21Novel

Font: Big Medium Small
Dark Eye-protection
21Novel > Mushoku no Eiyuu ~Betsu ni Skill Nanka Iranakattan daga~ > 29-Episode 29: I have already mastered it

29-Episode 29: I have already mastered it

    What do you mean by that? The Sword Princess Phara is actually the Sword God! And how can you use that skill, Arel-san, to use it...?


    What it means is what it means.


    It wasn''t just the 《Sword Princess》 skill that I spent five years learning, but also the 《Sword God》 skill.


    I also mastered the 《Sword God》 skill at the same time.


    Or rather, I can say that the latter took up most of my time.


    The 《Sword Princess》 skill had become a thing in a little over a year, while the 《Sword God》 skill had taken him nearly four more years to master.


    At that moment, the pressure he could feel from the golden living armor suddenly increased.


    That alone seemed to put pressure on him, and the young man and the others slumped in place as if he had lost his back.


    ''''It looks like you''re going to get serious.


    The Sword God''s skill - divine possession.


    It is an unstandard technique that temporarily increases its own physical abilities by several times.


    Although the Sword God is unrivaled in every ability, including muscle strength, agility and dexterity, this boost further strengthens it, making it look as if a god had descended.


    ''''But I''ve already mastered that.


    I also responded by being possessed by a god.


    Those who had plunged into the realm of the gods collided with each other, and the impact alone caused a tremendous storm to erupt.


    Zugagaagaagaagaagaagaagaagaagaaga!


    The sound of a roaring sword fight is like an earth-shaking sound.


    ''''Wait, what is this? This is not a human battle! It''s almost a natural disaster!


    This is divine possession...?


    ''''I mean, aside from that one, the 《unemployed》 Aleru-san can even use the 《Sword God》 skill, so anything is possible already!


    Lilia and Laina are shouting at each other, almost blown away by the wind.


    ''''It''s not like anything is going to happen.


    The skills of the "Sword God" are even more demanding on the body than those of the "Sword Princess".


    This "divine possession" is especially so.


    In any case, they are forcing you to draw out a power that should have been unconsciously suppressed considering the burden on your body.


    Just by maintaining this state, the blessings are decreasing.


    But thanks to the muscle training or the training of "sturdiness", it''s much better than before.


    But of course, there''s no such thing as fatigue in front of me.


    Living armor is armor without substance.


    Therefore, it doesn''t cause muscle fatigue or loss of strength like humans do.


    As long as the exoskeleton-like armor is not destroyed, it will probably be able to continue to use the Divine Possession forever.


    In short, we need to get this over with as soon as possible, but--


    Perhaps disliking the stalemate, the Living Armor moved first.


    Is this........the 《Sword God》''s special skill 《Infinite Break》?


    A series of blows that would continue semi-permanently until the opponent died.


    Moreover, each and every one of those blows are so perfectly coordinated that when you take the first one, you''re no longer allowed to escape or even fall down.


    ''''But that''s a bad move.''''


    I''d rather not have the stalemate continue for me.


    If there was no lack of physical strength, they should have continued to cut each other evenly.


    When I learned that I could learn the skills of a swordsman even though I was "unemployed", I volunteered to become an apprentice to my mother.


    However, it''s extremely difficult to teach a person who doesn''t have the skills to learn swordsmanship.


    To begin with, she''s not smart enough to teach people anything.


    So basically, I learned the skills that she showed me by simply watching her, but of course it''s impossible to replicate the skills by simply watching.


    Hence, I thoroughly analyzed those skills.


    He understood every aspect of it perfectly: stance, breathing, eye movement, sword trajectory, etc.


    Infinite Break was no exception.


    Hence, this technique was not effective against me.


    I''ve figured out the moment the technique comes out, and I instantly crush it.


    With the first strike, the balance is exquisitely disrupted and the activation of the skill is cancelled.


    ''''Huh?''''


    The mindless golden living armor looked astonished.


    ''Payback.''


    The living armor is slightly stiffened as the special skill is prevented.


    I don''t miss that momentary opening.


    It''s only natural that he''s been aiming for the moment when he can reliably hit his special skill from here.


    I let loose with an Infinite Break.


    With a loud crash, the full body armor slammed to the ground.


    You can''t call it full-body armor any longer.


    The two arms were torn off and rolled over a long time ago, and the legs were bent in a different direction.


    The helmet is slumped over and is a shadow of its former self, and the body is barely connected around the waist, which could easily be split into two parts if you pulled on it.


    The golden armor had now turned into a mass of junk.


    ''''........I''m indeed tired.


    Convenience, fifty-eight.


    That''s the number of slashes I fired before I destroyed the golden armor to this point.


    I feel like the forty-second strike or so was already enough, but I had to be careful and destroy them firmly.


    These guys are powered by magic, so even if their arms are slashed off or their helmets are destroyed, they can normally continue fighting.


    I poked it with my sword with a thump, but it seems to have completely stopped functioning.


    ''''Was I saved...?


    The young man who set us up muttered in disgust.


    ''If only this guy was the only enemy coming out.


    ''No, no, no, don''t be scared!
『Add To Library for easy reading』
Popular recommendations
Super Gene Shadow Slave Cultivation Online Mecha Breaks the World Nine Star Hegemon Body Arts I Can Copy Talents