Leila''s guy do to take a bath and change clothes? ''It!I''ve always wondered that, too!I''ve been looking for a chance to do this for years!The next thing I know, you''re gone. .... I''m just kidding!I''m just kidding! Well, we can hide somewhere to change clothes, and the baths are the worst, and we can make do with magic. Off topic, but have you got anything else up your sleeve besides dueling? Hmm, I can''t think of anything. Good. Oh, she asked me to join some independent study group. "Independent seminar?What kind? Apparently that''s the super high level one where all the students in S class are participating. And then some angry third-years came barging in, wondering why freshman E class was being recruited. Apparently, that led to that duel. "An independent seminar.... I don''t even know how he responded. Um, what did I say, that girl''s senior - I think it was the third year - yes, Miss Merena. Miss Melena? Where have I heard that before........ Ah, yes. She''s the one who was in charge of my entrance exam. "I heard the other participants are against it, but Melena insists on it. Why don''t you go see her if you''re interested? Yeah, I''ll do that. ...but first I have to help the teacher. I had come to the training grounds. As punishment for the duel the other day, I was to help the teacher. But why the training ground? Oh, there you are. Waiting there was a muscular, ara-four instructor. Because of his appearance, he has been nicknamed a gorilla by the students. As I recall, he was the head of the freshman year. I never took a class, but I knew he existed. I don''t remember his name. ''Hello, Ark-kun,'' Miss Melena? For some reason, it wasn''t just the teachers in the classroom, but Melena was there as well. ''She''s Melena from the third year S class. I heard she was in charge of you during the entrance exam. Yes, I do. Dr. Gorilla confirmed it and I nodded. ''She''s actually suing me. That it''s not right for her to enroll you in E class. ''That''s right!Based on the results of Ark-kun''s entrance exam, it can''t be anything but an S class! But I''m not a professional. Normally, just getting in is not an option. "Unemployed" must be some kind of mistake!I saw it with my own eyes!He could easily take down a goblin lord........! It''s true that I''m "unemployed"........ Even yesterday, in a duel, I beat an S-class fourth year in a duel........ Wait, wait, wait. Wait, wait, wait. I heard about yesterday''s duel myself. It sounds far-fetched, but even if it were true, I would not give credit for a private, forbidden duel. .... Melena''s lips quirked up in frustration. "That''s why I''m going to find out for myself once again. ''Huh?Aren''t you supposed to be helping the teacher...? That''s just a name. Now we will see how good you are. If I agree with you, you can move up to a higher class. Good. I thought I was going to have to deal with a lot of cumbersome paperwork, but this looks like it''ll be easy. Good luck, Ark-kun!I''m going to show you what you can do! Uh-huh. With Merena-san cheering me on, I face Gorilla-sensei a few meters away from him. Apparently, they''re going to assess my strength through a mock battle. But how strong is it? I''m even a martial arts teacher, and I''m probably strong in my own right... But my mom says, "Basically, you should assume that the adults in the world are much weaker than you. There''s no need to go easy on them. Well, I''m saying this, and it''s okay to put some effort into it, right? 212-Episode 36: I love your sister Foolishly I have never thought that I would be so easily defeated. As it turns out, Dr. Gorilla, it was surprisingly weak. I don''t think there''s much to look at. No, but he''s a hypothetical instructor. He was probably cutting corners and letting his guard down because he was dealing with a student. I''ll ask him just in case. ''''Um........teacher, are you serious about that one?'''' Oh no, that can''t be it! ''Good. You''re right, of course. I''m not even a tenth of what I really do. Tenth of a percent? Dr. Gorilla turned over. ''Huh?How long was the doctor? Yeah, that''s right, of course, I''m only a tenth... I wonder why my voice was getting quieter and quieter. Sir.... And for some reason, Melena-san is looking at the teacher with a scowl. ''''Gosh, gosh, gosh!Anyway!I know exactly what you can do!All right!I can recommend a move to S class!It should be official after the next staff meeting! Gorilla-sensei had promised me that. ''You did it, Ark-kun! ''Yes. But is this the right thing to do?After all, it seems the doctor was only ten percent serious about it... No, no, no!For that matter, have you thought about the independent seminar? Oh, yes. I nodded vigorously, but of course I didn''t think about it at all. It was Leila who heard about it in the first place. ''''It looks like we''re going to be moving to S-class, and with the dueling thing going on, maybe this won''t be enough for people to object to your participation. Is that so? ''Yes. And more importantly, once you''ve seen the actual power, no one should be able to complain about it anymore. What exactly do they do? I''m curious, but I think it''s probably already been explained to you, and it might seem strange to ask again here. Well, it would be similar to the one that Celestia-san is hosting. ''''I understand. Then I''ll try to participate in it once. ''Thank God!It''s going to be so much fun when you join us!So what do you say to me earlier today after school?I have a brief meeting. ''Yes. Then I''ll go. Thank you! ....and after school. "Oh, Ark-kun. You came properly. Well, he said he was going. Yeah, yeah, I like a girl who can keep her word. When I went to the classroom where we were to meet, Melena greeted me with a happy smile. ''''Merena, is that first year the Ark-kun you were guessing?'''' Yes, Endy, The one called Endy was a slender, medieval-looking boy. Apparently, he was also a participant in this seminar. ''I''ll introduce you to him. This is Endy. He''s a third year student like me. Nice to meet you, Mr. Ark. Yes, nice to meet you. Yet another boy - with a sharp look in his eyes - approached and sniffed arrogantly. ''Ha, he''s still a kid. Did this guy really defeat Kasem? It''s not just Khazem. I took down a gorilla. What?That gorilla? ''Yes!I''m sure they''ll move you up to S class soon! Melena says triumphantly. ''Oh, this is Vanna. He''s a third year.'' It''s a pleasure to meet you, Mr. Vanna. .... Mr. Vanna just looked at me as if he was silently priced out. There were several other students in the classroom. I heard that there were no first-year participants yet, so they were probably second-year students. Most of them have been looking at me with the same skepticism as Vanna. ''Everyone seems to be coming together,'' A few students, led by a fresh-looking young man, entered the classroom. ''''Diaz-senpai!'''' ""Good job!" Then the students in the classroom stood up in unison and greeted each other. Perhaps these were the fourth year students. The young man called Diaz was a beautiful blond-haired, blue-eyed, tall man. And yet, he seemed mild. From what Melena-san told me beforehand, it seems that Diaz-san is the son of a duke family. I heard that she also has the right to succeed to the throne. ''''Good work. .........Hmm, there''s an unfamiliar face. Could it be that you are the Ark-kun that Merena was talking about? ''Oh, yes, yes,'' ''I''m Diaz, the fourth year student who is organizing this independent seminar. Melena has told me about you. I heard you beat Mr. Gora? Gola? Oh, you mean Dr. Gorilla. His real name is almost the same... Just in case......... ''That''s great. There are only a few people in fourth grade who can deal properly with their teachers. No, Mr. Diaz, you don''t believe that? It was Mr. Vanna who interrupted me earlier. ''It wouldn''t hurt to lie, would it?'' I don''t know. Maybe Melena''s guy has been pushing that guy for so long that he can''t back out now, and he''s just blown a big conspiracy theory. I wouldn''t do that. I don''t know. They glare at each other. It''s awkward for them to be fighting about me, but perhaps by the looks of it, they don''t usually get along very well. ''''Well, you''ll find out what''s really going on soon enough. Ark-kun, do you by any chance have a brother or sister in the magic department? Yes. I have a twin sister. I knew it. Mr. Diaz nodded widely. The others looked like they were huffing and puffing. ''Oh, now that you mention it, we look a lot alike. ''What?Maybe that''s why I gave a representative address at the Commencement ceremony... The first-year student of the "Magical Sword Princess"? ''Seriously?You had twins in the same grade! Apparently, there were rumors about Leila among the senior students in the martial arts department. ''''The next live-fire training, it''s going to be quite fun. ''Diaz, senior?What do you mean? As a matter of fact, we''re going to have a joint training session with an independent seminar of the magic department that Her Highness is hosting. 213-Episode 37: Even though its my first meeting Apparently, they''re going to hold a joint training session with Celestia-san''s seminar. ''''Joint training exercises?'''' Sounds interesting! "I will see Her Highness... Many of them had never heard of it before, and the classroom sprang up. ''''I heard that the rumored first year students are also participating in the Queen''s Highness''s voluntary seminar. In other words, if Ark-kun also participates, it means that all of his siblings will be there. Joint training........ Naturally, Celestia-san will be participating in it. We''ve met again in a terrible way, and I don''t know what kind of face I should see her with. I don''t even know what she thinks of me. I was much more concerned about Celestia-san than I was about Leila. In the blink of an eye, the day of joint training arrived. It''s a day off from the academy''s classes because of the expedition outside the city. It''s a very good idea to have a good idea of what you''re looking for. There are a total of twelve participants in the martial arts department: five fourth-year students, three third-year students, three second-year students, and one first-year student. Probably about the same number of students as in the magic department. In the meantime, one faculty member will accompany you to each seminar. Are you guys ready? Diaz-san once again explained the outline of the training. ''''This training will involve exploring the druidic forest that extends to the western part of the royal capital. The Druidic Forest is that forest that I went to nearby the other day in my magic department seminar. It is said that the name was given because the nature-worshipping shamans once lived there. I''ve been told that currently no one lives there and only demons live there. As I said the other day, the theme is cooperation with the magic squad. The important thing is how to fight while complementing each other. It is important to refrain from acting on your own and watch the situation around you even more carefully than usual. Everyone listened to Diaz-san''s words with a mysterious look on their faces. ''''But on top of that, let''s definitely show Your Highness the proficiency of our martial arts department! ""Yes!" The carriage stopped not far from the druid forest. By the way, I burned incense to avoid demons, so I didn''t encounter a single demon. After waiting for a while, the magic department''s carriage arrived. Some familiar people get down from inside. Of course, I only knew most of them one way or the other, as they had joined in place of Leila. ''''It''s Your Highness........'''' You''re beautiful as ever... I''m jealous of those magicians... While the participants in the martial arts department were fawning over it, Diaz-san stepped forward and bowed deeply. ''''Best regards for today, Your Highness. ''''This is not the Royal Palace, and don''t be so awed, Diaz. Let''s do our best to be students of the same academy today, Thank you. Mr. Diaz raises his head. ''Wow, it''s Ark~! What? Suddenly, I was shocked from the side. Leila hugged me. ''Stop, you''re too hot.'' What? Why? It''s been a long time since we''ve had an adventure together like this, but I''m so excited. Everyone is giving me a warm look and I really wish they hadn''t. And that''s where I roll my eyes. Because there was a petite girl with bobbed hair. ''It''s nice to meet you. Leila''s told me about you? It was Rikka who smiled at me in a deliberate way. ''Hey, why are you here?'' Now that I get to be a part of it. .... ''Why does he look so disgusted?We haven''t even met. That''s right, me and Rikka have never met. ............It has to be our first meeting. ''Huh, so that''s Leila''s twin brother? You sure do look like him. Your hair is the exact same color. The magicians say, comparing me and Leila to each other. ''Maybe we wouldn''t know if we were swapped? Hey, hey, Ricka! Don''t say anything........ When I glare at her, Rikka giggles wickedly with a chuckle. I feel very uneasy with this guy around........ As expected, once we entered the forest, Rikka didn''t call out to me anymore. She is walking diligently at her post. ''''Hey, Ark, how are you doing, Dad~? Leila, on the other hand, had been talking to me since a while ago. It''s partly because the deployment was so close, but I''m used to exploring a forest of this magnitude in the first place, so I''m not nervous. ''''Leila-san, you need to concentrate a little more.'''' ''What?I do? When Alisa-san warned her, Leila''s lips twitched. In fact, even while conversing, she can naturally explore the signs of the surrounding area. At any rate, it''s so ingrained in my body that it''s possible even in my sleep. ''''Oh, there''s a demon approaching from over there. Leila pointed in the northwest direction. Of course I''ve noticed it too. The strength of this presence, it''s not a very strong demon. No one around me seems to be able to sense the presence of the demon yet, "Really? How do you know? I have a look on my face. ''Leila-san, do you have any idea how strong the demon is?'' ''I''m not that strong!Maybe. Hey, Ark? Uh-huh. ''''~~~~'''' Celestia-san, who should have been looking at me, for some reason immediately turned her head away as soon as her eyes met mine. Yah, I guess I''ve been hated because of the duel we had the other day...? I glare at Leila. ''Huh?Why are you angry? Ask your heart. "...?All I can hear is a heartbeat, okay? 214-Episode 38: Do you both know each other? We were making good progress through the forest. Since the purpose of this time is to cooperate with the magic and martial arts departments, we had divided each of them into two groups, splitting them in half. While one group is fighting the demons, the other group is waiting and alerting the surroundings. Of course, in case of an emergency, the reserve group would take care of it. The martial arts department acts as the vanguard and draws the demons to them, while the magic department at the rear sees an opening and attacks them with magic. As expected of the S class students, or should I say the S class students, even though this was their first attempt, they worked together without any problems to defeat the demons they encountered. Eventually, the trees broke off and we came to a slightly open area. ''''Then let''s take a short break here.'''' Celestia-san skipped those instructions. I immediately burned incense to avoid the demons and took measures to prevent them from approaching us. ''''You''re coordinating better than I thought you would, Your Highness. ''Diaz, I told you earlier, didn''t I?It makes me kind of sad when you act like a stranger to me. All right, Celes. Thank you. Well I think you''re the one who could be a little more shattered, don''t you think? Wow, in my case, this is more natural for me... I could hear Celestia-san and Diaz-san talking in some kind of friendly manner. When you''re the child of a princess and a duke family, you must have known each other since you were a child. I couldn''t help but listen in. ''''By the way, Leila-san, was it?We''ve got some amazing freshmen in the magic department. ''Yes, sir. She''s clearly exceptional. Much stronger than I am at the moment. That much? I''m sure of it. ''''I see........ She''s a [Magical Sword Princess].......If she had joined the martial arts department......then the fish we missed would have been bigger. But in the martial arts department... Have you been to the martial arts department? No, no, it''s nothing. ...? Apparently, Leila was being talked about. ''Hey, Ark!Do you hear me? What? Moo, I''ve been calling you for hours! I''m sorry. I''m sorry. I''m sure he was admiring the princess. Rikka! Rikka goes off on a tangent again. ''I was looking at it, but I wasn''t fawning over it. ''Or are you jealous of Lady Diaz?'' No! Yes! And what I thought there, Leila suddenly tugged on my hand. ''What are you doing?'' I don''t care! And so, I was forced to be taken to Celestia and the others. ''''Celestia, big sister!Let me introduce you!It''s Leila and her twin, Ark! Wait, Leila! It wasn''t like I was being extra cautious or anything because of Leila, but simply wanted to introduce me to Celestia-san. But please, please, please call the air a little more. Obviously, I was being avoided by Celestia-san right now. And it was because of Leila. ''''Leila''s twin brother, Ark.............yea, Leila has always been a big help to me. It can''t be helped, so I say a bland greeting. "No, no, I''m the one who''s indebted to Leila-san for her help... Celestia-san''s face turned down slightly and she replied as if she were muttering. ''''........'''' Awkward......... "?Do you two know each other? Mr. Diaz tilted his head curiously, and that was when it happened. ''''Huh!'''' Me and Leila turned our gazes in the same direction almost simultaneously. It''s because we sensed the approach of a demon. But I soon realized that it wasn''t just one of them. A number of demons are approaching, surrounding us at 360 degrees, as if they were surrounding us. ''''This presence........ It feels weird! Hey, what''s going on?Could it be a demon? Yes. And there are quite a few of them. ''''But the demon repellent incense should still be in effect...'''' Perhaps it''s the kind of demon that doesn''t work. Everyone who had been resting hurriedly picked up their weapons and prepared themselves for battle. ''''Ark, how many of them are there?'''' Maybe the hundred is crap. ""What? Hundred!" Even as we do this, the signs are increasing. The closest demon will soon be appearing in this place where we are. ''''This presence ... there''s no doubt about it. The demon is undead! "''Undead!''? It reminds me of the undead high orc I encountered the other day. ''''Oaaaaaah!'''' The first to appear was a giant monkey demon. A little later, a variety of demons appeared one after another. Although it''s hard to distinguish them just from their appearance, they are all undead. ''''Well, unleash your magic! The students of the magic department unleashed long-range attack magic all at once. But even if they are hit directly, the demons are not intimidated at all. They are undead, so they don''t feel any pain or fear. ''''Ku, I''m going to hold them off! ""Oh, oh!" At Diaz-san''s command, the students of the martial arts department stepped forward. Since the demons are coming from all directions, they can''t help but deal with a small number of people, and in some cases, one demon by themselves. ''''Gruaaaah!'''' ''Hey, the attack isn''t working! ''Because you''re undead!If you want to stop him moving, you have to go for his legs! Yes! Diaz-san''s instructions were accurate. Even for the undead, if a leg was injured, their mobility would decrease at once. The magician''s squad poured concentrated fire on the place where they slowed down their movements. But there are too many of them. The momentum of the demons forced the martial arts unit to retreat unceremoniously. If the vanguard collapsed at this rate, they would all be crushed together. Of course I won''t let that happen. ''''Leila!'''' ''Yes!Holy Rain! A torrential downpour of purification fell on the undead horde. 215-Episode 39: You dont have to be so tragic Holy Rain! ""Oaaaaaahhhh!" The white magic method that Layla invoked rained down a widespread rain of purification. The demons who were exposed to it began to suffer all at once. With the range of effects extended, it was indeed not enough to stop their movements. Even so, now that the momentum had slowed down, everyone turned to the offensive at once, as if this was their chance. ''''Divine Sky Slash!'''' Of course I join them. ''Hey!Don''t just strike out at that point! I got yelled at by Mr. Vanna, a third year in the martial arts department. No, I didn''t strike out. The next moment, an invisible slash cut all the demons in front of me in two. ''''........What?'''' Mr. Vanna opened his mouth. ''Oh, what the hell did you just do...? ''What?It was just a normal cut. How is this normal? I don''t have time to argue with Vanna-san right now. A large number of demons are still coming in from deep in the forest, and in some places they are struggling. I move quickly and join them. ''''Da, no........! I can''t hold on... "Sky Slayer. "What? "Huh, huh, huh... no more... Patience!Or else you''ll die! "Sky Slayer. ? Gah! Are you all right?d*mn...... "Sky Slayer. Wha... Okay, this will bring back some of the places that were inferior for now. ''''Now, that freshman did that...?'''' ''Yes!What do you think?This is Mr. Ark!I wasn''t wrong, was I! For some reason, Melena-san is happy as if it were her own, but the demons haven''t broken up yet. However, the momentum is slowing down considerably. ''''One more step! Diaz-san scolded them forcefully, and everyone responded by vigorously defeating the demons. Eventually, the wave of demons somehow began to break off. ''''What in the world is going on...? Don''t tell me the Demon King''s Army is back...? Everyone can''t hide their frustration and exhaustion. Many of them are probably remembering the horrors of four years ago. ''Leila, how are you doing?'' There''s no sign of them on this side! West is out. I don''t see any in the east, so all we need is the north. We have been searching for the source of this situation from a while ago in parallel with the battle. The possibility of this many undead occurring spontaneously is infinitesimally small, and we believe that there must be a necromancer causing this somewhere, so we are working together to detect the flow of magic power. South is the direction we came from, and it takes us out of the forest. Now that we''ve already crushed the east and west, the only possibility is the north. ''Huh!There''s something coming from the north! As I was exploring the north, I found the most powerful presence I''ve ever seen. It''s coming towards us at a considerable speed. Mekimekimekimekimek! Thump, thump, thump, thump! Soon, what I heard was a roaring sound of trees cleaving down and footprints that shook the earth. ''Oh, hey, what''s that sound? What more do you have in mind? And finally, its true identity is revealed. "''N......... Looking up at the sky above, everyone was exclaiming. What was there was a huge monster, even taller than the surrounding trees. Its shape was humanoid. But its size is not the same. It''s probably comparable to a five- or six-story building. "Kye, the giant........? Well, the Cyclops...? ''The Cyclops wouldn''t be that big! So you don''t think it''s...Atlas! Atlas, a higher-ranking Cyclops species, was approaching us, lightly cleaving the trees as if he were ripping through a weed. To everyone who were astonished, Leila confronted them with an even harsher fact. ''''It''s not just Atlas!He''s probably undead too. What did you say? Oh, it''s over... There''s no way we can defeat a monster like that... You''re undead... Several people sit there as if they have lost their strength heaving. Even Diaz-san, who had been leading the surroundings up until now, is cowering on the spot in a daze. In such a situation, it is Celestia-san who raised her voice. ''''Well, it''s not over yet!I will fight until the end!During the battle four years ago, in spite of the hopelessness of the situation, our nation''s warriors never despaired and fought to the very end.......! But when she looked closely, her legs were shaking. I''m sure she herself is terrified and wants to run away at any moment. Still, she is trying her best to inspire her companions with the pride of being a princess. ''''Your Highness........'''' Yeah, well to give up on a fight before it''s even begun... I''m the guy that did it! I guess Celestia-san''s thoughts were getting through to us, and everyone regained their fighting spirit. Moreover, Celestia-san looked at us. Leila!And ... and Mr. Ark!You''re the ones we''re counting on!Please, please, can you help me? He begs so desperately. It''s a request from Celestia of all people. Of course I intend to live up to her expectations. But.......... I looked at Leila and I looked at each other. Do you think they are such a powerful enemy?It''s tiny compared to Befi, okay? ''Yeah, well, it''s undead, so it''s a bit of a pain in the ass, right?'' It''s kind of like, let''s fight to the death, but I don''t think you have to be so grim, do you? 216-Episode 40: I swore to show Stigma in the snow Leila, can you cover me with magic? Yeah, okay! "God''s Foot Street. I flew right in front of Atlas''s face at a speed that made me ignore the distance. "Unlike "Shrinkage", its upwardly compatible "God''s Foot Path" is capable of not only flat but also three-dimensional instantaneous movement. I''m not going to be able to get my hands on any of them. ''''What!Gone! Look!There! What?When did that happen?! While I could hear startled voices from the ground, I slammed a slash into Atlas'' neck. Zubang! There was a violent sound, but at most, Atlas''s thick, hard neck only had a one-meter wound on it. As expected of this size, it seems to have a high level of defense. In addition, since it''s undead, it doesn''t seem to be feeling any pain. It immediately waves its arms and tries to knock me off. BOOM! ""~~~?" "[W]ugh! I kicked in the air as quickly as I could to avoid it, but the storm that rolled up hit everyone on the ground and blew some people away. ''This guy,'' I gave Atlas a thrust to his eyeballs. ''Aaaaah!'' He roared out a yell, as if he was impatient as expected after his vision was taken away. ''''Meteor strike!'''' Then a huge mass fell from the sky. Leila activated the highest peak of yellow magic, Meteor Strike. Dogo-On! With a tremendous impact sound, the meteorite hit Atlas in the face. With a momentum that felt as if its head was going to be plunged into the ground, the huge body was turned over. ''''Ugh........'''' The head was heavily dented, and the meteorite was completely stuck in it. Egregious. Normally, his face would have exploded, but the fact that it was just that means he was such a phenomenal stone head. Still, it''s an undead that transcends death. Atlas was already trying to wake up his body. "''Divine Sky Slayer'' x 10. Permafrost! To prevent this from happening, I sent a rain of "kamikaze slashes" from above. Meanwhile, Leila uses the frigid air to freeze Atlas in place, blocking his movements. Eventually, she succeeded in completely trapping Atlas in the ice. Alright, now all we need to do is purify this guy. As expected with something this big, it will take some time. Leila, I''ll leave the cleansing to you. I found the culprit, I''ll take care of that one. Riley! But I ask Leila to do that and I leave. There are still some other monsters left besides Atlas, but I''m sure everyone else can handle that one. I sprint through the trees. The reason I didn''t purge Atlas right away and blocked his movements first was to trace the magic power that was being supplied. The distance of about a kilometer is covered in a matter of seconds, and I finally find the guy. What the hell is going on here?Are you saying that all those undead people were killed by a mere mortal?And even Atlas is becoming less and less responsive...? Accompanied by several undead monsters, the one who was summoning them was a man who seemed to be of the demonic race. It seems that this guy is the source of the problem, a necromancer. ''''I''m sorry to be upset, but it would be nice if you noticed by now. What? When I called out to him, he finally turned to me. ''''Wha.........................when? Well, you''re a demon, right?What are you doing in these woods? How did you find me? I need you to answer a question for me. The demon tribe retreats backwards to keep their distance from me. ''Ki, of course!I''m going to take revenge on you humans! Revenge? ''Yes!Four years ago, my master attacked the city, but was defeated by the humans! Do you think Master is that old man? He was human, but he was a necromancer who was a cadre of the Demon King''s army. ''''But I just couldn''t get my head around it!I just can''t see how that master could be defeated by a human! I defeated him......... ''''Therefore, I swore on behalf of my master that I would definitely put that stigma to rest!That''s why I''ve been preparing carefully for the past four years! I see. So that was that large number of demons and Atlas. The High Orcs that I encountered outside the forest the other day must have left the control of the sorcerer for some reason and gone out of the forest. ''''However, I was going to try and eliminate those humans who appeared in this forest and make them into pawns for my long-cherished wish... What is the meaning of this! Apparently, the idea didn''t work out so well for you. Failure?Impossible!There''s no way those many undead monsters could be defeated by that many people! ''No, I think you''d better accept reality. Shut up!You people, get rid of that human child! "''Oaaaaaahhhh!'' The undead monsters, who had been quiet until then, attacked all at once. ''''Holy Cross.'''' ""Aaaaaaah!" He showered the light of purification and slashed into the frightened place. ''''Bah, that''s ridiculous...?'''' The necromancer''s demon tribe was stunned as they were easily annihilated by their subordinates. Since there are so many gaps, he closes the gap and kesa-slashes in time. ''''Gyaaaaaaah! You don''t have any other disciples anymore, do you...? 217-Episode 41: Dad is a Human When I returned after defeating the demons, all the demons, including Atlas, had already been taken care of. ''''Ark, welcome back!'''' I''m home, Leila. How did it go? ''There were demons. I think we''ve defeated them, so I think we''re good to go. When I told him that, a breath of relief escaped from everywhere. ''That''s what I''m talking about,'' What do you think, guys?I knew I wasn''t crazy, right? Rikka is impressed, and for some reason, Melena is smug. ''Oh, hey,'' Mr. Vanna approached me with a scary look on his face. I was a little defensive, wondering if she was going to complain about something else. Wow, I''m sorry I doubted you. You really are a tough guy. Apparently, he recognized me. "I was surprised too. I thought I was doomed when that Atlas showed up, but I didn''t expect him to beat me alone. Diaz-san cowered her shoulders. ''Leila-san aside, why so much strength...?Are you not unemployed?Or is that some kind of mistake? The one who asked me that was Alisa. ''''No, you''re really unemployed? "......... Huh? I''m getting some suspicion from everyone...? I''ll tell you the truth. Well, my dad trained me pretty hard. ''Yes!He''s so strong!Even if it took two of us, Leila and Ark, we couldn''t stand a chance! That person really is a human...? Everyone shuddered. ''My dad is human!'' Leila puffs out her cheeks and gets angry. She''s a father figure, so she gets in a bad mood when people say bad things about her dad. After resting for a while, we quickly decide to leave the forest. As expected, no one wanted to continue the training under these circumstances. A few days had passed since the joint training. In the boys'' dormitory room, Ranta said. ''''Even so, it''s still scary. The undead, no matter how much you attack them, they don''t work, do they? I''m not saying it won''t work, okay?You won''t feel any pain, but if you destroy your leg, you won''t be able to move, and if you crush your head, you''ll generally be stuck. "Up. As if imagining it, Ranta frowned in disgust. Not only Ranta, but that one incident was already known throughout the academy. This is because just yesterday, the faculty told all the students about it. It had already become a rumor, and as expected, they couldn''t afford to keep it hushed up. Although there were many students who were relieved to hear that the main culprit, the demon tribe, had been defeated, there were still many who felt uneasy, and a gloomy atmosphere had enveloped the academy. That''s how much the events of four years ago must have cast a shadow over them. ''''Come to think of it, you fought too, didn''t you? Yes. It''s a real disaster. You''re in your first seminar and all of a sudden, right? Well. But I think it was a good experience. He''s got balls. That''s what it takes to jump up from E-Class to S-Class in one fell swoop. Ranta was right, I had been moved to S class without incident. I heard that Gorilla-sensei had gotten approval from the staff meeting. ''You''ve completely overtaken me. If Lanta can hang on, he''ll get there. You don''t need to be a genius to get an S-rank in the world. I don''t think so. If you want to talk about talent, I''m just "unemployed". Oh, yeah. Ranta clapped his hands as if he remembered something. ''I''ve got another letter for you, eh? A letter? It''s probably Leila again. I don''t want to be me anymore, I don''t want to be replaced. It''s hard to live in a girl''s dormitory disguised as Layla, but more than that, I don''t know what I''m going to get up to when Layla has me in charge. I let out a sigh and called out the contents of the letter. ''''I apologize for the suddenness of your letter. The next holiday, if you don''t mind, can we meet up?I want to talk to ARC about something. Celestia I mean, that''s Celestia! Hmm?What''s going on?Maybe it''s a love letter?Early on, the S-class effect~. I''m so jealous. No, no! Then why are you so upset? I didn''t! I take a deep breath and calm myself down. What in the world does he want, calling me all the way out here with a letter? If this were a normal girl, I might expect a little bit of that. But she''s dealing with the princess of this country. It''s not going to be a sweet turn of events. When I calmed down and thought about it, I suddenly felt uneasy. Don''t tell me they didn''t find out that they were swapped or something! If so, it''s the end of the roll. It''s the end of my spirit, not just my school life. "What am I going to do... Oh, hey, you okay?You''ve suddenly gone pale, but... I''m not okay. Ark! It''s all Leila''s fault........ The next day, I had come to the meeting place. It''s a small garden behind the school building, almost unpopular even within the academy. I sat on a bench set up there and waited for Celestia-san. There is still thirty minutes until the appointed time. I was too nervous to arrive too early. I meditate and unify my mind. I''ll review again the excuses I''ve already thought of many times. ''''Ark, Mr........'''' ...Your Highness Celestia? Wait, are you early? Celestia arrived much earlier than I had expected, and I was greatly flustered. 218-Episode 42 I remember Oh, here you go. Yeah, I''m not waiting for you at all!I mean, I just came early.... No, no. I''m insanely nervous. This is probably the first time my heart has been this fast, including in my past life. I was planning to arrive early too, but........ Huh? Is Miss Celestia nervous too? Then we sat side by side on a bench. There was a space between us, about two people. "......... We were silent for a while. It may have only lasted a few dozen seconds, but it felt like an eternity to me. What in the world is the story...? I don''t want to be a waste of time, but I''m still scared! I can''t wait to hear it, and the thought of not wanting to hear it is fighting inside me. Then finally, Celestia-san finally opened her mouth timidly. ''''Today, I thought I''d........thank you for that........'''' Oh, thank you...? The moment I heard those words, I was released from my nervousness. Yes! They didn''t find out that he and Leila had been swapped out! What can I do about...? ''Yes, no, it''s nothing. Please continue. Relief seemed to show on my face, and Celestia wondered why I was wondering. Somehow I managed to fool her. ''''Well, could it be that it was during the joint training?But that wasn''t anything to be thanked for.... I just did what I had to do as a participant. But, thanks to Ark-san and Leila-san, we were all able to come back safely while dealing with so many demons. That''s why I''m really grateful to them. Yes, sir. I can''t believe you came all the way out here to thank me for that. He''s such a disciplined person. But that''s not the only thing I want to thank you for. What? Do you remember...?Four years ago.... Four years ago... Celestia-san said in a tone that sounded as if she was going to tell you an important secret. ''''Actually, I was once saved by Ark-san!But, of course, I don''t think you remember... Oh, no, no, I remember that, remember? Oh, I remember! I remember it well, of course. I was searching for a necromancer who could control the undead, and I met Celestia in the royal palace. Even though this was not the case, I couldn''t help but fall in love with her. Naturally, I couldn''t say that because I''d be embarrassed to do so. ''''Let''s see, you were attacked by a chimera and an enemy ringleader, and it was pretty dangerous, wasn''t it? Oh, yes!Just when it seemed like it was all over, a boy with red hair appeared and knocked me down in a flash........!Ark-san, it was you after all, wasn''t it? The space that should have been for two people earlier had become almost zero before I knew it. It was because Celestia-san, who looked excited, was approaching at once. ''''But at that time, you were gone before I could thank you... so I''ve always wanted to express my gratitude to you! So Celestia-san stood up from the bench and bowed to me as much as she could. ''''Thank you so much! Wha... I got up in a hurry too. "Oh, please raise your head! I don''t want you to bow to me!I''m a princess........! ......... Celestia-san raised her head, but for some reason she looked shocked. Did I say something wrong...? Ceres. What? You can call me Celestial. Well, that''s a good point. I''m fine!Because that''s what Leila calls it, too! No, you didn''t call me! You''re Ceres'' big sister and this is even more embarrassing for a man to call you. You''re a lifesaver to me. So that''s why I don''t want you to call me princess, which is an unattractive term to use. The last words were spoken like a sulking child. Ka, cute..... ''''Wow, I understand, Mr. Celes. Ceres is fine. Se?or Celes. ''''Ugh, there''s no way around it...'''' In addition to being a princess, she is also an older woman. In my previous life, I was a Japanese with a strong sense of seniority, so this is a non-negotiable point for me. ........Well, if you put that former life together, I''m probably older than you. Then Celes-san and I sat down on the bench again, side by side. Without a care in the world, Celes-san is getting closer to me than before. ''''Even so, the two of you keep surprising me. ........If you ask me, you''re only twelve years old, right?Four years ago, you weren''t even blessed yet, were you? ''Well..... But I''ve been trained by my father since I was very young. Both of us were a little less tense, and we were able to afford to have a normal conversation. "........I don''t think the ''profession'' or skill barrier can be helped by training or anything else....... ''Really?I''m unemployed, but I''m getting by. That''s not some kind of mistake...? It''s true, though. Since the S class, when I claimed that I was "unemployed", people didn''t believe me at all. I believe it! If you think about it, Ark-san, who was only 8 years old, was that strong.........................There must be a secret that no one knows about, right? I guess it''s more of a secret, I just trained the way my father told me to train. Like me, he was ''unemployed'' and spent years mastering every skill he could on his own. When you think about it, he''s a real monster. If it was me, I would have given up when I was "unemployed" to begin with. By the way, my father used to say that you don''t need skills to become strong, what''s important is that you don''t set any limits. ''''........She''s an amazing person. I''d love to meet him if I get the chance. 219-Episode 43: Ill beat you Celestia remembered that day four years ago clearly. She was eleven years old at the time. It had only been a year since she had received her blessing. Unable to fight the demons, she was hiding in a crypt with a few soldiers and maidservants while the royal capital was attacked by a horde of undead. ''''........Father......Brother.......'''' And don''t worry, Your Highness. Your Majesty and Her Royal Highness will be safe. The intelligent woman could hear the trembling in the voice of the maidservant who encouraged her to do so. The situation was not good. Her mother, the queen, had died when she was very young. What if her father and brother hadn''t come back? Just imagining that future was enough to make my body tremble. But the Grim Reaper''s Scythe was the first to come hunting for the lives of the young royalty. What appeared after destroying the cellar door was a fearless chimera that was a fusion of multiple creatures. Moreover, the one who was twitching the chimera was an old man who claimed to be a leader of the Demon King''s army. The soldiers in his bodyguard were easily killed, and Celestia realized that he was dead. No, it would still be better if they just killed him. It was an unbearable humiliation to be turned into the undead and become a puppet of the enemy for eternity. Then a boy appeared. ''''Hey, it''s not safe here!Run..........! At first I thought a normal child had wandered in and exclaimed so. After all, he was a year smaller than Celestia, who was eleven years old. But he didn''t falter at all in the face of the chimera, on the contrary. Don''t worry, I''ll take him down. I showed him with a confident declaration. There was no way I could do that. It''s a common heroic desire for boys of this age, but in front of this reality right now, nothing but tragedy can be produced. And what unfolded in front of the impatient Celestia was the exact opposite of what she expected. A boy has defeated the chimera and then the necromancer with overwhelming strength. As I stood there dumbfounded in front of the unbelievable scene. ''Oh....'' By the time I noticed, he was already gone in the basement. ''I didn''t even get to thank him... or his name...'' I don''t even know his name, that boy. I don''t even know if he lives in the royal capital or not. Celestia has been living with regret about that day ever since. Why didn''t I thank her? Why didn''t I ask him his name? As the months passed without having the opportunity to meet the boy, these thoughts did not fade, but grew stronger. (I never expected to see him again in this way...) Celestia''s heart was racing as she glanced at the profile of the boy sitting right next to her. Although he was now twelve years old, he had grown up more than he had four years ago, but he still looked very young from her fifteen year old. And yet, he felt as if he had a dependable, mature man by his side. ''''........Celes-san?'''' Huh! I couldn''t help but watch. With a flushed face, Celestia hurriedly stood up. ''''Thank you for coming all the way here today!Well, I''d better get back to it now. Oh, yes. I''m tempted to talk more, but that''s the limit for today. I''m not sure if I''m going to be able to get it right, but I''m sure I''ll be able to get it right. Celestia hurriedly left the place so that her reddened cheeks would not be noticed. ''''Your Highness Celestia!'''' I was just coming back to the girls'' dormitory when I heard a voice calling my name. When I turned around, a faculty member from the academy rushed over to us with a somewhat panicked look on his face. ''''What''s going on?'''' As a matter of fact, a few minutes ago, a messenger from the royal palace arrived. Celestia wondered what was going on. ''His Majesty the King wants you to return to the Royal Palace as soon as possible. Your Majesty? ''Yes, sir. The carriage is already ready for you. It''s very sudden. This had never happened before. It must be very urgent. While feeling uneasy, Celestia got into the carriage that was prepared for her. It was a royal carriage with the royal coat of arms inscribed on it. It takes several dozen minutes to swing in the carriage. Celestia arrived at the royal palace and headed to her father, the king. ''.........Celestial. No. So, what are you talking about? Just when I had a bad feeling about my father''s extremely clipped appearance, a voice interrupted me from the side. ''Oh!My dear Princess Celestia!It''s been a while! ......... Turning around, Celestia couldn''t help but contort her face. The man there was a middle-aged man who looked like an orc, as it were. His age was in the mid-thirties, younger than he looked. He wasn''t very tall, but that gave him a wide, sideways body shape. Perhaps due to his inadequate life, the hair on his head was already thinning and he was sweating just by walking. ''''Oh, Your Highness the Crown Prince........'''' "Ho-ho!You remembered that!I''m very happy for you! How could I forget? After all, he is the crown prince of the Hanbalada Empire, a neighboring kingdom here in Edelheid. And you look more and more mature and beautiful!As your fiance, you have a nose for it! --he is Celestia''s fianc. ''''What kind of a case is this, at this time...? Actually, sir!I have come all the way from Hanbalada to hasten the time of your marriage! What...? 220-Episode 44: You Should Refuse ''Sister Ceres?What''s going on?You''re not feeling well? That day, Leila noticed that something was wrong with Celestia. ''Nah, it''s nothing, Leila. ''It''s not nothing!I don''t have any energy! Celestia shook her head in an attempt to not make you worry, but that didn''t get through to Leila. You can''t say that Leila can understand people''s feelings, but even such a person can see that Celestia today was wearing a heavy atmosphere. Of course, the others had noticed that as well. But the other party was the princess. We can''t even pursue that situation in depth. ''''What''s wrong?Leila will consult with you! It was because Leila couldn''t read the air like that that she was able to step in. ''''........Yes, that''s right.'''' Maybe Celestia would rather have someone to listen to her. She nodded at the pretty junior''s offer and found herself starting to talk about the events that happened yesterday. ''''Actually........I''m getting married.... Huh?Married?Sister Ceres? ''Yes. In case you''re wondering, I''m the one who''s been in an engaged relationship for some time... The Empire of Hanbalada is a neighboring country of the Edelheid Kingdom. The story of her marriage to its crown prince began with a request from the other side, before Celes had yet received his blessing. But Celestia is not even ten years old, while the Crown Prince is already in his late twenties. His Majesty politely declined, taking into consideration the relationship with the neighboring country. Incidentally, the crown prince and Celestia had met only once at that time, and Celestia had no recollection of the other party. The reason things had changed was because of that crisis four years ago. Although the Hanbalada Empire''s territory bordered Edelheid, it was fortunate that it was diverted from the Demon King''s army''s marching path, so it did not suffer too much damage. From the beginning, the Hanbalada Empire had almost double the national strength of Edelheid. On top of that, Edelheid was the only one to suffer a great deal of damage, which further widened the gap in the power relationship between the two countries. In such a situation, the number of nobles who claimed that Edelheid was the one to blame for the loss of power was increasing. For the Edelheid Kingdom, the only way to maintain good relations with the Hanbalada Empire was no longer a political marriage between the Crown Prince and Princess. That''s what happened. ''What!Why don''t you just say no to that! That''s not going to happen. I''m royalty. I''m royalty and I have to put the affairs of this country before my own. If this engagement was broken, there could be a war if it was not done well. An all-out war would result in the loss of many lives, and Edelheid, with its declining national power, would be no match for the Empire. When weighing her own future and the fate of this country, Celestia could not choose herself. ''''Boo.'''' Leila''s lips twitched in frustration. There was no way she could understand the situation of the royal family. ''''It''s just........Originally I was going to say after I graduated from the academy, but....... It seems that the other side wants to hurry up. Marriage in itself was depressing, of course, but that was still good because she was ready for it. But it was still almost a year away, and I thought I could spend the last of my time at the Academy. The fact that even that might not be possible was the biggest shock. ''''What?So, Celes, how long are we going to be able to stay together...? ''....months at the most....and if it''s shorter....it could be sooner.... Yeah! I thought I yelled loudly, but Leila jumped on Celestia. ''Oh no!How did you do that?I don''t want to lose my sister Celes! I''m sorry... Stay until Leila graduates! Well that''s not possible to begin with. Celestia is a fourth year student. No matter how hard she tries, it is impossible for her to graduate with Leila. ''''Uu~'''' I''m sorry. While apologizing, Celestia was glad that this lovely sister had missed her so much, and that she was sorry to be separated from her. The announcement of their engagement came five days later. On this day, Leila and the other students of the Royal Academy were participating in the regularly scheduled King''s Speech, which took place in the square in front of the Royal Palace. This was held in the square in front of the Royal Palace and was open to the public. But on this occasion, only a select group of people were allowed to attend. After all, it was the engagement of the handsome and popular Princess Celestia, and the neighboring Crown Prince, who was 20 years older and less than flattering in appearance. In some cases, the participants were opposed to it and there was a risk of a riot. In order to prevent that, the participants were to be carefully selected. That was why the students of the Royal Academy had been mobilized in a hurry. Although the matter of the engagement announcement was kept under wraps, the teachers had strongly warned them beforehand that no matter what the content of the engagement announcement was, they were to listen to it to the end in a manner befitting a student of the Royal Academy. And in the unlikely event of an emergency, they have been strictly ordered to cooperate with the Knights. Because of that, most of the students were waiting for His Majesty the King to appear with a nervous look on their faces, wondering what kind of speech he was going to give. 221-Episode 45: OK The king of this country is named Rahardt-Edelheid, and he is Celes'' father. I remember meeting him four years ago, and he called me "you" and Leila called him "uncle", which made me nervous. I remember I was on edge as I watched. People around me who seemed to be in charge looked at him, but the king himself didn''t seem to be bothered by it. But now King Rahardt is speaking in front of the crowd gathered in the square in front of the palace. It seems that the King''s speech is held periodically, but all of us students at the Royal Academy were forced to participate in it. It seems it was decided at a moment''s notice, and just before the event, the teachers told the whole school that they were going to hold it. It seems that a big announcement will be made in this speech, and there will be something "just in case". They didn''t tell us what it was all about, but ''Whatever it is, you must listen to it to the end in a manner befitting a student of the Royal Academy. We were dubious, but we had to obey. ''''If you ask the upperclassmen, they''ve never done anything like this before. We''re allowed to carry equipment, so seriously, what kind of announcements do you think they''re going to make? I''m the wrong person to ask... I''m not familiar with this country and I have no idea what to expect, although Ranta said it with a nervous look on his face. However, since we are strictly ordered to cooperate with the knights in case of emergency, we are probably expected to be an asset to the war effort. In other words, does that mean it could even lead to a riot if it''s not done well? Looking around me, I saw that everyone''s faces were as tense as Ranta''s. But despite the tension, the speech that began seemed to be quite ordinary. But in spite of the tension, the speech that began seemed to be quite ordinary. The audience listened quietly. What do you mean by that? Nothing is going to happen, okay? The students of the Royal Academy now nodded their heads. ''''Last but not least... I actually have some good news to announce to you all! Good news? We nodded our heads further. At this rate, it doesn''t look like the danger we were expecting was going to happen. That''s when most of the students in the academy relaxed and felt relieved. Then the king spoke those words, and the hall instantly fell silent. ''My daughter, Celestia, is now engaged to be married! What? At first, I couldn''t understand what he was saying. Celes-san........you''re only 15 years old.......right? At any rate, my feeling was that the topic of marriage would not come up until after 18 years of age at the earliest. Of course, my previous life has had an effect on me. In Japan, it was normal for people to get married much later than eighteen. But I wasn''t the only one who was surprised. The audience was in an uproar. ''''Oh, it''s not true........the princess is.......? Seriously.... But I''m okay with it if you''re happy. It''s not OK! But what surprised us even more was the fiance who followed. "This is Prince Abdul, Crown Prince of our friendly nation, the Hanbalada Empire! ""What?" It was an old man for all intents and purposes. His age was estimated to be around forty at a young age. He was small but big and fat, and his hair was quite receding. Eh...? Celes, are you going to marry that guy...? It''s Abdul, who you entrusted with the introduction!I first met Princess Celestia when she was just a little girl, but I remember how beautiful she was back then, and I don''t remember her being a child!And now you have a beauty that is unparalleled on the continent!It is a great honor to have her as my wife! That crown prince, whose name was Abdul, proudly spoke of Mr. Ceres. On the other hand, Mr. Celes, who appeared on the stage late, was standing behind Abdul with a languid expression on his face. The words "political marriage" pass through my head. No matter how you look at it, this is it. For some reason between countries, Ceres-san was forced to marry the crown prince even though she didn''t like him. But even if I was convinced of that, it doesn''t mean I could do anything about it. In Japan it would be a clear violation of human rights, but this is a different world. I suppose political marriages are not uncommon. Nevertheless, judging from the upset and indignation of the people around him, there are few people who are convinced of this disproportionate engagement. I think Ceres is popular, too. But due to the people of the monstrous Order looking around with their sharp eyes, no one can raise their voice. There was such an atmosphere that if they showed even the slightest opposition, they could be taken away immediately. ''''Wait a minute! Suddenly, a loud voice roared out. Everyone''s eyes turned to the owner of that voice. .........you mean, Leila! It''s still crazy! It was Leila who raised her voice. Although a little confused by the fact that the culprit was a student of the academy, the knights immediately began to move. But Leila didn''t care about that and thrust her fingertips at the crown prince who was on the stage, and Because being forced to marry that creepy, balding, old man is worse than being dead! It was so disrespectful. 222-Episode 46: Isnt it a bit too painful? ''Gruaaaaaah! Hmm, so you''re Bahamut. I nodded in front of a huge jet black dragon that spread its wings wide to intimidate us. This evil dragon, called Bahamut, is said to be a mythical class of demon, along with Behemoth and Leviathan. Why am I confronting such a demon now? It would be a long story, so I''ll try to summarize it briefly. Ark and Leila are gone and I have no time for them. Fear is only two years old, so I can''t train her (she was stopped by Laina in the first place). So we went on a trip for a while. Then we found a large island in the sky. It was inhabited by people with angelic wings on their backs (but they can''t fly). They were suffering from the damage of a jet black evil dragon. Due to various reasons, they decided to go and defeat that evil dragon, Bahamut. Up to the present. And well, it goes something like this. ''''Gluaaaaaah! It seems that this evil dragon, unlike Befi and the others, is unable to communicate. Moreover, it seems to have a rather violent and belligerent character, and just by entering their territory for a moment, they become angry. ''''Hm?'''' I had a bad feeling, and I flew to the side as quickly as I could. Cackle - doooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! Then, in an instant, a light passed through the place where I was just now. Apparently, it spat out a ray of light from its mouth. When I looked back, the ground had been gouged out in a straight line for several tens of meters. That''s quite a powerful thing. This time it''s our turn. Huh? "I''ll close the distance with my god''s fast feet and deliver a slash to its gut. However, due to the hard scales that are typical of dragons, it was not a fatal wound. It was only a one-meter long wound to the giant body at most. ''''Ahhhh! Isn''t he in a little too much pain? Bahamut screams loudly and in agony for it. Maybe it''s because he didn''t have a natural enemy until now, or maybe his tolerance for pain is low. Kaa----dooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo! Ka-o-o-o-o-o-o-ooh! Ka-o-o-o-o-o-o-ooh! You''re firing too many shots! Bahamut fires a series of haphazard shots without even aiming a beam of light at it. Since it''s too late after seeing it, I use my premonition-level intuition to avoid all of them. ''''Hm?'''' What I thought then was that Bahamut flapped his wings and flew into the sky. As I wondered, Bahamut just flew away. ''''Wait a minute. You''re not trying to escape? It was like that no way. Bahamut''s huge body was getting further and further away from me. "No, that was just a greeting. I hurriedly flew through the air and chased after Bahamut. ''''A mythical grade demon is trying to escape!Come back! Grrrr! I had no choice but to continue chasing Bahamut, but the opponent is a demon that lives in the sky. I was confident in my flying speed, but before I knew it, I found myself gradually being separated from it. Eventually, they only look like bean grains. ''''Hmm........what should I do?'''' Because being forced to marry that creepy, balding, old man is worse than being dead! Leila''s voice echoed through the square. The hall instantly fell silent at the ridiculous insult to the crown prince of another country. Hey, what are you doing, Leila! I shudder at what my twin sister has done. But.........what Leila says is never wrong. Even though it was a political marriage, I couldn''t forgive Celes-san for marrying such a creepy old man. ''''Or, she''s right........'''' What''s wrong with Her Highness, that balding, fat guy? Yeah, yeah, yeah!I won''t allow any engagement! Then some students began to speak out, forgetting that the teachers had warned them. More and more of them agreed with them, and the voices of opposition spread one by one. ''Nah, nah, nah...'' As for the Crown Prince on the stage, his face is flushed with anger and shame, and his mouth is crunching like a washed-up fish. ''''Shh, be still!'''' You will be taken away for treason! The knights hurriedly threatened, but the opposition grew louder rather than subsided. ''''King Rahart, what does this mean? Oh, slow down, Master Abdul... I don''t know how I''m going to stay calm with this kind of humiliation. Crown Prince Abdul seemed to be furious and grabbed at the king. When he was somehow pulled off by the knights, the crown prince, breathing heavily, loudly announced to the booing royal citizens, "War! ''''It''s war!An empire as weak as this one could easily destroy a nation as weak as this one!When the victory is won, all of these foolish king''s people will be enslaved by our nation! The war...? The Empire and...? "Well, seriously... It seems that the King''s people, who had been getting hot and bothered by the Crown Prince''s statement, finally understood the meaning of what they had done. The king-sama and Celes-san are both pale. If it were to become a war, the kingdom''s side, which is inferior in terms of national strength, would be at a disadvantage, without a doubt. I weaved my way through the crowd of people and finally arrived at Leila''s place. Hey, Leila!What the hell are you doing? "Spitzer? A fluent sister who tilts her head in the air with a big smile. From there! ''Gruaaaaaah! ? It was right then that a deafeningly powerful yell came from the sky. 223-Episode 47: Getting time alone for a while ''Gruaaaaaah! A deafening yell fell from the sky. I hurriedly looked up at the sky, and there was a jet black dragon spreading its wings wide. ''''Wah, wyvern...?'''' No, it seems too big for that...? The people in the plaza also look up at the sky and have an uneasy expression on their faces. The reason they are still calm is probably because there are many knights here, so they don''t think it''s that dangerous if a demon appears. ''''Leila........that was.......'''' Uh, yeah it''s not a wyvern, is it? That demon''s presence that we are feeling is incomparable to the wyvern. If it is not good, it could rival Befi and the others. The closer it came to the ground, the more noisy the surroundings became. ''''Oh, hey, hey.......'''' ''Wait a minute.......what the hell is that size.......? What the f*ck is this? The vast square was shaded by the monster. It was so huge that the perspective was almost out of whack. ''''Ah, that''s........ba, ba, ba, bahamut oh! Someone shouted. A mythical grade demon, Bahamut. The one that appeared in the square during the king''s speech was a jet black evil dragon that reached two hundred meters in length. ''''Waaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa. The people screamed as if they had been dammed and fled at once. It turned into an a-hole of shoving and squeezing each other. ''''Ze, all of you, take a stand!Let''s fight off the demons! How did you get that monster? I want to hear it!But that''s our role!Show me your knightly pride! The knights are forming a desperate formation and are about to intercept the approaching giant dragon. ''''Hey, hey........that, could it be crashing into the ground.......'''' If that big one had just rammed into us.... But I don''t think they can handle the huge bodies that are falling like meteorites while they are just stunned in front of them. "Leila, let''s go! Yeah! If we don''t, there will be enormous damage. Me and Leila nodded to each other, then kicked the ground and flew up into the sky. The huge body approaching with tremendous force. Its power is still on par with Befi and her friends, or even more so. ''''I''ll take it! Hey! Me and Leila join forces and use yellow magic. ''''Metal Shield!!!'''' What emerged was a gigantic metal shield that was over a hundred meters wide and ten meters thick. Bahamut crashed into it without slowing down. Zuduo! ''''~~~~~~~~~!'''' The sound of the explosion roared and me and Leila were blown away by the uncommon impact. We were knocked to the ground and a large crack appeared on the cobblestones. ''''Leila-san!Mr. Ark! I thought I heard Mr. Ceres scream. But we''re safe. We don''t have a soft workout to get beaten up like this. ''Grrrr........'' When I looked up, I saw that Bahamut seemed to have suffered damage from the collision as well, and was dizzy and hovering in the air. He may have suffered a concussion from a head-on collision. "''Divine Sky Slayer''. I quickly released a series of slashes while flying into the sky. I hit Bahamut''s huge body one after another, but didn''t cause much damage to its hard scales. ''''Huh?'''' That''s when I suddenly realized that there was a bigger wound in Bahamut''s abdomen than I had just inflicted. There was a bigger wound on Bahamut''s abdomen than I had just given him. By the looks of it, it gives the impression of a cut. And it''s still fresh. Was this wound inflicted by some other demon? But what kind of demon would give Bahamut that many wounds? Or......... Meteor Strike! While I was thinking about that, the meteorite that Leila had created with magic had collided with Bahamut''s abdomen. ''''Gruaaaah!'''' It''s not working very well! It was a powerful magic that had given Atlas a fatal wound, but it had only made Bahamut scream in agony at best. .........That guy''s scales, maybe they were harder than Libby''s. ''''Huh?'''' Just then, a strong chill ran down my spine. Intuitively, I jumped away from the place. Ka-... The rays of light that were spat out of Bahamut''s mouth scraped right past his side. --Doh-oh-oh! After a moment''s delay, there was a tremendous explosion from behind. When I turned around, I saw that part of the outer wall of the castle had completely disappeared. ''''Danger........'''' We would have been in trouble if we had taken a direct hit from that one. But the crisis has not gone away. I have a bad feeling again. Bahamut is about to unleash its next blow right away. Moreover, because of the change in position between me and him, his mouth was pointed towards the ground. ''''Explosions!'''' Huh? Kah-- Just before he was about to release it, Bahamut''s ray of light disappeared into the sky as the magic exploded under his chin. ''Leila, thank God!We need to direct the attack upwards as much as possible! Yeah! As the rays of light turned toward the sky, Leila and I flew above Bahamut''s head. While releasing slashes and magic and evading the rays of light, we rose into the sky like a spiral with Bahamut pursuing us. Somehow this will prevent any damage to the ground........ ''''How are we going to defeat this guy?'''' It seems that the attack isn''t working very well after all. There''s still plenty of time to spare, but I didn''t want to fight on and on. "I have an idea!Ark, buy yourself some time alone for a while! ''What?Wait, Leila! Leila suddenly takes off. Bahamut seemed to be unsure of which one to prioritize for a moment, but his hate for me was winning out, and he just went after me. 224-Episode 48: You cant change your belly on your back Bahamut''s sharp paws snatched at my back. When I lost my balance due to the wind pressure generated, it now radiated light from its mouth. ''''Ice Shield!'''' I managed to deflect it with the ice shield I created on the spur of the moment, but Bahamut''s onslaught didn''t stop. Because Leila said, "Buy yourself some time alone for a while" and took off, I was forced to take on this mythical-class demon alone. .........Really, don''t say it so easily. ''''I can''t do this alone........!"The alter ego! I gave up fighting on my own and created five alter egos. I used to be limited to two at a time, but I''ve been able to increase the number through training since then. However, unlike the "afterimage", this one puts a lot of strain on the brain, and unlike his father, it can''t last for a long time. Besides, his grandfather and grandmother had warned him that it was dangerous and he should use it when he was more mature. Unfortunately, I have no choice but to use it now. ''''Huh?'''' Bahamut is clearly confused by my sudden increase. ''''Grrrrrr!'''' It seems that Bahamut thought it would be easy to take them down one by one in turn, and he leapt at the nearest alter ego. But a slash from a different direction hits the head. ''''Over here, Bahamut! Grrrr! No, it''s really me. Grrrr! No, no, no, no. I''m the real thing. "~~~~? The six of us, including the main body, surrounded Bahamut and tossed him around. Then, as if his frustration had reached its peak, Bahamut spat out the largest ray of light ever in his mouth and turned his head in a circle. I guess he wanted to round us up. But the move was easy to read. The six of us all easily avoided the rays of light. ''Gruuu...'' He was apparently exhausted from emitting too many rays of light. Bahamut exhales weakly. ''''Ark, hold on!'''' Leila caught up with me there at just the right time. ''''Ah.'''' Perhaps sensing the danger, Bahamut suddenly begins to fly in a different direction. ""Shall we let him go?" To keep them from doing so, we fired a series of slashes into the sky to stop them from escaping. Let''s go!Illumination! Leila released a spell that we both invoked four years ago. ''''~~~~? The magic that makes everything disappear doesn''t produce any flashy changes or loud noises. The matter in front of me just disappears completely. As expected, it couldn''t erase all of the giant body over two hundred meters in height, but Bahamut''s entire chest disappeared. The mythical evil dragon couldn''t possibly sustain life with this, and it lost the light from its eyes. And so it fell to the ground. Zdooooong! With a loud earth shaking, Bahamut crashed to the ground. This is the vast plaza where the King''s speech was held. There was no other place in the city where this giant body could be dropped, so Leila and I made some minor adjustments to make it fall here. Fortunately, the evacuation of the general public was over, and the knights fled in a hurry when they saw the giant body falling from the sky. ''''Ah, it''s all right now! He''s dead! When the dust cloud has settled, we call out to the stunned people. Are they really dead...? You didn''t think you''d beaten Bahamut...? Oh, my God... But people are too scared to come close. Bahamut''s life activities have been completely stopped, and it''s okay........ ''''Leila-san!'''' Oh, Ceres! In the midst of all this, the first one to come running over here was Celes-san. As it was, she jumped at Leila. ''''Hoho?'''' ''Are you okay?Are you hurt? As you can see, I''m full of energy, okay? Thank God. I was so worried about you! Then Miss Celes turned to me. Mr. Ark... Oh, yes, I''m with you on this one. You know, injuries can be healed with blessings in the first place. I''ve overworked my brain so much that I''m just a little tired. ''''Oh, oh, that''s impossible! When I heard a loud voice and turned around, I saw that Crown Prince who had poked his butt in front of Bahamut''s corpse. ''''Well, well, well, no way, just two people defeated Bahamut! Well ... yes, but ... Hee! As I replied, the crown prince paled and retreated back about a meter with his butt on the ground. ''''This, this is the kind of monster that exists in this country!No, you can''t!If we go to war, they''ll destroy our country! The crown prince shouted this with tears in his eyes, and then he bowed flatly before the king of this country who was nearby. ''''Well, I take back what I just said!Please, forgive me!Please forgive me! The crown prince''s change of heart, while showing some confusion. So does that mean you''re not engaged to my daughter, too? Of course I do!It''s a shame that I won''t be able to marry Princess Celestia............... And so the Crown Prince, supported by his soldiers, left as if to escape. 225-Episode 49 The Crown Prince accepted the annulment of the engagement and left as if to escape. Looking away from it in a daze, Celes-san muttered. ''''Could it be that this means I don''t have to marry that pig-like man...? Well, Celes, you''re being honest! ''''That''s right!You did it!Ceres sister! ''Yes, yes.........Leila, it''s all thanks to you! I knew I should marry the man I love! You''re in love with... For a moment there, I thought Celes-san glanced my way. It was my imagination, right? No, no, it would be ideal if it were possible, but I''m a princess... ''Eww, you don''t have to worry about that! ''It''s not like that...'' As they were arguing, the king came in. Celestia I''m sorry. I''m sorry that I wanted you to marry the man you hated so much, even for the sake of your country. Indeed, that was nothing but a pig. King, I just heard Celes call you a pig earlier..... But you didn''t say "nothing but a pig", did you? Father.... ''''Even so, how can I thank you guys........ I didn''t expect to defeat such a monster........and that uniform, a student of the Royal Academy.......hmm?That red hair looks like something I''ve seen before... And that''s when. Me and Leila felt a nostalgic feeling, and we looked up at the sky together. "Wow!Dad! It was his dad who fell from the sky. Leila happily ran over and hugged her dad. ''It''s been a while, Leila. How are you doing? ''Yes!I''m fine! Dad?Why are you here? No, actually... My father answered my question by looking back at Bahamut''s body. ''We''ve been chasing this guy. We were fighting him, but we let him get away. What? So it was your father''s fault that Bahamut came here? Well, you two beat me, so I guess it''s all right. Yes, but......... And depending on how you think about it, that''s why Celes-san was spared from marriage, but....... As I was having mixed emotions, for some reason the king looked at his father and was surprised. ''''Ki, you are.........! Hmm? Are you sure you''re not the same young man who saved our country four years ago? "Hmm? Dad is tilting his head. Apparently he''s forgotten about it. ''Dad, it''s the king of this country. Four years ago, I stopped in this country on my way to the Demon King''s Castle, and I''m sure we met then. Was it? No, still!You''re the one who slayed the Witch King!Yeah, right!Then they were the kids who were with you then!No wonder you''re so strong! The king, alone in his excitement, raised his voice and ordered his men. ''A feast!Prepare for the feast!A grand feast for the heroes who have saved our country, no, the world! But then again, I didn''t know you were the child of a hero who saved the world. No wonder you''re such bullshit. Ranta says dismissively. ''I''m nothing compared to your father, though. ''''No, no, no, when two people take down Bahamut, they''re both on cloud nine. Hey, Ark-sama? Don''t call me that... It has already been a few days since the King''s Speech the other day. Because it became known that I was the child of a hero who defeated the Demon King, everyone was calling me "sama" and even I was being treated like a hero. In such a situation, Ranta was one of the few friends who kept up with me in the same manner as before. Incidentally, after receiving a country-wide welcome as a hero, his father said something like, "Maybe I''ll go to the demon world next time." and left. ''''Bad, bad. By the way, aren''t you going to switch places with Leila again? I won''t do it again. Don''t say that. Why do you look like you want them to switch places so badly.... In general, that''s Leila''s way-- Hey, Ark! .........................If you talk about it, it''s called a shadow. I frowned at the unpleasant feeling. Why had I been replaced again? Wearing Leila''s uniform, I felt like cursing my weak will. That also means that I broke under Leila''s forceful push, but.... But that''s not all. Let''s be honest. If we switched, I could be by Celes-san''s side again. I''ve been defeated by her powerful charm. I know that I can''t... I''m such an idiot! ........There''s no point in being depressed. Let''s play Leila properly and come back to the boys'' dormitory safely. ''Leila-san?Where have you been at this hour? Just for a walk! It was just about bedtime, so I went to Leila''s room in the girls'' dormitory and was greeted by Celes-san. She''s in a lovely sleepwear that you can''t see unless you''re here. Alisa-san was probably in the bathroom or something, but I couldn''t see her, and Rikka was laying on the bed reading a book. She looked at me through the book and grinned, so she must have recognized that I had been replaced again. ''It''s time to go to bed, right?'' ''Yes!Good night! Good night. I don''t know what I thought, but Celes-san came closer as she said that. As it was, she squeezed me tightly. ''''~~! "Hmmm, this is what helps me sleep peacefully. The softness of Mr. Ceres and the good smell of him turned me on, and I probably couldn''t sleep! ...? Suddenly, Celes-san tilts her head. Then suddenly, she pulled away from me and looked intently into my face. ''''Leila-san...not...not...?'''' What? You''re in? 226-Episode 50: Still not good now Leila, it''s not...? I shuddered at the words Celes-san uttered. I tried to deny it in a hurry, but Oh, you''re not Leila, are you? What are you talking about, Lisa?Leila is Leila! No, no!It''s similar, but it smells a little different from Leila-san! The smell! And the mole on his face is in the wrong place! That''s it! Mr. Celes, how much detail do you know about Leila? No, come to think of it, it''s been a long time since I entered the school. We''re in the same dorm room, and now we''re in the same seminar. It''s only natural that the longer the two of them are in contact, the easier it is to notice the differences between them when they are replaced. Aaaaah! Why didn''t I think of something so simple! The replacement should have been the last time they replaced him! And, of course, you don''t have to guess who they replaced it with-- Ark, Mr....? I gave up and surrendered. It''s not a good idea to resist, but if you resist here, it will only make the impression worse. ''''Yes that''s right I''m sorry....'''' The next day, I was gathered in an empty classroom with Leila, Ms. Celes, and Rikka. Celes-san hadn''t uttered a single word since a while ago, and that was very scary. ''''........Did you know about this too, Ricca-san? Yes. I knew it. Why were you complicit in this? It looked so interesting. It looked interesting...? At Rikka''s oblique words, Celes-san raised her eyebrows. Rikka, who says clearly to the princess-sama counterpart, is the same as always. ''Well, well, we can talk about you later. First of all, Leila. It is correct to say that this matter was brought up by you, isn''t it? Yeah, I do. May I ask why? I wanted to go to the martial arts department as well! And Leila, who happily tells the truth, is still the same. But I''m glad you told the truth. If this is the case, I can be treated as a victim too........or not? The two of you are the opposite s*x.Inevitably, that means sleeping in a dormitory of the opposite s*x!If they find you, you''ll be expelled! Hmm, I think I''m okay with that. Mr. Leila. As expected, Celes-san is also dumbfounded by Leila. Yeah, that''s good. The flow of the source of the problem is completely Leila. ''''........Why did Ark-san comply? ''Well first Leila forced me to ... and then Rikka threatened me. She said she''d spill the beans if I didn''t do what she said. Both of those things are true. Oh, come to think of it, I''m really not a total victim, am I? Mr. Leila, Mr. Ricca, are you sure? Yeah! It''s true. They both nodded clearly. ''''Huh.... Celes let out a deep sigh. ''''What are you doing at all........ .........It can''t be helped. Normally, this is a matter that should be reported to the academy and punished...................You guys owe me. Let''s meditate on this case. I let out a breath of relief. ''Thank you, Celes, thank you. ''''But..... And there, for some reason, Celes-san''s sharp gaze shot through me. ''There''s one condition for that. Can you tell us all about when the two of you were switched, what you saw and what you did there? ''What?'' That''s not good! Because if they know about it... I''ll tell you. Wait, Ricka! ''At first, about a week after I started school. I went to class instead of Leila, and at night I went to the girls'' dorm bath-- Ohhhh! ''''I didn''t expect you to go to the big bathroom... and I didn''t expect you to think it was Leila... and that sleepless day you slept in bed with me...'''' When Rikka finished telling her everything, Ms. Ceres was plodding and shaking. Oh no! I''m freaking out! My face is as red as an apple! Glancing sideways, Rikka grinned and smiled happily. This guy.........! "I mean ... that I ... allowed Mr. Ark to see ... and ... and ... and ... and ... and ... and ... and ... and ... and ... I''m sorry! I got down on my knees on the spot. Even if I am reborn, my soul is still Japanese. I had no choice but to apologize. I''ll take whatever punishment I can get! Mr. Ceres looked red-faced and silent for a moment, and then ...Oh, Ark-san. I''m going to ask you to take responsibility for this. Yes..... Hmm?Responsibility? What''s the complaint? ''No!Of course, I''m willing to accept whatever it takes!So what do I do...? That''s...oh, I''ll tell you after you graduate from this academy! What?Not now! No, not yet! For some reason, Celes-san turns redder and redder and refuses. I''d be more than happy to tell you right now. Maybe that''s a punishment in itself? If so, that''s pretty mean. It''s not like you, Celes-san. But if it''s to appease Celes-san''s anger, I''ll just accept it. I''m not sure if this is the right way to go, but I''m sure it is.